The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	325698	343070	6880508	integrase	Pseudomonas_phage(33.33%)	25	322562:322575	334417:334430
322562:322575	attL	CGCCGCCCTCGGCT	NA	NA	NA	NA
WP_139791561.1|325698_326334_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	54.1	3.2e-42
WP_045210031.1|327350_328355_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.6e-35
WP_167523156.1|328444_328834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015476292.1|328791_329115_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_151189635.1|329180_331721_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.6	7.5e-26
WP_151186284.1|331801_332782_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	63.4	2.0e-112
WP_151186285.1|332792_332996_-	DUF4224 domain-containing protein	NA	A0A2H4JC20	uncultured_Caudovirales_phage	60.9	2.6e-14
WP_151186286.1|333047_333410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151186287.1|333413_333611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151186288.1|333698_334319_-	hypothetical protein	NA	A0A2I7RF87	Vibrio_phage	29.4	9.1e-10
WP_151189636.1|334315_334564_-	hypothetical protein	NA	NA	NA	NA	NA
334417:334430	attR	CGCCGCCCTCGGCT	NA	NA	NA	NA
WP_151186289.1|334811_335060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151186290.1|335016_335523_-	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	64.9	2.7e-52
WP_151186291.1|335519_335933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151186292.1|335961_336579_-	YqaJ viral recombinase family protein	NA	A0A1B0VMB3	Pseudomonas_phage	80.0	2.0e-94
WP_151186293.1|337426_338485_-	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	72.0	9.3e-47
WP_151186294.1|338528_338798_-	hypothetical protein	NA	C6ZR42	Salmonella_phage	45.8	1.0e-10
WP_167523157.1|338963_339107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151186295.1|339103_339463_-	hypothetical protein	NA	B5WZW7	Pseudomonas_phage	89.1	1.9e-60
WP_151186296.1|339584_339794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151186297.1|339790_340129_-	hypothetical protein	NA	W6MYA8	Pseudomonas_phage	38.9	7.4e-06
WP_151186298.1|340125_341220_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	35.1	5.1e-48
WP_151186299.1|341492_341849_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_151186300.1|341885_342470_-	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	47.0	3.9e-31
WP_151186301.1|342587_343070_-	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	67.9	2.2e-51
>prophage 2
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	346742	369897	6880508	terminase,holin,capsid	Pseudomonas_phage(55.56%)	32	NA	NA
WP_151186307.1|346742_347525_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6Q0	uncultured_Caudovirales_phage	49.8	2.1e-64
WP_151186308.1|347634_347835_+	hypothetical protein	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	75.8	6.9e-20
WP_151186309.1|348089_348683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186310.1|348684_348888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186311.1|348928_349696_+	replication protein	NA	W6MYB0	Pseudomonas_phage	54.7	2.7e-40
WP_167523158.1|349692_351093_+	AAA family ATPase	NA	A0A125RNK2	Pseudomonas_phage	80.0	2.3e-210
WP_151186312.1|351208_351415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186313.1|351411_351732_+	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	63.1	1.2e-34
WP_151186314.1|351842_352289_+	hypothetical protein	NA	A0A1B0VMG4	Pseudomonas_phage	31.1	2.7e-08
WP_151186315.1|352285_352561_+	hypothetical protein	NA	H2BDI5	Pseudomonas_virus	54.3	3.9e-13
WP_151186316.1|352557_352764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186317.1|352760_353009_+	hypothetical protein	NA	A0A2H4J105	uncultured_Caudovirales_phage	64.2	5.7e-24
WP_151186318.1|353005_353620_+	ninG protein	NA	H2BDI7	Pseudomonas_virus	78.4	6.3e-80
WP_151186319.1|354515_354881_+	hypothetical protein	NA	A0A0S2SYH4	Pseudomonas_phage	80.5	4.5e-49
WP_151186320.1|354873_355200_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.8e-25
WP_151186321.1|355199_355628_+	proteasome subunit beta	NA	A0A1B0VNC4	Pseudomonas_phage	50.3	1.2e-29
WP_167523278.1|355639_356251_+	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	79.7	5.3e-95
WP_151186323.1|356282_356744_+	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	73.4	9.3e-44
WP_151186324.1|356730_358026_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.0	4.1e-145
WP_151186325.1|358030_359425_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	57.9	3.1e-143
WP_151186326.1|359411_360500_+|capsid	minor capsid protein	capsid	A0A0H5BBX3	Pseudomonas_phage	45.3	2.4e-82
WP_151186327.1|360509_360758_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	55.4	1.9e-19
WP_151186328.1|361090_361849_+	hypothetical protein	NA	A0A2H4J0I7	uncultured_Caudovirales_phage	36.8	5.9e-27
WP_151186329.1|361868_362861_+	hypothetical protein	NA	W6ARA3	Acinetobacter_phage	33.9	8.2e-37
WP_151186330.1|362905_363865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186331.1|363867_364365_+	hypothetical protein	NA	A0A2H4J970	uncultured_Caudovirales_phage	50.0	1.8e-32
WP_151186332.1|364361_364745_+	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	43.3	2.1e-20
WP_151186333.1|364744_365140_+	HK97 gp10 family phage protein	NA	A0A0H5AWD5	Pseudomonas_phage	57.3	8.0e-36
WP_151186334.1|365143_365563_+	hypothetical protein	NA	A0A088F7T0	Vibrio_phage	28.0	6.3e-07
WP_151186335.1|365566_366742_+	hypothetical protein	NA	A0A2I6PI45	Pseudomonas_phage	35.4	3.5e-26
WP_151186336.1|366756_367161_+	hypothetical protein	NA	A0A1B0Z0C9	Vibrio_phage	41.5	4.4e-21
WP_151186337.1|367440_369897_+	tape measure protein	NA	J7HXG0	Pseudomonas_phage	51.7	4.6e-89
>prophage 3
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	373812	382562	6880508		Pseudomonas_phage(33.33%)	9	NA	NA
WP_151186342.1|373812_375231_+	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	29.2	1.5e-36
WP_151186343.1|375991_378040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186344.1|378048_378582_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	65.5	1.3e-60
WP_167523160.1|378578_379088_+	DUF2514 family protein	NA	A0A077KH21	Edwardsiella_phage	35.8	2.3e-11
