The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	199390	272406	5260440	plate,transposase,tRNA,protease	Emiliania_huxleyi_virus(11.11%)	58	NA	NA
WP_001520521.1|199390_200743_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|200772_203205_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203326_203812_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139287.1|203815_204841_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|204945_205401_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|205404_206193_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001550626.1|206192_207341_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_001550627.1|207337_207934_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001294781.1|207970_211453_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_000055748.1|211465_212425_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|212522_214664_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|214720_215110_+	VOC family protein	NA	NA	NA	NA	NA
WP_001550628.1|215174_216473_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|216521_216782_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|216768_216969_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185287.1|217134_217680_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|217676_218099_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239188.1|218112_218823_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001550629.1|218853_219678_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|219730_221449_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|221559_222267_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222263_222668_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|222785_223601_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|223640_224294_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224286_225318_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|225504_226077_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|231836_232640_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|232636_233551_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|233791_234592_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001550637.1|234669_235440_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|235486_236845_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|236916_237672_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|237705_238428_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238424_238892_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|238956_239688_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|240226_241012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|241160_241628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|241637_242552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|242595_243078_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001563736.1|243101_244454_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_122989438.1|244464_247899_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|248007_249420_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001550641.1|249424_250168_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001563737.1|250164_252990_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.1	1.0e-79
WP_001521863.1|252998_253760_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|253764_255096_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255098_255623_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|255619_256900_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|256924_258007_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|257970_259821_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001521866.1|259824_260238_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|260244_261720_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|261770_261995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550646.1|262029_262530_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|263226_263745_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550647.1|263954_266096_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001077735.1|270671_271049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024192499.1|271269_272406_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	956892	970017	5260440	terminase,protease,integrase,head,capsid	uncultured_Caudovirales_phage(28.57%)	19	943648:943662	967452:967466
943648:943662	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_023063565.1|956892_958131_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	4.0e-126
WP_001302637.1|958548_958758_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.8e-15
WP_032300391.1|958768_959584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075827259.1|959516_959807_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113142.1|959799_960120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023063568.1|960126_960426_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023063569.1|960422_962240_+	DNA primase phage-associated	NA	Q7M2A8	Enterobacteria_phage	47.9	1.1e-127
WP_024210327.1|962527_962773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126638.1|962769_963192_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_126856877.1|963157_963355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281836.1|963465_964506_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.7	6.7e-66
WP_000190775.1|964515_964857_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000572593.1|964866_965211_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001390169.1|965278_965413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023063570.1|965412_965955_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.1	2.9e-36
WP_000133431.1|966028_966310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001334712.1|966434_966629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|967389_967710_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
967452:967466	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000934041.1|967740_970017_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 3
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	1215453	1279274	5260440	terminase,tail,tRNA,lysis,integrase,head,portal,transposase,holin,capsid	Escherichia_phage(36.21%)	84	1208908:1208922	1236049:1236063
1208908:1208922	attL	AACTGGCGAAACGTA	NA	NA	NA	NA
WP_000074983.1|1215453_1216572_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1216540_1216810_-	excisionase	NA	NA	NA	NA	NA
WP_000102155.1|1216871_1219328_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
WP_001093951.1|1219405_1219609_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|1219605_1219794_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|1219804_1220659_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|1221189_1221564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|1221575_1221728_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_000787428.1|1221934_1222342_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|1222418_1222646_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|1222629_1223181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|1223152_1224193_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001403041.1|1224224_1224647_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
WP_000450706.1|1224680_1225451_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|1225466_1225859_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1225855_1226152_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|1226148_1226610_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|1226587_1226944_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137947.1|1227039_1227447_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
