The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1055767	1068950	4735153		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1055767_1056529_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_151140361.1|1056522_1057149_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.1	1.7e-35
WP_001272592.1|1057288_1058428_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1058490_1059483_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1059576_1060941_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1061029_1061806_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1061810_1062449_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1062445_1063708_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1063704_1064613_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1064808_1065576_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1065626_1066283_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_085438572.1|1066388_1068950_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
>prophage 2
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1149991	1250454	4735153	capsid,head,terminase,holin,portal,transposase,tail,integrase,tRNA	Cronobacter_phage(45.83%)	103	1169590:1169606	1239302:1239318
WP_089566769.1|1149991_1151153_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000795662.1|1151520_1151727_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_000151178.1|1151747_1152047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572958.1|1152295_1152571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001422398.1|1153315_1153675_-	hypothetical protein	NA	M1PL54	Cellulophaga_phage	46.1	4.7e-19
WP_000614786.1|1156418_1157315_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_021570915.1|1157311_1158208_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_021570914.1|1158197_1159754_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.3	1.1e-19
WP_085947917.1|1159801_1161074_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001384082.1|1161372_1162602_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	2.7e-207
WP_000162574.1|1163345_1163828_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1163959_1164436_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1164425_1164716_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1164777_1165119_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1165267_1166929_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1167014_1167893_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1168015_1168609_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1168663_1169950_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1169590:1169606	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|1169970_1170762_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1170928_1172290_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1172538_1172787_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1172805_1173354_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1173384_1174152_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1174193_1174541_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1174616_1175099_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1175114_1176341_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1176330_1176849_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000976004.1|1176998_1177364_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1177573_1178644_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225229.1|1178654_1179776_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1179818_1180979_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1181077_1181125_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_077629794.1|1181288_1182308_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	57.2	5.9e-107
WP_000089404.1|1182347_1182647_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.2	5.9e-23
WP_000662537.1|1182755_1183037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853270.1|1183063_1183399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681788.1|1183408_1183978_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	50.5	7.2e-46
WP_071988497.1|1183980_1184199_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.2	2.4e-05
WP_032292416.1|1184238_1186896_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	46.5	1.8e-240
WP_000909748.1|1186964_1187684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224585.1|1187823_1188099_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.4	1.7e-24
WP_000746492.1|1188152_1189172_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	9.3e-137
WP_064670487.1|1189168_1190950_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.3	2.9e-250
WP_064670488.1|1191093_1191933_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.0	1.2e-44
WP_032295604.1|1191967_1192996_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.9	2.2e-133
WP_032292413.1|1193006_1193720_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	3.9e-65
WP_064670486.1|1193721_1193913_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.2	7.3e-11
WP_077760539.1|1194006_1194459_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	62.0	1.2e-46
WP_032292410.1|1194455_1194938_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	5.2e-37
WP_032292409.1|1194934_1195639_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	4.0e-70
WP_151140365.1|1195635_1196763_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	8.1e-174
WP_089587597.1|1196759_1197215_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_032292406.1|1197227_1197524_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
WP_032292405.1|1197520_1197862_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	8.1e-45
WP_032292404.1|1197861_1198194_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.5	3.3e-35
WP_072007678.1|1198120_1198354_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	3.9e-30
WP_032292402.1|1198340_1198598_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	2.8e-21
WP_151140366.1|1198785_1200753_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.7	7.5e-268
WP_032292401.1|1200749_1201079_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
WP_032292400.1|1201075_1202260_+	phage protein	NA	F1BUK6	Cronobacter_phage	78.9	3.3e-178
WP_032292399.1|1202252_1202840_+	protein phage	NA	F1BUK5	Cronobacter_phage	86.2	6.6e-95
WP_032292398.1|1202849_1204427_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	80.7	2.7e-135
WP_064670485.1|1204426_1205014_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.0	3.6e-56
WP_064670484.1|1205003_1205729_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.9	3.6e-58
WP_032292395.1|1205700_1206246_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	1.6e-63
WP_032292425.1|1206248_1207949_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.3	3.7e-223
WP_032187555.1|1208980_1210168_-	acyltransferase	NA	NA	NA	NA	NA