WP_151186346.1|379115_379346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151186347.1|379342_380032_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_151186348.1|380035_380551_-	hypothetical protein	NA	Q5QF67	Pseudomonas_virus	44.2	2.6e-26
WP_081517916.1|380908_381421_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	71.8	3.2e-53
WP_081517917.1|381506_382562_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.1	1.7e-112
>prophage 4
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	1917493	1999072	6880508	protease,transposase,integrase	Hokovirus(22.22%)	54	1913418:1913432	2000876:2000890
1913418:1913432	attL	TGAGCAGCGACAGAT	NA	NA	NA	NA
WP_151187103.1|1917493_1918054_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_151187104.1|1918100_1918418_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_081519935.1|1918599_1918830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151187105.1|1918884_1919139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187106.1|1919299_1920370_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_151187107.1|1920372_1921479_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_081519939.1|1921719_1922622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187108.1|1923023_1927163_+	PAS domain S-box protein	NA	A0A1B0VMK3	Pseudomonas_phage	34.5	2.2e-22
WP_167523188.1|1929336_1929567_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	50.7	1.7e-09
WP_151187110.1|1929908_1930208_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033974343.1|1930204_1930498_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_167523189.1|1930664_1931105_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_151187112.1|1931155_1936906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187113.1|1936968_1937847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187114.1|1938147_1938537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187115.1|1938735_1940529_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.1	4.1e-18
WP_151187116.1|1940605_1943068_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	3.2e-34
WP_151187117.1|1943075_1943705_-	response regulator	NA	NA	NA	NA	NA
WP_151187118.1|1944532_1944805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187119.1|1945077_1946508_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_151187120.1|1946840_1947770_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_138212024.1|1947769_1948519_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_151187121.1|1949335_1951138_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151187122.1|1951165_1953277_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151187123.1|1953326_1954511_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_151187124.1|1954510_1955284_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.4	4.6e-11
WP_138212019.1|1955396_1956974_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	1.4e-27
WP_138212018.1|1957074_1958427_-	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
WP_138212017.1|1958837_1959293_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_138212016.1|1959324_1960464_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151187125.1|1960478_1961672_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151187126.1|1961684_1962872_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_151187127.1|1963145_1963946_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_138212010.1|1968246_1969020_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_138212009.1|1969049_1970294_+	thiolase family protein	NA	NA	NA	NA	NA
WP_151187128.1|1970376_1971288_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_151187129.1|1971475_1973038_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	9.9e-29
WP_151187130.1|1974526_1975852_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_151187131.1|1975931_1976981_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	42.6	2.3e-74
WP_151187132.1|1977120_1978578_-	long-chain-fatty-acyl-CoA reductase	NA	NA	NA	NA	NA
WP_151187133.1|1978581_1980012_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_151187134.1|1980182_1980905_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138212000.1|1980901_1982023_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_138211999.1|1982132_1983281_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_138211998.1|1983350_1985810_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_151187135.1|1985835_1986903_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_138211996.1|1987070_1988762_-	DUF1302 domain-containing protein	NA	NA	NA	NA	NA
WP_151187136.1|1988962_1990069_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_151187137.1|1990285_1991032_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_151187138.1|1991287_1993987_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151187140.1|1995976_1996357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151187141.1|1996500_1996779_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151187142.1|1997044_1997914_-	plasmid replication region	NA	NA	NA	NA	NA
WP_151187143.1|1998001_1999072_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	28.9	6.2e-06
2000876:2000890	attR	ATCTGTCGCTGCTCA	NA	NA	NA	NA
>prophage 5
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	2161792	2169130	6880508	tRNA	uncultured_Caudovirales_phage(85.71%)	9	NA	NA
WP_024765156.1|2161792_2162458_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	80.7	6.8e-88
WP_151187236.1|2162573_2162966_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	76.0	3.0e-51
WP_151187238.1|2162965_2163325_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	58.3	1.4e-31
WP_139791686.1|2163321_2163627_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	59.0	1.9e-24
WP_151187240.1|2163623_2163959_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	5.4e-41
WP_151187242.1|2163955_2164954_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	72.2	2.6e-139
WP_081520467.1|2165042_2166044_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_081520569.1|2166119_2166464_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_151187244.1|2167849_2169130_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.9	4.4e-99
>prophage 6
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	3592780	3606113	6880508	tRNA,capsid,integrase	Pseudomonas_phage(61.54%)	18	3585162:3585177	3601472:3601487