WP_001229301.1|1227448_1227814_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|1227810_1228797_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000786207.1|1228917_1229097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1229355_1229511_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|1229727_1229979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|1230045_1230324_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|1230325_1231384_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|1231384_1231753_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|1231745_1232435_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|1232647_1232845_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_000871291.1|1233214_1233550_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|1233795_1233999_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000284506.1|1234306_1234522_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037013.1|1234526_1235417_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	1.2e-108
WP_001092866.1|1235453_1235987_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001322430.1|1235929_1236145_-	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	90.2	1.1e-23
1236049:1236063	attR	AACTGGCGAAACGTA	NA	NA	NA	NA
WP_001446668.1|1236143_1236326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1236340_1236472_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|1236474_1236942_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|1237252_1237579_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|1237701_1238055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602757.1|1237942_1238263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|1238537_1239047_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|1239018_1240947_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|1240930_1241137_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|1241133_1242726_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253887.1|1242715_1244164_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
WP_000256814.1|1244200_1244548_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522603.1|1244605_1245634_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|1245685_1246060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|1246052_1246406_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|1246421_1246955_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|1246951_1247347_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235048.1|1247354_1248104_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|1248122_1248554_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|1248580_1248994_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_000082417.1|1248974_1251536_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847291.1|1251532_1251862_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001309428.1|1251861_1252560_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
WP_000194723.1|1252570_1253314_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122991350.1|1253259_1253892_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.7	1.2e-102
WP_000559722.1|1253913_1254255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000514742.1|1254235_1257928_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_001233148.1|1257995_1258595_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|1258746_1261773_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|1261772_1262357_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_001309429.1|1262329_1262467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240999.1|1262411_1263080_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|1263136_1263403_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|1263634_1264498_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1264481_1265618_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1265867_1267094_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1267142_1268264_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1268339_1269800_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1269799_1270471_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1270639_1272010_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1272013_1272655_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|1272690_1273797_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476103.1|1273850_1274312_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|1274321_1274960_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|1275292_1275628_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|1275627_1276077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|1276658_1277909_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_000526135.1|1278104_1278563_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000526135.1|1278815_1279274_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 4
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	1479825	1586369	5260440	terminase,tail,tRNA,lysis,integrase,transposase	Escherichia_phage(46.43%)	103	1470721:1470736	1513210:1513225
1470721:1470736	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001314661.1|1479825_1481058_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1481312_1482296_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001551034.1|1482773_1484147_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000662472.1|1484275_1485211_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_001551035.1|1485262_1486498_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_000079604.1|1486499_1486715_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001551036.1|1486814_1487003_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_001317028.1|1486995_1487190_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001551037.1|1487246_1488056_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001551038.1|1488048_1490700_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001314664.1|1490801_1491077_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001551041.1|1491151_1491322_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	9.7e-23
WP_000560221.1|1491321_1491543_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_001551042.1|1491963_1492116_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001551043.1|1492569_1493046_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|1493169_1493466_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551045.1|1493488_1493911_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	5.3e-70
WP_001551046.1|1493923_1494781_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	82.6	3.5e-68
WP_001551047.1|1494787_1495534_+	phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_001551048.1|1495556_1496318_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	93.3	2.3e-119
WP_001403739.1|1496333_1496765_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_001551049.1|1496761_1496983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000385105.1|1496958_1498113_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001551050.1|1498087_1500352_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000940316.1|1500765_1501365_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001551052.1|1501364_1501655_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	9.0e-45
WP_000640136.1|1501651_1502194_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_000839599.1|1503475_1503691_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_001551053.1|1503690_1504188_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_001228688.1|1504404_1504590_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|1504786_1506244_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|1506381_1507173_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|1507165_1508098_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|1508075_1508285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551055.1|1508288_1509383_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	1.0e-112
WP_000625348.1|1509363_1510665_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_001551056.1|1510667_1512074_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_001363932.1|1512057_1513170_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551057.1|1513274_1514039_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