WP_000178456.1|1210311_1210653_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1210923_1211661_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1211795_1212776_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1212772_1213504_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_064670483.1|1213633_1216207_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000841103.1|1222061_1223360_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1223356_1223680_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1223725_1225081_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083005.1|1225194_1227855_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1227886_1228585_-	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
WP_001098726.1|1228653_1229073_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1229279_1230317_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1230364_1231054_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1231358_1231742_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1231797_1232385_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_053286107.1|1232487_1233369_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1233577_1234912_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1235043_1235781_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_001094491.1|1235765_1237388_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1237643_1237799_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1237795_1238371_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1238403_1239054_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1239053_1240010_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1239302:1239318	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589068.1|1240006_1240486_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1240683_1242483_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002541.1|1242498_1243473_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1243744_1244425_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020749.1|1244421_1245327_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399404.1|1245338_1246067_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1246078_1246810_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986023.1|1246809_1247190_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1247610_1247691_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196283.1|1247884_1248145_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001013779.1|1248200_1249049_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|1249257_1249893_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|1249917_1250454_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1463032	1475057	4735153	integrase,plate	Enterobacteria_phage(57.14%)	15	1459924:1459940	1477067:1477083
1459924:1459940	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_151140423.1|1463032_1463551_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.8	1.7e-54
WP_089519078.1|1463594_1464173_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	99.0	1.2e-109
WP_001614322.1|1464159_1464336_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_000753555.1|1464352_1464667_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041317.1|1464678_1465161_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_064670570.1|1465440_1466520_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.2	2.9e-205
WP_001259084.1|1466519_1467068_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424747.1|1467067_1467493_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_064670569.1|1467479_1468538_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.7	3.0e-202
WP_064670568.1|1468528_1469113_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.2e-112
WP_001349560.1|1470131_1470548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077878018.1|1470802_1471951_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	31.1	3.9e-30
WP_064670333.1|1472259_1472649_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	87.5	4.6e-60
WP_064670332.1|1472655_1473813_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.2	1.0e-219
WP_000368140.1|1474124_1475057_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1477067:1477083	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1715141	1724582	4735153		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670440.1|1715141_1716068_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.1	2.2e-23
WP_000783120.1|1716072_1716804_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1716784_1716892_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1716951_1717683_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1717904_1719590_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719586_1720306_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1720352_1720823_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1720862_1721324_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|1721448_1723449_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_064670439.1|1723445_1724582_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 5
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1816813	1824780	4735153		Klebsiella_phage(16.67%)	8	NA	NA
WP_064670358.1|1816813_1818208_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|1818365_1819361_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183034.1|1819603_1820497_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000699411.1|1820868_1821954_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000676086.1|1821953_1822817_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_001025599.1|1822820_1823216_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000971201.1|1823212_1823680_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000564888.1|1823676_1824780_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
>prophage 6
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1848919	1886536	4735153	lysis,holin,terminase,head,portal,protease,coat,integrase	Enterobacteria_phage(64.15%)	53	1843131:1843146	1868280:1868295
1843131:1843146	attL	ATTTGTAATGAACTGG	NA	NA	NA	NA
WP_151044111.1|1848919_1850098_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.5	3.4e-231
WP_000132739.1|1850078_1850270_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_032320906.1|1850300_1850468_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	94.5	1.4e-26
WP_122991675.1|1850540_1850825_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	4.1e-50
WP_151044108.1|1850817_1851036_-	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	97.1	1.6e-33
WP_001276453.1|1851032_1851218_-	hypothetical protein	NA	K7PJY8	Enterobacterial_phage	100.0	4.6e-26
WP_151044106.1|1851220_1851991_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	66.7	4.2e-89
WP_001214456.1|1852899_1853064_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_001111298.1|1853074_1853368_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_000168274.1|1853381_1853888_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_053880671.1|1853888_1854596_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_001243353.1|1854850_1855003_-	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1854987_1855119_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000005785.1|1855143_1856112_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_000392415.1|1856300_1856666_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