3585162:3585177	attL	CGCCTGCTGCTGCGCA	NA	NA	NA	NA
WP_081520108.1|3592780_3593311_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	44.0	3.7e-20
WP_139791663.1|3593391_3594018_-	NlpC/P60 family protein	NA	A0A217EQL1	Bacillus_phage	37.3	1.7e-19
WP_151188013.1|3594087_3594852_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	32.9	7.0e-20
WP_151188014.1|3594881_3595553_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_081520104.1|3595572_3596400_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.3	1.1e-106
WP_151188015.1|3596673_3597591_+	hypothetical protein	NA	A0A2D1GMP9	Marinobacter_phage	28.4	9.0e-22
WP_151188016.1|3597677_3598178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188017.1|3598174_3598543_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_151188018.1|3598517_3599507_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	82.5	9.0e-153
WP_151188019.1|3599506_3600802_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	81.4	1.3e-212
WP_151188020.1|3601035_3602331_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	72.3	2.8e-162
3601472:3601487	attR	TGCGCAGCAGCAGGCG	NA	NA	NA	NA
WP_151188021.1|3602338_3602695_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	75.4	1.4e-44
WP_151188022.1|3602699_3603923_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	52.0	1.0e-25
WP_151188023.1|3604063_3604315_-|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	81.9	2.5e-27
WP_151188024.1|3604327_3604579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188025.1|3604580_3604802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188026.1|3604818_3605238_-	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	85.3	8.2e-47
WP_151188028.1|3605795_3606113_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	48.5	7.9e-18
>prophage 7
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	3740464	3789288	6880508	terminase,holin,head,tRNA,tail,capsid,portal,integrase	Pseudomonas_phage(87.8%)	63	3752937:3752955	3798708:3798726
WP_017522296.1|3740464_3741244_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_081515987.1|3741390_3742206_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_081515989.1|3742382_3742919_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_081515990.1|3743078_3743996_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.7	5.6e-48
WP_151188091.1|3744006_3745869_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017522301.1|3745933_3746275_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.6	4.5e-11
WP_138215487.1|3746313_3747432_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.1	1.0e-91
WP_045210558.1|3747444_3748488_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_151188092.1|3749932_3750190_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	75.6	2.2e-26
WP_151188093.1|3750186_3750558_-	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	41.2	1.4e-10
WP_151188094.1|3750554_3751070_-	hypothetical protein	NA	C8ZKR3	Pseudomonas_phage	49.0	2.4e-32
WP_151188095.1|3751130_3752795_-	hypothetical protein	NA	A0A0B5A596	Achromobacter_phage	28.0	8.4e-10
WP_151188096.1|3752799_3753363_-	hypothetical protein	NA	A0A0U4JIY3	Pseudomonas_phage	67.8	3.3e-67
3752937:3752955	attL	CCGGGGTGCTGGTGGGCTT	NA	NA	NA	NA
WP_151188097.1|3753373_3753571_-	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	48.3	2.9e-10
WP_151188098.1|3753578_3754157_-	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	54.2	2.8e-53
WP_151188099.1|3754218_3755409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188100.1|3755417_3757175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188101.1|3757171_3757627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188102.1|3757626_3759408_-	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	48.1	1.5e-145
WP_167523223.1|3759409_3759913_-	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	61.7	9.5e-58
WP_151188103.1|3759928_3761980_-	hypothetical protein	NA	A0A0U3TH20	Pseudomonas_phage	33.2	6.6e-73
WP_151188104.1|3761945_3762158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188105.1|3762163_3762523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188106.1|3762574_3763279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188107.1|3763335_3764121_-	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	81.2	4.0e-119
WP_151188108.1|3764147_3764588_-	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	64.6	1.6e-48
WP_151189721.1|3764595_3765195_-	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	58.5	3.9e-58
WP_151188109.1|3765194_3765746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188110.1|3765749_3765935_-	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	57.6	1.2e-10
WP_151188111.1|3765965_3766286_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	62.9	1.7e-31
WP_151188112.1|3766278_3766554_-	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	50.7	1.2e-09
WP_151188113.1|3766599_3767802_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	73.8	1.8e-171
WP_151188114.1|3768442_3769666_-|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	81.5	1.2e-191
WP_151188115.1|3771395_3771878_-|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	73.6	5.1e-61
WP_151189722.1|3771784_3772363_-	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	53.2	1.1e-28
WP_151188116.1|3772407_3772695_-|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	59.8	1.9e-18
WP_151188117.1|3772684_3773065_-	hypothetical protein	NA	J7I0R6	Pseudomonas_phage	63.6	1.0e-35
WP_151188118.1|3773318_3773876_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	74.3	4.4e-56
WP_151188119.1|3773872_3774166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188120.1|3774189_3775452_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GND4	Pseudomonas_phage	49.0	5.4e-110
WP_151189723.1|3775448_3775757_-	hypothetical protein	NA	A0A0A0YQ44	Pseudomonas_phage	55.8	1.6e-20
WP_151188121.1|3775816_3777214_-	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	68.7	1.1e-177
WP_151188122.1|3777210_3778053_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	54.0	9.3e-74
WP_151188123.1|3779004_3779199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188124.1|3779195_3779426_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	85.5	9.7e-34
