The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	1055767	1068950	4662393		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1055767_1056529_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1056522_1057149_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1057288_1058428_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1058490_1059483_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1059576_1060941_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1061029_1061806_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1061810_1062449_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1062445_1063708_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1063704_1064613_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1064808_1065576_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1065626_1066283_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_085438572.1|1066388_1068950_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
>prophage 2
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	1149991	1250455	4662393	terminase,head,capsid,integrase,holin,transposase,portal,tail,tRNA	Cronobacter_phage(45.83%)	103	1169591:1169607	1239303:1239319
WP_089566769.1|1149991_1151153_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000795662.1|1151520_1151727_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_000151178.1|1151747_1152047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572958.1|1152295_1152571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414984.1|1153112_1153676_-	hypothetical protein	NA	M1PL54	Cellulophaga_phage	44.9	1.8e-36
WP_000614786.1|1156419_1157316_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_151164936.1|1157312_1158209_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_021570914.1|1158198_1159755_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.3	1.1e-19
WP_085947917.1|1159802_1161075_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001384082.1|1161373_1162603_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	2.7e-207
WP_000162574.1|1163346_1163829_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1163960_1164437_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1164426_1164717_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1164778_1165120_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1165268_1166930_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1167015_1167894_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1168016_1168610_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1168664_1169951_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1169591:1169607	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|1169971_1170763_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1170929_1172291_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1172539_1172788_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1172806_1173355_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1173385_1174153_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1174194_1174542_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1174617_1175100_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1175115_1176342_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1176331_1176850_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000976004.1|1176999_1177365_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1177574_1178645_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225229.1|1178655_1179777_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1179819_1180980_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1181078_1181126_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_077629794.1|1181289_1182309_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	57.2	5.9e-107
WP_000089404.1|1182348_1182648_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.2	5.9e-23
WP_000662537.1|1182756_1183038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853270.1|1183064_1183400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681788.1|1183409_1183979_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	50.5	7.2e-46
WP_071988497.1|1183981_1184200_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.2	2.4e-05
WP_032292416.1|1184239_1186897_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	46.5	1.8e-240
WP_000909748.1|1186965_1187685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224585.1|1187824_1188100_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.4	1.7e-24
WP_000746492.1|1188153_1189173_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	9.3e-137
WP_064670487.1|1189169_1190951_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.3	2.9e-250
WP_064670488.1|1191094_1191934_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.0	1.2e-44
WP_032295604.1|1191968_1192997_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.9	2.2e-133
WP_032292413.1|1193007_1193721_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	3.9e-65
WP_064670486.1|1193722_1193914_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.2	7.3e-11
WP_077760539.1|1194007_1194460_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	62.0	1.2e-46
WP_032292410.1|1194456_1194939_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	5.2e-37
WP_032292409.1|1194935_1195640_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	4.0e-70
WP_151140365.1|1195636_1196764_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	8.1e-174
WP_089587597.1|1196760_1197216_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_032292406.1|1197228_1197525_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
WP_032292405.1|1197521_1197863_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	8.1e-45
WP_032292404.1|1197862_1198195_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.5	3.3e-35
WP_072007678.1|1198121_1198355_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	3.9e-30
WP_032292402.1|1198341_1198599_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	2.8e-21
WP_151140366.1|1198786_1200754_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.7	7.5e-268
WP_032292401.1|1200750_1201080_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
WP_032292400.1|1201076_1202261_+	phage protein	NA	F1BUK6	Cronobacter_phage	78.9	3.3e-178
WP_032292399.1|1202253_1202841_+	protein phage	NA	F1BUK5	Cronobacter_phage	86.2	6.6e-95
WP_032292398.1|1202850_1204428_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	80.7	2.7e-135
WP_064670485.1|1204427_1205015_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.0	3.6e-56
WP_064670484.1|1205004_1205730_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.9	3.6e-58
WP_032292395.1|1205701_1206247_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	1.6e-63
WP_032292425.1|1206249_1207950_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.3	3.7e-223