WP_000394305.1|1856725_1856977_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	1.4e-41
WP_151140369.1|1856985_1857291_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	89.7	4.9e-25
WP_000233125.1|1857658_1858027_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
WP_000428318.1|1858044_1858761_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|1858867_1859062_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000251073.1|1859170_1859464_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_151140370.1|1859644_1860535_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	99.3	6.4e-158
WP_151140371.1|1860524_1862990_+	helicase DnaB	NA	K7PGR8	Enterobacteria_phage	58.1	4.4e-233
WP_151140372.1|1863066_1863507_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	1.7e-79
WP_000984218.1|1863503_1863677_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113772.1|1863643_1863820_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001363895.1|1863822_1864182_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
WP_000950963.1|1864174_1864351_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_151140373.1|1864343_1864955_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	8.7e-98
WP_000144614.1|1864951_1865158_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_078204257.1|1865135_1865807_+	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	98.2	7.3e-130
WP_000512808.1|1865797_1866316_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	4.5e-95
WP_015966862.1|1866913_1867237_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
WP_000229392.1|1867220_1867697_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_151140374.1|1867693_1868131_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	96.6	1.1e-70
WP_001139680.1|1868118_1868271_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000583720.1|1868287_1868488_-	hypothetical protein	NA	H6WRZ7	Salmonella_phage	98.1	2.4e-20
1868280:1868295	attR	CCAGTTCATTACAAAT	NA	NA	NA	NA
WP_089583698.1|1868476_1869001_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.8	1.2e-87
WP_000807780.1|1869301_1869544_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	78.8	7.6e-29
WP_040090634.1|1869546_1869990_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	93.1	3.5e-64
WP_151140375.1|1869986_1871465_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	66.8	1.2e-180
WP_085455940.1|1871466_1873665_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_151140376.1|1873755_1874649_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	2.0e-127
WP_063119632.1|1874667_1875921_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.6	4.5e-234
WP_001389518.1|1875962_1876151_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_151140377.1|1876131_1876593_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	1.6e-83
WP_151140378.1|1876602_1878021_+	hypothetical protein	NA	Q716G7	Shigella_phage	98.7	3.0e-274
WP_142436681.1|1878020_1878869_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	1.9e-103
WP_151140379.1|1878868_1879324_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	4.4e-86
WP_137455329.1|1879326_1880019_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.1	3.9e-110
WP_069936398.1|1880028_1881435_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	55.8	1.4e-127
WP_151140380.1|1881434_1883276_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.1	1.3e-245
WP_104726698.1|1885504_1886536_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.9	9.1e-23
>prophage 7
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1932257	1942178	4735153	transposase	Burkholderia_phage(33.33%)	12	NA	NA
WP_085947917.1|1932257_1933531_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_072134966.1|1933574_1934384_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_044066597.1|1934671_1934857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313057.1|1934949_1935315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|1935354_1936050_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157230.1|1936116_1937535_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000786004.1|1937515_1937986_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001507517.1|1937974_1938895_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|1939067_1939985_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|1940063_1940246_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_071525573.1|1940328_1940523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001564714.1|1940483_1942178_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 8
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	1976146	2015660	4735153	integrase,transposase	Staphylococcus_phage(33.33%)	35	2005790:2005849	2021776:2021892
WP_024169776.1|1976146_1977346_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001685082.1|1977382_1977619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054834.1|1977771_1978086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|1978111_1978645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034167753.1|1978717_1979152_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_096106433.1|1981475_1984076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053266086.1|1984122_1984761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281555.1|1984750_1984951_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053266085.1|1985101_1986229_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	6.9e-16
WP_032172475.1|1986371_1987502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112918425.1|1988008_1989241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032174629.1|1989547_1991071_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.3	3.7e-89
WP_094323336.1|1991060_1992320_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	22.7	7.0e-09
WP_151140382.1|1992316_1993000_+	YecA family protein	NA	NA	NA	NA	NA
WP_063078878.1|1993022_1994807_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_097506538.1|1994876_1998161_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	6.9e-64
WP_001290572.1|1998157_1998913_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_105629577.1|1999775_2000510_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_053275385.1|2000530_2001571_-	fimbrial protein	NA	NA	NA	NA	NA
WP_077816311.1|2001583_2004115_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_112910902.1|2004202_2004889_-	molecular chaperone	NA	NA	NA	NA	NA
WP_112910903.1|2004946_2005474_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
2005790:2005849	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_117355267.1|2005844_2005937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118645.1|2005983_2006907_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_112918391.1|2006899_2007196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085950841.1|2007218_2007455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071598175.1|2007701_2007890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034167755.1|2007964_2008705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169776.1|2008785_2009985_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001685082.1|2010021_2010258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054834.1|2010410_2010725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|2010750_2011284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021579298.1|2011356_2011791_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_089580313.1|2012631_2013555_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