WP_151189724.1|3779422_3780139_-	Rha family transcriptional regulator	NA	A0A0A0YQ39	Pseudomonas_phage	75.4	6.2e-95
WP_151188125.1|3780174_3780963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188126.1|3780959_3781352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188127.1|3781544_3781802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189725.1|3782239_3782956_+	helix-turn-helix domain-containing protein	NA	W6MVG5	Pseudomonas_phage	53.1	2.6e-61
WP_151188128.1|3783068_3783449_+	response regulator transcription factor	NA	A0A1W6JTA9	Pseudomonas_phage	48.1	1.5e-18
WP_151188129.1|3783438_3783735_+	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	67.5	1.1e-18
WP_151188130.1|3783847_3784633_+	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	56.9	7.3e-81
WP_151188131.1|3784687_3784885_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	60.8	9.9e-11
WP_151188132.1|3784887_3785364_+	hypothetical protein	NA	A0A0U2KZ33	Pseudomonas_phage	60.6	1.0e-05
WP_167523224.1|3785360_3785684_+	hypothetical protein	NA	O64348	Escherichia_phage	45.6	2.9e-15
WP_151188134.1|3785676_3785895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188135.1|3785891_3786119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188136.1|3786102_3786789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188137.1|3786781_3787207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188138.1|3787210_3787510_+	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	69.7	3.0e-35
WP_151188139.1|3787697_3788072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188140.1|3788289_3789288_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	83.0	5.0e-127
3798708:3798726	attR	AAGCCCACCAGCACCCCGG	NA	NA	NA	NA
>prophage 8
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	4153793	4162572	6880508	capsid,integrase	Pseudomonas_phage(77.78%)	11	4151958:4152005	4166958:4167005
4151958:4152005	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATA	NA	NA	NA	NA
WP_151188324.1|4153793_4154864_-	acyltransferase family protein	NA	C6ZR20	Salmonella_phage	30.1	5.4e-26
WP_151188325.1|4154929_4155934_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.5	2.8e-77
WP_151188326.1|4155930_4157223_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	77.3	1.2e-208
WP_151188327.1|4157462_4158746_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	70.1	2.5e-163
WP_151188328.1|4158753_4159110_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	72.9	1.6e-43
WP_167523233.1|4159114_4160329_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	53.1	2.7e-26
WP_151188023.1|4160469_4160721_-|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	81.9	2.5e-27
WP_151188329.1|4160733_4160985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188330.1|4160986_4161208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188331.1|4161224_4161659_-	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	77.7	2.0e-40
WP_151188333.1|4162236_4162572_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	51.4	4.3e-22
4166958:4167005	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATA	NA	NA	NA	NA
>prophage 9
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	4750011	4853074	6880508	terminase,protease,holin,head,plate,tRNA,tail,capsid,portal,integrase	uncultured_Caudovirales_phage(45.45%)	100	4789924:4789968	4826005:4826049
WP_081515353.1|4750011_4751466_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_045215805.1|4751797_4753207_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_081515351.1|4755762_4756311_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_151188584.1|4756313_4756904_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_081515350.1|4757110_4758187_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.9	4.8e-06
WP_151188585.1|4758189_4759620_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_081515348.1|4759945_4760407_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_151188586.1|4760405_4760858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017517171.1|4761544_4762027_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_045215790.1|4762064_4762319_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	45.9	1.9e-14
WP_081515346.1|4762320_4762743_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_081515345.1|4762888_4764424_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_081515344.1|4764562_4765852_+	murein hydrolase activator EnvC	NA	NA	NA	NA	NA
WP_081515343.1|4765879_4767190_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.5	2.3e-26
WP_151188587.1|4767193_4767976_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_054910504.1|4768115_4768871_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081515341.1|4769023_4769782_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081515340.1|4770055_4770826_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_054910490.1|4770938_4771676_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_045215778.1|4771716_4771977_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_081515338.1|4771980_4772619_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_015479330.1|4772618_4773212_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_151188588.1|4773352_4773751_+	aspartate 1-decarboxylase autocleavage activator PanM	NA	NA	NA	NA	NA
WP_151188589.1|4773892_4776121_+	AsmA family protein	NA	NA	NA	NA	NA
WP_151188590.1|4776117_4777185_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_015479334.1|4777181_4777454_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_151188591.1|4777856_4780169_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_045215765.1|4780452_4781226_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	2.7e-19
WP_081515332.1|4781240_4781993_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081515331.1|4782049_4782745_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_081515330.1|4782741_4783434_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_151188592.1|4783500_4784721_+	methyltransferase	NA	NA	NA	NA	NA
WP_151188593.1|4785109_4785583_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151188594.1|4785579_4787067_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_151188595.1|4787081_4788266_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_151188596.1|4788279_4789818_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