WP_032187555.1|1208981_1210169_-	acyltransferase	NA	NA	NA	NA	NA
WP_000178456.1|1210312_1210654_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1210924_1211662_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1211796_1212777_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1212773_1213505_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_064670483.1|1213634_1216208_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000841103.1|1222062_1223361_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1223357_1223681_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1223726_1225082_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083005.1|1225195_1227856_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1227887_1228586_-	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
WP_001098726.1|1228654_1229074_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1229280_1230318_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1230365_1231055_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1231359_1231743_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1231798_1232386_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_053286107.1|1232488_1233370_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1233578_1234913_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1235044_1235782_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_001094491.1|1235766_1237389_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1237644_1237800_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1237796_1238372_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1238404_1239055_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1239054_1240011_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1239303:1239319	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589068.1|1240007_1240487_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1240684_1242484_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002541.1|1242499_1243474_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1243745_1244426_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020749.1|1244422_1245328_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399404.1|1245339_1246068_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1246079_1246811_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986023.1|1246810_1247191_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1247611_1247692_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196283.1|1247885_1248146_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001013779.1|1248201_1249050_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|1249258_1249894_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|1249918_1250455_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	1463033	1475058	4662393	integrase,plate	Enterobacteria_phage(57.14%)	15	1459925:1459941	1477068:1477084
1459925:1459941	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_151140423.1|1463033_1463552_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.8	1.7e-54
WP_089519078.1|1463595_1464174_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	99.0	1.2e-109
WP_001614322.1|1464160_1464337_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_000753555.1|1464353_1464668_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041317.1|1464679_1465162_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_064670570.1|1465441_1466521_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.2	2.9e-205
WP_001259084.1|1466520_1467069_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424747.1|1467068_1467494_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_064670569.1|1467480_1468539_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.7	3.0e-202
WP_064670568.1|1468529_1469114_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.2e-112
WP_001349560.1|1470132_1470549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077878018.1|1470803_1471952_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	31.1	3.9e-30
WP_064670333.1|1472260_1472650_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	87.5	4.6e-60
WP_064670332.1|1472656_1473814_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.2	1.0e-219
WP_000368140.1|1474125_1475058_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1477068:1477084	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	1715021	1724462	4662393		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670440.1|1715021_1715948_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.1	2.2e-23
WP_000783120.1|1715952_1716684_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1716664_1716772_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1716831_1717563_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1717784_1719470_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719466_1720186_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1720232_1720703_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1720742_1721204_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|1721328_1723329_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_064670439.1|1723325_1724462_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 5
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	1816693	1824660	4662393		Klebsiella_phage(16.67%)	8	NA	NA
WP_064670358.1|1816693_1818088_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|1818245_1819241_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183034.1|1819483_1820377_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000699411.1|1820748_1821834_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000676086.1|1821833_1822697_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_001025599.1|1822700_1823096_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000971201.1|1823092_1823560_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000564888.1|1823556_1824660_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
>prophage 6
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	1893714	1903635	4662393	transposase	Burkholderia_phage(33.33%)	12	NA	NA
WP_085947917.1|1893714_1894988_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_072134966.1|1895031_1895841_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_044066597.1|1896128_1896314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313057.1|1896406_1896772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|1896811_1897507_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157230.1|1897573_1898992_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000786004.1|1898972_1899443_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001507517.1|1899431_1900352_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|1900524_1901442_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|1901520_1901703_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_071525573.1|1901785_1901980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001564714.1|1901940_1903635_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 7