WP_151140383.1|2014607_2015660_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
2021776:2021892	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCAATTCTCAACGTTAACCCACATGCCCATCATAAAATCAAATTTTGAAAGAAAATGC	NA	NA	NA	NA
>prophage 9
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	2355187	2370992	4735153	integrase	Salmonella_phage(25.0%)	15	2352891:2352904	2365256:2365269
2352891:2352904	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000041681.1|2355187_2357614_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2357812_2358118_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2358225_2358936_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2358938_2359499_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2359533_2359875_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2360009_2360336_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2360541_2361756_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2361767_2362787_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2362844_2362973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2362974_2364255_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2364289_2364526_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021570798.1|2364613_2367085_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
2365256:2365269	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_001083297.1|2367177_2367369_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2367365_2367554_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000527809.1|2369531_2370992_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 10
NZ_CP041442	Escherichia coli strain YPE12 chromosome, complete genome	4735153	3596242	3744111	4735153	lysis,capsid,holin,head,terminase,portal,protease,tail,transposase,plate,integrase	Shigella_phage(34.69%)	171	3624967:3625026	3738989:3739756
WP_085947917.1|3596242_3597516_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000983410.1|3597621_3598293_+	amino acid exporter for proline, lysine, glutamate, homoserine	NA	NA	NA	NA	NA
WP_000290616.1|3598309_3598555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301260.1|3598967_3599783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692754.1|3600025_3601075_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000665120.1|3601451_3602834_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000661619.1|3602843_3603794_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_001295687.1|3603869_3604166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083429.1|3604215_3605634_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000111836.1|3605633_3607181_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001310582.1|3607170_3608034_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_064670549.1|3608073_3608679_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013892.1|3608936_3609434_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001084399.1|3609525_3610458_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301264.1|3610499_3611588_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_120795374.1|3612859_3612934_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|3613239_3615273_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3615401_3615989_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3616002_3617475_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3617488_3619159_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3619371_3620040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3620282_3620978_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064670551.1|3620970_3622398_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3622408_3623128_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3623654_3624509_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064670552.1|3624734_3624971_+	FAD-binding protein	NA	A0A2K5B2C5	Erysipelothrix_phage	53.9	5.5e-16
3624967:3625026	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_000474084.1|3626944_3627181_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016244293.1|3627192_3627816_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|3627812_3628964_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000621009.1|3629598_3630450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3634576_3634678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3635041_3635305_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3635304_3635445_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3635479_3635707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3636530_3637073_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3637147_3637735_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3637792_3638461_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3638486_3641012_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3641001_3642645_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3642613_3643324_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3643636_3643966_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3644213_3644828_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070700.1|3645245_3645935_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3645931_3646888_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_053286015.1|3646884_3649083_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
WP_000121359.1|3649092_3650049_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3650027_3650438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670530.1|3651006_3652023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670529.1|3652483_3653716_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.3	4.3e-237
WP_064670528.1|3653844_3654429_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
WP_151140399.1|3654428_3657779_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000453558.1|3658351_3658897_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000025003.1|3659234_3659555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085438473.1|3659935_3660379_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	82.8	7.3e-62
WP_000900879.1|3660375_3660693_-	lysozyme	NA	A0A2I6TCA1	Escherichia_phage	98.1	1.2e-55
WP_000186784.1|3660899_3661580_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_072126246.1|3661576_3661759_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000548531.1|3661731_3661923_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3661933_3662215_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_085438467.1|3662313_3662532_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	1.4e-34
WP_000488407.1|3662579_3662858_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_071791770.1|3662829_3663180_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	98.3	4.6e-59