4789924:4789968	attL	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
WP_151188597.1|4790727_4791366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188598.1|4791528_4792587_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	80.8	1.5e-158
WP_151188599.1|4792586_4794338_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	75.4	1.1e-262
WP_151188600.1|4794492_4795335_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	64.5	2.1e-94
WP_151188601.1|4795363_4796371_+|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	80.1	1.2e-149
WP_151188602.1|4796375_4797077_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	61.9	1.8e-70
WP_151188603.1|4797182_4797647_+|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	55.8	1.8e-39
WP_151188604.1|4797646_4797856_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	75.4	1.3e-24
WP_151188605.1|4797934_4798249_+|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	58.7	7.5e-29
WP_151188606.1|4798245_4799085_+	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	58.4	6.0e-81
WP_151188607.1|4799081_4799312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188608.1|4799308_4799767_+	DUF2570 domain-containing protein	NA	Q9ZXL5	Pseudomonas_virus	51.0	1.8e-26
WP_151188609.1|4799860_4800388_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	69.4	6.0e-55
WP_151188610.1|4800380_4800830_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	66.0	2.8e-45
WP_151188611.1|4800904_4801474_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	67.4	1.9e-54
WP_151188612.1|4801470_4801824_+|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	74.6	9.6e-41
WP_151188613.1|4801820_4802732_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	76.8	1.6e-124
WP_151188614.1|4802731_4803355_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	67.2	2.5e-76
WP_151188615.1|4805796_4806303_+	DUF4376 domain-containing protein	NA	A0A1S5R1J2	Pseudomonas_phage	51.4	2.8e-25
WP_151188616.1|4806299_4806668_+	DUF1353 domain-containing protein	NA	A0A2H4JDM4	uncultured_Caudovirales_phage	65.5	1.9e-39
WP_151188617.1|4806784_4807957_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	85.1	1.9e-194
WP_151188618.1|4808006_4808522_+|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	73.1	2.5e-69
WP_151188619.1|4808596_4808923_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	61.7	9.6e-27
WP_151188620.1|4808931_4809054_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	63.2	4.1e-07
WP_151188621.1|4812299_4813568_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	71.7	3.1e-174
WP_151188622.1|4814108_4814633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188623.1|4814643_4815243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189756.1|4815266_4815596_-	helix-turn-helix domain-containing protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	57.7	1.6e-26
WP_151188624.1|4815680_4815893_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	45.3	1.4e-07
WP_151188625.1|4815922_4816408_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	59.5	6.8e-45
WP_151188626.1|4816469_4816748_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_151188627.1|4816744_4817026_+	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	58.0	7.5e-12
WP_151188628.1|4817093_4817327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189757.1|4817343_4820061_+	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	52.0	2.7e-276
WP_167523243.1|4820114_4820255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188629.1|4820307_4820580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188630.1|4820637_4821369_+	hypothetical protein	NA	X5IGG9	Pseudomonas_phage	32.3	3.3e-27
WP_151189758.1|4821463_4821721_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	56.5	7.8e-24
WP_151188632.1|4823038_4823257_+	hypothetical protein	NA	A0A2H4JE76	uncultured_Caudovirales_phage	61.1	4.0e-13
WP_151188633.1|4823253_4824057_+	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	41.1	1.2e-49
WP_151188634.1|4824053_4824287_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_151188635.1|4824279_4824543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188636.1|4824539_4824749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188637.1|4824745_4825894_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.3	3.7e-73
WP_151189759.1|4826474_4827374_+	glycosyltransferase	NA	NA	NA	NA	NA
4826005:4826049	attR	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
WP_151188638.1|4827377_4828436_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	4.6e-86
WP_151188639.1|4828432_4829341_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_151188640.1|4829337_4830219_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	62.4	1.1e-104
WP_151188641.1|4830218_4830764_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.4	2.5e-48
WP_151188642.1|4830823_4831654_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_167523244.1|4831685_4835147_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_151188644.1|4835143_4836082_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A140G5S6	Enterobacteria_phage	28.0	6.2e-18
WP_151188645.1|4836078_4837119_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	27.8	5.4e-07
WP_151188646.1|4837183_4838500_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_151188647.1|4838496_4840512_+	methyltransferase	NA	NA	NA	NA	NA
WP_151188648.1|4840636_4842433_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_151188649.1|4842429_4843824_+	sigma 54-interacting transcriptional regulator	NA	W8CYM9	Bacillus_phage	28.5	5.0e-08
WP_081515309.1|4844410_4845862_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_081515308.1|4845878_4847135_+	arginine deiminase	NA	NA	NA	NA	NA
WP_065086518.1|4847275_4848286_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_065086519.1|4848355_4849288_+	carbamate kinase	NA	NA	NA	NA	NA
WP_151188650.1|4849543_4851442_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_139791463.1|4851516_4852341_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_151188651.1|4852534_4853074_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	34.3	3.0e-17
>prophage 10