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	2284005	2299810	4662393	integrase	Salmonella_phage(25.0%)	15	2281709:2281722	2294074:2294087
2281709:2281722	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000041681.1|2284005_2286432_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2286630_2286936_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2287043_2287754_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2287756_2288317_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2288351_2288693_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2288827_2289154_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2289359_2290574_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2290585_2291605_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2291662_2291791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2291792_2293073_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2293107_2293344_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021570798.1|2293431_2295903_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
2294074:2294087	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_001083297.1|2295995_2296187_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2296183_2296372_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000527809.1|2298349_2299810_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 8
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	3542066	3607804	4662393	holin,lysis,integrase,tail	Enterobacteria_phage(48.65%)	70	3570978:3570996	3592188:3592206
WP_000131044.1|3542066_3544100_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3544228_3544816_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3544829_3546302_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3546315_3547986_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3548198_3548867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3549109_3549805_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064670551.1|3549797_3551225_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3551235_3551955_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3552481_3553336_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064670552.1|3553561_3553798_+	FAD-binding protein	NA	A0A2K5B2C5	Erysipelothrix_phage	53.9	5.5e-16
WP_000474084.1|3555771_3556008_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3556019_3556613_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3557202_3558054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3562180_3562282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3562645_3562909_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3562908_3563049_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3563083_3563311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3564134_3564677_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3564751_3565339_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3565396_3566065_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3566090_3568616_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3568605_3570249_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3570217_3570928_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
3570978:3570996	attL	CGTTTAAATGATGTGGAAG	NA	NA	NA	NA
WP_001303809.1|3571240_3571570_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3571817_3572432_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070700.1|3572849_3573539_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3573535_3574492_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_053286015.1|3574488_3576687_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
WP_000121359.1|3576696_3577653_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3577631_3578042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670530.1|3578610_3579627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670529.1|3580087_3581320_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.3	4.3e-237
WP_064670528.1|3581448_3582033_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
WP_151140399.1|3582032_3585383_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000453558.1|3585955_3586501_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000025003.1|3586838_3587159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085438473.1|3587539_3587983_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	82.8	7.3e-62
WP_000900879.1|3587979_3588297_-	lysozyme	NA	A0A2I6TCA1	Escherichia_phage	98.1	1.2e-55
WP_000186784.1|3588503_3589184_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_072126246.1|3589180_3589363_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000548531.1|3589335_3589527_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3589537_3589819_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_085438467.1|3589917_3590136_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	1.4e-34
WP_000488407.1|3590183_3590462_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_071791770.1|3590433_3590784_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	98.3	4.6e-59
WP_053271768.1|3590660_3591824_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	99.7	9.1e-229
WP_085438561.1|3592326_3592479_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	86.2	3.9e-07
3592188:3592206	attR	CGTTTAAATGATGTGGAAG	NA	NA	NA	NA
WP_085438563.1|3593074_3594157_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	22.9	4.0e-05
WP_136710480.1|3594377_3594794_-|tail	tail assembly chaperone	tail	A0A077KAY3	Edwardsiella_phage	55.3	4.5e-13
WP_064670553.1|3595796_3596135_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.4	3.6e-53
WP_000774473.1|3596131_3596422_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000211034.1|3596414_3596585_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_064670554.1|3596584_3597040_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_072097297.1|3597036_3597138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074400827.1|3597232_3598015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064670555.1|3598189_3598513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3598624_3600151_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_001301135.1|3600208_3600358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3600406_3600739_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3600806_3601109_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|3601105_3601807_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_064670557.1|3601803_3602733_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.6e-111
WP_064670556.1|3602819_3603359_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	5.8e-61