WP_053271768.1|3663056_3664220_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	99.7	9.1e-229
WP_085438561.1|3664722_3664875_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	86.2	3.9e-07
WP_085438563.1|3665470_3666553_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	22.9	4.0e-05
WP_136710480.1|3666773_3667190_-|tail	tail assembly chaperone	tail	A0A077KAY3	Edwardsiella_phage	55.3	4.5e-13
WP_064670553.1|3668192_3668531_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.4	3.6e-53
WP_000774473.1|3668527_3668818_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000211034.1|3668810_3668981_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_064670554.1|3668980_3669436_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_072097297.1|3669432_3669534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074400827.1|3669628_3670411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064670555.1|3670585_3670909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3671020_3672547_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_001301135.1|3672604_3672754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3672802_3673135_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3673202_3673505_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|3673501_3674203_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_064670557.1|3674199_3675129_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.6e-111
WP_064670556.1|3675215_3675755_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	5.8e-61
WP_000184665.1|3675785_3676013_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3676123_3676816_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3676896_3677958_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3677935_3678313_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3678788_3678995_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_033561765.1|3679070_3679367_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_074400828.1|3679372_3680200_+	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	87.6	4.0e-114
WP_024220864.1|3680977_3681772_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000218773.1|3681853_3682207_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_029380176.1|3682490_3682772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071840188.1|3683722_3683980_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000470135.1|3684034_3685780_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000926290.1|3685748_3685997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082070.1|3685968_3686949_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_000784327.1|3687641_3688781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072161528.1|3689334_3690549_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_094304446.1|3690583_3692017_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.9	5.4e-106
WP_000355484.1|3692420_3693194_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_151140400.1|3693254_3693809_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.7	5.3e-86
WP_001008234.1|3694268_3694712_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_151140401.1|3694683_3695286_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	1.7e-101
WP_151140402.1|3695285_3696008_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	1.6e-50
WP_063073499.1|3696011_3696596_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.0e-112
WP_028125900.1|3696586_3697645_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.2e-200
WP_000424744.1|3697631_3698057_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_052921837.1|3698056_3698605_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	2.5e-96
WP_063073500.1|3698604_3699684_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_063073501.1|3699680_3701009_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_040072272.1|3701062_3701740_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	45.6	6.6e-46
WP_063073503.1|3701821_3703603_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	91.8	9.8e-275
WP_001314907.1|3703595_3703778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|3703744_3704014_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3704013_3704370_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_151140403.1|3704369_3705866_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	98.4	1.4e-274
WP_063073505.1|3705849_3706020_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	7.9e-25
WP_000779292.1|3706028_3706589_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224836.1|3706585_3707092_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702401.1|3707066_3707477_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927711.1|3707473_3707797_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3707799_3708000_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_063073507.1|3708049_3709255_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193640.1|3709269_3709920_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	5.6e-119
WP_000466255.1|3709897_3711139_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|3711138_3711321_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|3711332_3712829_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_063073508.1|3713067_3713553_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	1.4e-85
WP_001135220.1|3713678_3714029_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	1.2e-62
WP_071780599.1|3714320_3714461_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
WP_000738423.1|3714553_3714847_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123010240.1|3714937_3715120_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	2.1e-15
WP_001197766.1|3715336_3715813_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120496.1|3715816_3716143_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001532221.1|3716461_3717559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552536.1|3717569_3717992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073510.1|3717984_3718620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552535.1|3718595_3718982_-	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	6.8e-56
WP_021552534.1|3719000_3719990_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_001061445.1|3719997_3720807_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767103.1|3720826_3721216_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_061356387.1|3721212_3721539_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_074149693.1|3721538_3722033_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	8.1e-86
WP_061356389.1|3722029_3722971_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	5.0e-153
WP_001250269.1|3722960_3723140_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_063073513.1|3723315_3723873_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_000649477.1|3723916_3724117_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3724207_3724882_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3725116_3725323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3725294_3725729_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_077632131.1|3725647_3725851_-	hypothetical protein	NA	U5P0J5	Shigella_phage	95.5	4.0e-31