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	5237643	5296431	6880508	protease,holin	Bacillus_virus(37.5%)	44	NA	NA
WP_045213877.1|5237643_5238822_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.1	2.9e-25
WP_081519043.1|5238827_5239667_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_045213872.1|5239721_5240663_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_081519042.1|5240904_5241843_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_151188802.1|5242178_5243555_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_024766695.1|5243937_5245044_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_151188803.1|5245209_5246673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189762.1|5246735_5247203_-	phage antirepressor	NA	A0A290FZK7	Caldibacillus_phage	26.8	2.7e-06
WP_151188804.1|5247755_5248154_-	VOC family protein	NA	NA	NA	NA	NA
WP_151188805.1|5248262_5248562_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_151188806.1|5248564_5248969_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_151188807.1|5249130_5249514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188808.1|5251235_5251601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188809.1|5251742_5252204_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_151188810.1|5252498_5252813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167523301.1|5252814_5253126_-	adhesin	NA	NA	NA	NA	NA
WP_167523302.1|5264108_5265785_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_081519030.1|5265976_5266225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151188812.1|5266503_5267682_-	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_081519028.1|5267695_5268625_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	30.5	4.7e-26
WP_151188813.1|5268631_5269105_-	thioesterase	NA	NA	NA	NA	NA
WP_081519026.1|5269204_5270170_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_151188814.1|5270294_5271179_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_151188815.1|5271266_5272205_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_151188816.1|5272433_5273408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081519022.1|5273750_5274221_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_151188817.1|5274437_5276066_-	alcohol dehydrogenase	NA	A0A1V0SI18	Klosneuvirus	29.7	9.3e-54
WP_081519020.1|5276206_5277040_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	6.0e-33
WP_024764976.1|5277027_5277834_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	33.6	8.1e-27
WP_139791602.1|5278864_5279044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188818.1|5279184_5281578_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_151188819.1|5281717_5282632_+	AEC family transporter	NA	NA	NA	NA	NA
WP_081519187.1|5282762_5283278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081519016.1|5283566_5284871_+	CitMHS family transporter	NA	NA	NA	NA	NA
WP_081519015.1|5284888_5285647_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	4.8e-37
WP_081519014.1|5285737_5286211_-	water stress/hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
WP_151188820.1|5286228_5287536_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_081519012.1|5287875_5289600_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_081519011.1|5289698_5290733_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151188821.1|5290817_5291774_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_151188822.1|5291981_5293355_+	insulinase family protein	NA	NA	NA	NA	NA
WP_081519008.1|5293380_5293932_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151188823.1|5294056_5295346_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	37.7	7.8e-72
WP_167523303.1|5295855_5296431_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	5926218	6020545	6880508	terminase,protease,holin,plate,tRNA,tail,portal,integrase	Pseudomonas_phage(59.62%)	98	5951395:5951410	6006296:6006311
WP_151189141.1|5926218_5927631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JPZ8	Staphylococcus_phage	24.0	1.6e-06
WP_151189142.1|5928332_5932067_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	1.6e-13
WP_054908018.1|5932169_5934023_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.1	2.0e-36
WP_151189143.1|5934101_5936138_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.4	2.5e-72
WP_003085057.1|5936338_5936554_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_151189144.1|5936754_5937780_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.1	3.6e-104
WP_081520802.1|5937874_5938444_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_015475255.1|5938524_5938878_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_151189145.1|5939547_5940777_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	42.4	1.7e-76
WP_151189777.1|5940900_5941410_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_081520798.1|5941468_5943022_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_045212721.1|5943018_5944290_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	2.4e-09
WP_045212719.1|5944394_5946317_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_081520797.1|5946605_5946935_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_054908027.1|5947804_5948185_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_081520795.1|5948181_5949009_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_151189146.1|5949125_5950127_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_139791707.1|5950258_5951551_-	molecular chaperone SurA	NA	NA	NA	NA	NA
5951395:5951410	attL	CGCGCAGGCGCTGGTC	NA	NA	NA	NA
WP_151189147.1|5951531_5954303_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_081520791.1|5954432_5955455_+	phosphotransferase	NA	NA	NA	NA	NA
WP_151189148.1|5955451_5956126_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_151189149.1|5956127_5956892_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_151189150.1|5956904_5957954_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_151189151.1|5958119_5960531_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_081520786.1|5960582_5961212_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_139791706.1|5961376_5962414_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_081520784.1|5962594_5963704_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.3	5.2e-24