WP_000184665.1|3603389_3603617_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3603727_3604420_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3604500_3605562_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3605539_3605917_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3606392_3606599_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_033561765.1|3606674_3606971_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_074400828.1|3606976_3607804_+	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	87.6	4.0e-114
>prophage 9
NZ_CP041452	Escherichia coli strain YPE3 chromosome, complete genome	4662393	3616938	3660378	4662393	terminase,head,capsid,integrase,tail,protease,holin,lysis,portal,plate	Shigella_phage(55.17%)	63	3614805:3614852	3656475:3656522
3614805:3614852	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_072161528.1|3616938_3618153_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_094304446.1|3618187_3619621_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.9	5.4e-106
WP_000355484.1|3620024_3620798_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_151140400.1|3620858_3621413_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.7	5.3e-86
WP_001008234.1|3621872_3622316_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_151140401.1|3622287_3622890_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	1.7e-101
WP_151164942.1|3622889_3623612_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	1.6e-50
WP_063073499.1|3623615_3624200_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.0e-112
WP_028125900.1|3624190_3625249_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.2e-200
WP_000424744.1|3625235_3625661_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_052921837.1|3625660_3626209_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	2.5e-96
WP_063073500.1|3626208_3627288_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_063073501.1|3627284_3628613_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_040072272.1|3628666_3629344_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	45.6	6.6e-46
WP_063073503.1|3629425_3631207_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	91.8	9.8e-275
WP_001314907.1|3631199_3631382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|3631348_3631618_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3631617_3631974_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_151140403.1|3631973_3633470_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	98.4	1.4e-274
WP_063073505.1|3633453_3633624_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	7.9e-25
WP_000779292.1|3633632_3634193_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224836.1|3634189_3634696_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702401.1|3634670_3635081_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927711.1|3635077_3635401_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3635403_3635604_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_063073507.1|3635653_3636859_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193640.1|3636873_3637524_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	5.6e-119
WP_000466255.1|3637501_3638743_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|3638742_3638925_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|3638936_3640433_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_063073508.1|3640671_3641157_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	1.4e-85
WP_001135220.1|3641282_3641633_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	1.2e-62
WP_071780599.1|3641924_3642065_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
WP_000738423.1|3642157_3642451_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123010240.1|3642541_3642724_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	2.1e-15
WP_001197766.1|3642940_3643417_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120496.1|3643420_3643747_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001532221.1|3644065_3645163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552536.1|3645173_3645596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073510.1|3645588_3646224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552535.1|3646199_3646586_-	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	6.8e-56
WP_021552534.1|3646604_3647594_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_001061445.1|3647601_3648411_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767103.1|3648430_3648820_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_061356387.1|3648816_3649143_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_074149693.1|3649142_3649637_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	8.1e-86
WP_061356389.1|3649633_3650575_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	5.0e-153
WP_001250269.1|3650564_3650744_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_063073513.1|3650919_3651477_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_000649477.1|3651520_3651721_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3651811_3652486_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3652720_3652927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3652898_3653333_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_077632131.1|3653251_3653455_-	hypothetical protein	NA	U5P0J5	Shigella_phage	95.5	4.0e-31
WP_077251367.1|3653600_3653822_+	hypothetical protein	NA	S5FNS4	Shigella_phage	97.3	1.1e-37
WP_000008236.1|3653877_3654414_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3654404_3654767_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3654766_3655072_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|3654987_3655422_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|3655298_3656462_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3656666_3657920_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3656475:3656522	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3657931_3659035_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3659322_3660378_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
NZ_CP041451	Escherichia coli strain YPE3 plasmid pYPE3-114k, complete sequence	114322	0	24507	114322	integrase	Salmonella_phage(87.5%)	26	12839:12858	21555:21574
WP_000105079.1|0_1095_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
WP_073503561.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_094312814.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.0	3.3e-38
WP_000688530.1|2218_2398_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	69.5	1.4e-11
WP_001265407.1|2437_2713_-	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_024170891.1|2768_3185_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	1.3e-60
WP_151164907.1|3273_5613_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920225.1|5615_5882_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