1513210:1513225	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918487.1|1514137_1515277_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|1515499_1515895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551058.1|1515894_1516278_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001551059.1|1516278_1516659_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_000673077.1|1516655_1517048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551060.1|1517074_1518037_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_122452218.1|1518187_1518547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284309.1|1518654_1518855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579026.1|1519018_1521517_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.1	1.7e-86
WP_077634177.1|1521520_1522252_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	48.2	5.4e-54
WP_000024051.1|1522244_1522583_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152425.1|1522582_1523281_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_032147653.1|1523286_1524030_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	2.8e-146
WP_050436738.1|1523966_1524575_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.6	7.1e-100
WP_001551065.1|1524635_1528115_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_001228337.1|1528182_1528782_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.7e-101
WP_001551066.1|1528846_1531222_+|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	6.3e-168
WP_000654143.1|1531221_1531503_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001551067.1|1531512_1532553_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_000355602.1|1532595_1532889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968130.1|1533240_1534098_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|1534094_1534952_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983720.1|1534948_1535776_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_000286867.1|1535775_1536690_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|1537276_1537711_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|1537851_1538985_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_001551068.1|1539346_1542871_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1543144_1543411_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001523197.1|1543407_1543830_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|1543940_1544930_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001551069.1|1545137_1547777_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1547773_1547959_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001306533.1|1547966_1548293_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067519.1|1548464_1549370_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001551070.1|1549605_1551105_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000535436.1|1551163_1553437_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001551071.1|1553684_1555730_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_071591516.1|1555978_1556944_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1556955_1557243_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001551072.1|1557251_1557998_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189203.1|1558012_1558510_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001551073.1|1558517_1559588_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001551074.1|1559584_1560352_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001551075.1|1560351_1561140_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_019842675.1|1561141_1562566_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_001551077.1|1562558_1562981_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206190.1|1562980_1564186_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632281.1|1564212_1565526_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001551078.1|1565626_1566577_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001551079.1|1566558_1567149_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_060579170.1|1567479_1572501_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001563833.1|1572708_1573569_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000048949.1|1573682_1574288_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001551082.1|1574488_1578391_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_001523214.1|1578675_1579014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|1579000_1579450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343026.1|1579569_1579947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579171.1|1580062_1580863_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115969.1|1581059_1582499_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048646.1|1582540_1583542_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001306523.1|1583730_1584261_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731833.1|1584505_1584679_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001309484.1|1584750_1584900_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_085948682.1|1584999_1586369_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 5
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	1896545	1950267	5260440	terminase,tail,tRNA,lysis,integrase,head,portal,capsid	Enterobacteria_phage(51.79%)	68	1903519:1903546	1950292:1950319
WP_000672359.1|1896545_1898933_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001551178.1|1898947_1899931_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.4	1.7e-34
WP_001386830.1|1900069_1900114_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1900236_1900593_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1900646_1900844_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1900940_1901483_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|1901486_1903415_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
1903519:1903546	attL	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
WP_000877736.1|1904153_1905896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551179.1|1906377_1906671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247637.1|1906713_1907754_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
WP_001518417.1|1907763_1908045_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_016238726.1|1908044_1910420_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_001551182.1|1910484_1911084_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	1.0e-98
WP_019843055.1|1911151_1914550_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000090872.1|1914610_1915243_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843054.1|1915179_1915923_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
WP_001551186.1|1915928_1916627_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847339.1|1916626_1916956_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_001551188.1|1916952_1919514_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
WP_000459467.1|1919506_1919941_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479143.1|1919922_1920345_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001445656.1|1920360_1921101_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
WP_000683105.1|1921108_1921504_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985116.1|1921500_1922079_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752996.1|1922090_1922444_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000158895.1|1922455_1922851_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_001551189.1|1922892_1923918_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	7.6e-187
WP_001299443.1|1923972_1924305_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123230.1|1924314_1925634_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001445654.1|1925614_1927216_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