WP_077251367.1|3725996_3726218_+	hypothetical protein	NA	S5FNS4	Shigella_phage	97.3	1.1e-37
WP_000008236.1|3726273_3726810_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3726800_3727163_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3727162_3727468_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|3727383_3727818_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|3727694_3728858_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3729062_3730316_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3730327_3731431_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3731718_3732774_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|3732812_3733214_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3733271_3734516_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3734607_3735066_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3735326_3736784_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001329160.1|3736840_3737377_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|3737309_3737576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3737809_3738262_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3739048_3739447_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|3739449_3739743_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3739794_3740850_-	DNA polymerase IV	NA	NA	NA	NA	NA
3738989:3739756	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCTCAAAAACGCATGCGAAACGCTTCTGCCATTTTCCCAATTTTATGCATTTGGTTGTTATCTCGAGCCTGTTTATGAGGTTCAGGTTTCAGAATGGCAATGAGCAACCATGCTTGCTCATCAAACGCACCCTGACAATATACCAAATGCGCTTCGTCATTCGTTCTGCTGAATTGGCGCAACTGTGGCGGAAATGGATTATTCACATTTGCCAGATGAATATGAGCAACTCGCTCAAATTTGATTAATGGCCAGGTAAACGAGTCGTCGTAGAGTGCATCGCGACCAAATATATCTGGCAAAACACCGTCACGCTTATAGGAAATAAAATCCGCCGTTAACGCATCAAGTTCCTCTGCTGTAAGTTGCAGGCGAATAAGTTTTGTTTTGAATACCCGCATCCTTATTCCTTAAAGTCATTGAAATCATCATCCGTCATATCATTAAGATATTTTTCAGCTCGGCGTGTAATTTCCTCTAATCTTGCAGCACTTGGACGGAAGCGCGCCTTTATGGGCTTTTTCTCCTCTTGTTCAGCAAGCATGTCCATTAACGCTTCGAATGCGCTGGCACTTAAGAGATATCCTGCGGGGCGATTATTAGAAAGAACCGCAACCGGTTGATCAATAAAGTATTTAGCTGGGTTTTTACGTAACTCAGTAATATTGACCGATTTTTCAGCGAGAATTCGATGCATGCAGTGATCCCCT	NA	NA	NA	NA
WP_000636841.1|3740920_3741691_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3741650_3743390_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3743613_3744111_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP041443	Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence	101987	1249	54747	101987	transposase,integrase	Escherichia_phage(33.33%)	50	NA	NA
WP_053270619.1|1249_2173_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.6e-175
WP_033548869.1|2339_2756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|3340_3676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|3684_3876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|5003_5759_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001327128.1|5759_5954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063090489.1|6438_6627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153561.1|6753_6942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151140425.1|6942_7128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|7118_7823_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001516695.1|8524_9181_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|9341_10046_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011058339.1|11428_11515_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691727.1|11530_13450_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_011058338.1|13550_13736_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_072078461.1|14550_14736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077141251.1|15031_15526_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000027057.1|15636_16497_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_151140426.1|16679_17237_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.5	5.9e-93
WP_001531602.1|17400_20406_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
WP_001351729.1|21206_21599_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|21736_22621_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001493765.1|22652_23852_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_021536379.1|23930_24608_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|24639_24882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151140427.1|26162_26924_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_034167813.1|27366_28581_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.6	1.5e-19
WP_001452812.1|28797_29511_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_151140428.1|30441_31062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136655511.1|31093_31549_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136655510.1|31771_32401_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655509.1|32448_34062_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_015344975.1|34423_35917_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094309310.1|36255_37413_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_151140429.1|37402_38299_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001067858.1|39936_40641_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001317507.1|40969_41443_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067858.1|42747_43452_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072078461.1|43769_43955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|44809_45601_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|46069_46315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054377175.1|46352_47216_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_032492336.1|47361_48591_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_001067855.1|48718_49423_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105636.1|49695_51390_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|51441_51864_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|51899_52175_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|52188_52539_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|52610_53045_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|54042_54747_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP041439	Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence	106630	57122	100049	106630	integrase,transposase,protease	Escherichia_phage(15.38%)	45	66447:66506	86370:86670
WP_000616807.1|57122_57776_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|57868_58126_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|58058_58460_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|59770_60475_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063609966.1|60511_61468_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	3.4e-72
WP_001255015.1|61829_62135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151140340.1|62162_63377_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
WP_129501584.1|63560_64478_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_015344975.1|64508_66002_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|66212_66437_-	hypothetical protein	NA	NA	NA	NA	NA