WP_077108707.1|5881_6826_-	exonuclease	NA	J9Q7S6	Salmonella_phage	91.7	2.5e-168
WP_032328850.1|6886_7915_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_151164908.1|8032_8464_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	84.6	2.6e-64
WP_001351985.1|8718_8943_+	hypothetical protein	NA	J9Q735	Salmonella_phage	56.9	2.2e-14
WP_052988641.1|9003_9567_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	68.2	3.3e-67
WP_151164909.1|9597_13104_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	89.9	0.0e+00
12839:12858	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_074430105.1|13078_13282_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	89.6	3.4e-30
WP_151164910.1|13284_14520_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.5	2.3e-198
WP_151164911.1|14615_16724_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.2	8.2e-228
WP_151164912.1|16822_17035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282576.1|17286_17673_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|17667_18771_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|18981_19227_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_025670480.1|19223_19574_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	4.6e-27
WP_000067985.1|21133_21424_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_000636535.1|21569_21785_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
21555:21574	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_073503567.1|21781_23104_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	96.6	1.9e-251
WP_032187677.1|23694_24507_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	85.6	5.5e-124
>prophage 2
NZ_CP041451	Escherichia coli strain YPE3 plasmid pYPE3-114k, complete sequence	114322	31286	42419	114322		Salmonella_phage(75.0%)	15	NA	NA
WP_001603498.1|31286_31508_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053291281.1|31507_31885_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	9.3e-58
WP_094313027.1|32018_33230_-	hypothetical protein	NA	J9Q720	Salmonella_phage	94.6	2.9e-209
WP_023135655.1|33290_34631_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.9	2.5e-246
WP_151164915.1|34691_35417_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.7	4.6e-138
WP_000342417.1|35700_36468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062085.1|36520_36880_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_000161228.1|36879_37548_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_016582626.1|37968_38238_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016582627.1|38241_38766_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077929498.1|38793_39135_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.6	6.9e-28
WP_151164916.1|39203_39896_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.8	4.7e-124
WP_032084070.1|39909_40233_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
WP_151164917.1|40307_41090_-	receptor-recognizing protein	NA	Q8W678	Enterobacteria_phage	81.4	3.0e-50
WP_151164932.1|41156_42419_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	50.4	1.7e-95
>prophage 3
NZ_CP041451	Escherichia coli strain YPE3 plasmid pYPE3-114k, complete sequence	114322	46427	114001	114322	tail,tRNA,terminase	Salmonella_phage(87.3%)	72	NA	NA
WP_151164918.1|46427_51155_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	73.9	0.0e+00
WP_001293195.1|51173_51767_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_001405045.1|51754_52552_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_001351970.1|52544_53276_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_151164919.1|53325_53661_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	2.3e-52
WP_151164920.1|53703_58233_-	tape measure protein	NA	J9Q712	Salmonella_phage	67.0	0.0e+00
WP_001351971.1|58240_58510_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
WP_000163860.1|58590_58908_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	3.3e-48
WP_033566656.1|58962_59709_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.4	2.5e-107
WP_000469440.1|59783_60167_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_139444547.1|60168_60642_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	5.6e-76
WP_001027663.1|60632_60977_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057118.1|61056_61890_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_021520524.1|61889_62324_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	4.3e-59
WP_021520523.1|62368_63289_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	78.6	5.3e-123
WP_001130339.1|63362_64238_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_151164921.1|64263_65151_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.3	2.7e-132
WP_053904527.1|65172_66747_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	93.3	7.6e-287
WP_001007299.1|66773_68030_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|68029_68662_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|68857_69124_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_151164922.1|69133_70024_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	4.4e-167
WP_001717191.1|70020_70686_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|70682_71351_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_014962244.1|71350_72049_-	hypothetical protein	NA	J9Q756	Salmonella_phage	86.6	8.7e-110
WP_097335221.1|72113_73673_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	1.7e-278
WP_001291061.1|73675_73954_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_001308871.1|73986_74586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151164923.1|74888_75479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063122771.1|75478_76000_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	70.3	2.3e-54
WP_151164924.1|76325_76976_+	hypothetical protein	NA	J9Q754	Salmonella_phage	85.2	7.6e-100
WP_094337988.1|77023_77254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|77868_78351_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_049076852.1|78701_79112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077127647.1|79193_79589_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	4.1e-32
WP_000749406.1|79715_80027_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
WP_032203350.1|80180_80510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405018.1|82072_82294_-	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	8.7e-16
WP_032335025.1|82533_84567_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	1.3e-44
WP_000004356.1|84724_85825_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|85861_86251_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_001755493.1|86349_86601_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	88.0	6.2e-34
WP_072328030.1|86603_86819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151164925.1|86958_88515_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.5e-104