WP_081520782.1|5964948_5966196_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045214142.1|5966212_5967040_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015475282.1|5967229_5967904_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_081520781.1|5967903_5968722_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_151189152.1|5968794_5970288_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_081520779.1|5970421_5970736_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_151189153.1|5970857_5971628_-	helix-turn-helix domain-containing protein	NA	A0A1B0Z078	Pseudomonas_phage	56.1	1.4e-68
WP_081520777.1|5972039_5972249_+	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	46.8	1.7e-08
WP_045212666.1|5972268_5972628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189154.1|5972816_5973104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081520775.1|5973718_5974063_+|holin	holin	holin	B5TK61	Pseudomonas_phage	49.1	5.5e-25
WP_151189155.1|5974080_5974611_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	40.5	6.1e-23
WP_081520773.1|5974607_5975171_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	63.0	6.7e-44
WP_151189156.1|5975281_5975608_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	6.4e-31
WP_151189157.1|5975604_5976495_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	61.6	1.8e-91
WP_081520770.1|5976487_5977102_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	58.9	5.0e-61
WP_081520769.1|5979193_5980354_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	81.2	4.6e-172
WP_151189158.1|5980366_5980870_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	66.0	5.6e-58
WP_151189159.1|5980881_5981223_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_151189160.1|5981378_5983310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189161.1|5983319_5984225_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_151189162.1|5984196_5984406_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.8	1.4e-15
WP_151189163.1|5984470_5985475_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	57.6	2.1e-101
WP_151189164.1|5985476_5986106_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	63.0	1.3e-67
WP_151189165.1|5986102_5986459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189166.1|5986455_5986704_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	48.7	1.3e-07
WP_151189167.1|5986832_5987045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189168.1|5987204_5988368_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	41.9	1.9e-72
WP_151189169.1|5988385_5988751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189170.1|5988750_5989110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189171.1|5989129_5989345_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151189172.1|5989348_5989774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189173.1|5989766_5990450_-	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	38.9	3.0e-30
WP_151189174.1|5990449_5990659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189175.1|5990655_5990877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189176.1|5990873_5991401_-	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	72.8	2.2e-36
WP_151189177.1|5991397_5992390_-	hypothetical protein	NA	O64348	Escherichia_phage	44.6	3.0e-15
WP_151189178.1|5992392_5992587_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	70.6	4.7e-13
WP_024762904.1|5992717_5993104_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	69.2	7.1e-37
WP_151189179.1|5993263_5993596_+	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	55.4	7.7e-24
WP_151189180.1|5993632_5994490_-	helix-turn-helix domain-containing protein	NA	H2BD63	Pseudomonas_phage	58.3	2.6e-79
WP_151189182.1|5994594_5994909_+	helix-turn-helix domain-containing protein	NA	K7PKH4	Enterobacteria_phage	50.7	1.1e-11
WP_151189184.1|5995104_5995692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189186.1|5995688_5996150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189188.1|5996146_5996932_+	phage antirepressor protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	44.0	4.9e-45
WP_151189190.1|5996931_5997162_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	88.2	3.3e-34
WP_151188123.1|5997158_5997353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151188122.1|5998304_5999147_+	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	54.0	9.3e-74
WP_151188121.1|5999143_6000541_+	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	68.7	1.1e-177
WP_151189723.1|6000600_6000909_+	hypothetical protein	NA	A0A0A0YQ44	Pseudomonas_phage	55.8	1.6e-20
WP_151189192.1|6000905_6002201_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GND4	Pseudomonas_phage	53.9	4.7e-125
WP_151189194.1|6002197_6002458_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	59.3	1.7e-18
WP_151189196.1|6002457_6002847_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	78.3	9.0e-56
WP_167523252.1|6003422_6003800_+	response regulator	NA	NA	NA	NA	NA
WP_151189200.1|6003960_6004332_+	hypothetical protein	NA	W6MYB2	Pseudomonas_phage	53.8	8.3e-27
WP_151189202.1|6004328_6005066_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	61.6	4.0e-73
WP_151189204.1|6005178_6005724_+|terminase	terminase small subunit	terminase	A0A1W6JT69	Pseudomonas_phage	80.1	5.1e-73
WP_151189206.1|6005695_6007696_+|terminase	phage terminase large subunit family protein	terminase	A0A1W6JT68	Pseudomonas_phage	76.9	2.0e-308
6006296:6006311	attR	GACCAGCGCCTGCGCG	NA	NA	NA	NA
WP_151189208.1|6007686_6007908_+	primosomal replication protein PriB/PriC domain protein	NA	Q687G1	Enterobacteria_phage	45.2	1.1e-10
WP_151189210.1|6007907_6009461_+|portal	phage portal protein	portal	A0A1B0YZU4	Pseudomonas_phage	70.9	1.3e-201
WP_151189212.1|6009378_6011466_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	72.2	7.7e-271
WP_151189214.1|6011532_6011850_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	82.9	1.9e-40
WP_151189216.1|6011846_6012176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189218.1|6012172_6012643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167523253.1|6012639_6012813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189220.1|6012817_6013597_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	65.4	1.5e-86