66447:66506	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_004202492.1|67276_67618_-	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
WP_137042336.1|68081_68261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151140341.1|68391_68742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151140342.1|68921_69161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583524.1|69137_69734_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
WP_023281055.1|70771_71356_+	mobilization protein MobX	NA	NA	NA	NA	NA
WP_023281054.1|71398_74035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023281053.1|74039_76088_-	site-specific DNA-methyltransferase	NA	A0A1B0XWD0	Campylobacter_phage	37.8	9.5e-64
WP_001567330.1|76336_76540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567331.1|76582_76990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039021303.1|77061_77604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039021304.1|77587_78037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039021305.1|78047_78587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201280.1|80496_80970_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_151140344.1|81044_81836_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|81852_82653_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_123809930.1|82778_82970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012300772.1|82917_84177_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000237816.1|84497_84950_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_112917708.1|85125_85770_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	2.5e-18
WP_050394548.1|88086_88878_-	hypothetical protein	NA	NA	NA	NA	NA
86370:86670	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGC	NA	NA	NA	NA
WP_000565612.1|89848_89932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001376796.1|90086_90731_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	27.8	7.5e-07
WP_000864788.1|91025_91646_+	ParA family protein	NA	A2I303	Vibrio_virus	33.8	6.3e-19
WP_000051066.1|91697_91928_+	partitioning protein	NA	NA	NA	NA	NA
WP_012291478.1|92351_93416_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	30.4	6.3e-27
WP_001575534.1|93549_93729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024129958.1|93953_94307_-	DNA distortion protein 3	NA	NA	NA	NA	NA
WP_001074384.1|94443_94890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063116919.1|94893_95736_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024129959.1|95756_96596_-	replication initiation protein	NA	NA	NA	NA	NA
WP_071779027.1|96534_96765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121743.1|97830_98082_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220561.1|98071_98353_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_000948429.1|98849_100049_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP041441	Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence	122347	9151	49915	122347	integrase,transposase	Escherichia_phage(42.11%)	44	42070:42084	53075:53089
WP_001067858.1|9151_9856_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072748638.1|9801_10014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532073.1|10252_11467_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_001288435.1|11500_12934_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_032491824.1|14421_15213_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_000845048.1|15361_16375_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_130624313.1|16343_16628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067858.1|16661_17366_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000691727.1|19378_21298_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_011058339.1|21313_21400_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067858.1|23811_24516_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000004159.1|24712_25951_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|25947_26853_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|26974_27679_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|27715_28843_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|28893_29139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|29144_29336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|29817_30360_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|30372_31233_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|32329_33034_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_013362817.1|33571_34021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100249774.1|34535_34646_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|34650_35388_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|35513_35609_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067858.1|35743_36448_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000215655.1|36610_36808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|37132_38266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642771.1|38285_38570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074712.1|38740_39388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628093.1|39375_39711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139427.1|39890_40472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493380.1|41042_41393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063074920.1|41462_42071_+	hypothetical protein	NA	NA	NA	NA	NA
42070:42084	attL	GACAGCCAGAAACGG	NA	NA	NA	NA
WP_001372173.1|42138_42921_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_000239529.1|43058_43334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|43327_43972_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|44200_45172_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|45176_45569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457523.1|45573_46845_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_000109071.1|46844_47282_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|47278_47527_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_032072581.1|47637_47907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072748701.1|47944_48847_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086147.1|49231_49915_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
53075:53089	attR	CCGTTTCTGGCTGTC	NA	NA	NA	NA
>prophage 2
NZ_CP041441	Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence	122347	53178	61608	122347		Pseudomonas_phage(16.67%)	9	NA	NA
WP_012372796.1|53178_54846_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_032158038.1|55559_56066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001276107.1|56012_56540_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
WP_000006020.1|56597_56831_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001145485.1|56889_58848_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_001387500.1|58902_59337_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|59333_60053_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001579745.1|60049_60508_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117611.1|61107_61608_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