WP_151164926.1|88511_89693_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_151164927.1|89815_92932_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_025670504.1|93605_94220_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	75.5	1.3e-88
WP_032339194.1|94222_94504_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	2.5e-39
WP_112919513.1|94558_95128_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	63.0	6.5e-55
WP_014962273.1|95267_95426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025670506.1|95425_95851_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	79.4	3.4e-56
WP_023145165.1|95944_96133_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	2.1e-10
WP_089632760.1|96142_96637_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	51.8	1.5e-28
WP_001755502.1|96782_97376_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.2	1.4e-92
WP_000121543.1|97959_98190_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_014962277.1|98375_98969_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.0e-98
WP_151164928.1|99152_99962_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	1.5e-65
WP_052988644.1|100122_100677_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	78.1	8.2e-79
WP_012640764.1|100686_101106_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	3.6e-50
WP_000386470.1|101167_101812_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_000781810.1|101811_102288_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
WP_001308886.1|102284_102698_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.6	2.5e-64
WP_151164929.1|102699_103827_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	90.5	7.3e-199
WP_021520143.1|103973_104843_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.3	1.2e-132
WP_151164930.1|104920_106063_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.4	1.0e-195
WP_097515983.1|106169_108485_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.6	0.0e+00
WP_022644977.1|108558_109128_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	87.3	6.7e-92
WP_047579074.1|109137_109881_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.6	1.2e-53
WP_151164931.1|109870_111787_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	77.9	4.2e-271
WP_087507381.1|111783_111975_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
WP_000174803.1|112016_113102_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|113356_114001_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
>prophage 1
NZ_CP041453	Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence	92973	1249	57764	92973	integrase,transposase	Escherichia_phage(27.27%)	57	NA	NA
WP_053270619.1|1249_2173_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.6e-175
WP_033548869.1|2339_2756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|3340_3676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|3684_3876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|5003_5759_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001327128.1|5759_5954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063090489.1|6438_6627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153561.1|6753_6942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151140425.1|6942_7128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|7118_7823_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000429836.1|8820_9255_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|9326_9677_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|9687_9963_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|9998_10421_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|10472_12167_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001067855.1|12439_13144_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|13271_14501_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_054377175.1|14646_15510_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|15547_15793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|16261_17053_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_072078461.1|17907_18093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|18410_19115_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|19260_20274_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|20429_20903_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067858.1|21231_21936_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077250842.1|22015_22846_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_151140429.1|23576_24473_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094309310.1|24462_25620_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|25958_27452_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655509.1|27813_29427_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_136655510.1|29474_30104_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655511.1|30326_30782_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072051933.1|30813_32160_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_151140429.1|32890_33787_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094309310.1|33776_34934_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|35272_36766_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655509.1|37127_38741_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_136655510.1|38788_39418_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655511.1|39640_40096_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072051933.1|40127_41474_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|41504_42389_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_034167813.1|42605_43820_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.6	1.5e-19
WP_001255015.1|43847_44153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|44971_45676_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000105383.1|45846_47283_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000565612.1|48754_48838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203396.1|48992_49637_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_000516402.1|50017_50680_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001185482.1|50777_51059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245156.1|51083_52061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456533.1|52057_52414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|53036_53873_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001532157.1|53811_54042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121743.1|55106_55358_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|55347_55629_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_105278499.1|56546_56804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034167829.1|56840_57764_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	5.1e-166