WP_151189222.1|6013760_6014078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189224.1|6014134_6014443_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	40.6	6.7e-14
WP_151189226.1|6014544_6018249_+	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	33.8	1.2e-77
WP_151189778.1|6018307_6018811_+	hypothetical protein	NA	A0A0A0YR40	Pseudomonas_phage	47.1	6.0e-36
WP_151189228.1|6018811_6020545_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	44.2	1.8e-124
>prophage 12
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	6023946	6028357	6880508		Pseudomonas_phage(100.0%)	7	NA	NA
WP_151189236.1|6023946_6024525_+	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	54.2	2.8e-53
WP_151188097.1|6024532_6024730_+	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	48.3	2.9e-10
WP_151188096.1|6024740_6025304_+	hypothetical protein	NA	A0A0U4JIY3	Pseudomonas_phage	67.8	3.3e-67
WP_151189238.1|6025308_6027159_+	hypothetical protein	NA	A0A2K9VHT9	Pseudomonas_phage	34.9	3.5e-09
WP_151189240.1|6027219_6027735_+	hypothetical protein	NA	C8ZKR3	Pseudomonas_phage	49.4	4.9e-33
WP_151189242.1|6027731_6028103_+	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	48.3	1.6e-17
WP_151189244.1|6028099_6028357_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	75.6	3.5e-24
>prophage 13
NZ_CP043626	Pseudomonas denitrificans (nomen rejiciendum) strain BG1 chromosome, complete genome	6880508	6747480	6786352	6880508	terminase,holin,head,lysis,tail,capsid,portal,integrase	Pseudomonas_phage(53.57%)	49	6747278:6747327	6786844:6786893
6747278:6747327	attL	GGATTCTGGAGCGGGCGAAGGGAATCGAACCCTCGTCATGAGCTTGGGAA	NA	NA	NA	NA
WP_167523266.1|6747480_6748683_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A248SL35	Klebsiella_phage	32.9	5.3e-38
WP_088417669.1|6748688_6748895_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151189558.1|6748884_6749124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189559.1|6749116_6749551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189560.1|6749547_6751428_-	cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	42.9	1.2e-132
WP_151189561.1|6751930_6752476_-	phosphohydrolase	NA	A0A1W6JP41	Morganella_phage	40.4	4.7e-26
WP_151189562.1|6752472_6753147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189563.1|6753199_6753517_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_151189564.1|6753513_6753822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167523267.1|6753818_6753989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189565.1|6753978_6754272_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_151189566.1|6754282_6754885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151189792.1|6755126_6755891_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.7	3.6e-56
WP_151189567.1|6755980_6756220_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	46.3	1.1e-08
WP_167523268.1|6756524_6757061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189568.1|6757053_6757269_+	TraR/DksA family transcriptional regulator	NA	A0A0S2SYW7	Pseudomonas_phage	47.0	4.2e-07
WP_151189569.1|6759479_6759848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189570.1|6760338_6760686_+|holin	holin	holin	A0A2H4J893	uncultured_Caudovirales_phage	63.6	6.8e-31
WP_151189572.1|6761218_6761743_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_151189573.1|6761705_6763523_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	37.6	2.9e-104
WP_151189574.1|6763519_6763699_+	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	65.2	8.7e-06
WP_151189575.1|6763701_6764976_+|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	59.2	1.1e-139
WP_151189576.1|6764972_6765926_+	S49 family peptidase	NA	A4JX00	Burkholderia_virus	56.2	2.3e-92
WP_151189577.1|6765986_6767300_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	52.2	7.3e-118
WP_151189578.1|6767356_6767638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189579.1|6767640_6768192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189580.1|6768193_6768523_+|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	58.4	5.1e-20
WP_167523269.1|6768528_6768702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189581.1|6768705_6769278_+	HK97 gp10 family phage protein	NA	A0A2H4J8D5	uncultured_Caudovirales_phage	54.5	4.0e-44
WP_151189582.1|6769270_6769657_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	63.0	2.9e-38
WP_151189583.1|6769689_6770193_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	77.0	2.4e-69
WP_151189584.1|6770234_6770579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189585.1|6770575_6770803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189586.1|6770842_6774097_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	39.5	2.4e-77
WP_151189587.1|6774096_6774435_+|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	51.8	1.3e-29
WP_151189588.1|6774431_6775178_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.5	4.6e-117
WP_151189589.1|6775180_6775939_+|tail	phage tail protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	77.3	1.3e-119
WP_151189590.1|6775976_6776378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151189591.1|6776436_6777045_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	60.4	3.9e-58
WP_151189592.1|6777101_6781226_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	60.9	0.0e+00
WP_151189593.1|6781222_6781516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167523270.1|6781512_6781650_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	52.2	1.5e-05
WP_151189594.1|6781646_6782186_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	34.8	3.5e-26
WP_167523271.1|6782195_6783374_+|tail	tail fiber domain-containing protein	tail	A0A059VJZ6	Pseudomonas_phage	47.9	6.5e-33
WP_151189595.1|6783431_6783950_+	glycoside hydrolase family protein	NA	A0A1Y0T0U4	Pseudomonas_phage	60.8	3.4e-50
WP_151189794.1|6783976_6784477_+|lysis	lysis protein	lysis	A0A0H5AUG6	Pseudomonas_phage	36.7	5.6e-10
WP_151189596.1|6784466_6784832_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151189597.1|6784828_6785524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167523153.1|6785728_6786352_-	hypothetical protein	NA	A0A127KNL7	Pseudomonas_phage	62.3	5.7e-12
6786844:6786893	attR	GGATTCTGGAGCGGGCGAAGGGAATCGAACCCTCGTCATGAGCTTGGGAA	NA	NA	NA	NA