WP_000198149.1|1927212_1927419_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|1927415_1929341_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453587.1|1929315_1929861_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738421.1|1930529_1930823_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|1930913_1931096_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135296.1|1931312_1931810_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839582.1|1931809_1932025_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001563769.1|1933295_1934255_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|1934447_1934972_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|1935127_1935505_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971071.1|1935590_1935731_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|1935727_1936090_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000774479.1|1936086_1936377_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224916.1|1936369_1936540_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|1936539_1936995_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|1936991_1937093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|1937209_1938007_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|1938016_1938568_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001551199.1|1939032_1940559_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001299444.1|1940616_1940766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070450.1|1940813_1941146_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1941213_1941516_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|1941512_1942214_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001551200.1|1942210_1943140_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182891.1|1943226_1943766_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001067458.1|1943835_1944066_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|1944170_1944860_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_023148105.1|1945371_1945662_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995443.1|1945737_1946034_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000100847.1|1946039_1946825_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186804.1|1946821_1947502_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|1947498_1947681_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|1947653_1947845_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|1947855_1948137_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763364.1|1948235_1948454_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488401.1|1948501_1948780_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_001354056.1|1948870_1949101_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
WP_001196928.1|1949058_1950267_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	74.9	4.7e-180
1950292:1950319	attR	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	2299492	2307227	5260440		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001033086.1|2299492_2300599_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
WP_001332228.1|2300591_2301059_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032139969.1|2301045_2301456_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857507.1|2301473_2302349_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_001023648.1|2302407_2303307_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_000699453.1|2303306_2304392_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_000183029.1|2304764_2305658_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_001116045.1|2305832_2307227_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 7
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	2401062	2410505	5260440		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|2401062_2402199_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|2402195_2404196_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|2404320_2404782_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|2404823_2405294_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|2405340_2406060_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2406056_2407742_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|2407963_2408695_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2408754_2408862_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|2408842_2409574_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|2409578_2410505_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 8
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	2613365	2699176	5260440	terminase,tRNA,lysis,protease,integrase,head,portal,transposase,holin	Enterobacteria_phage(47.62%)	105	2638176:2638191	2680092:2680107
WP_000156122.1|2613365_2614256_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	3.1e-67
WP_001293612.1|2614452_2615226_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569963.1|2615233_2615950_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|2615946_2616633_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737631.1|2616722_2617505_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|2617725_2618508_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825691.1|2618773_2619343_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334221.1|2619437_2620955_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
WP_000262113.1|2620991_2621480_-	colicin V production protein	NA	NA	NA	NA	NA
WP_001551400.1|2621647_2622310_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_001525140.1|2622299_2623568_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|2623637_2624552_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364327.1|2624707_2625367_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283590.1|2625449_2626262_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2626261_2627275_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001551402.1|2627340_2628477_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.7e-22
WP_001551404.1|2628575_2629571_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|2629567_2630746_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|2631011_2632232_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_094158896.1|2632390_2634397_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2634517_2634796_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089220.1|2634829_2635378_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2635377_2636187_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001551406.1|2636186_2637011_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001551407.1|2637014_2638100_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
WP_001309606.1|2638134_2639067_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
2638176:2638191	attL	GCTGCTCTTTGGTGAG	NA	NA	NA	NA
WP_000730805.1|2639232_2639784_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001551408.1|2639907_2640762_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001551409.1|2640763_2641288_-	fimbrial protein	NA	NA	NA	NA	NA
WP_122134641.1|2641284_2641713_-	fimbrial protein	NA	NA	NA	NA	NA
WP_122134639.1|2641663_2641771_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000678660.1|2641751_2642258_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000170518.1|2642274_2643024_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001114066.1|2643043_2645683_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033306.1|2645766_2646333_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2646994_2647480_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_001544761.1|2647682_2649827_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531924.1|2649826_2651137_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2651317_2651602_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_001389840.1|2651973_2653314_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001551410.1|2653679_2654951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2655132_2655888_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2656181_2657114_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_029701261.1|2657425_2658583_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.4e-221
WP_100249830.1|2658699_2659392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050596990.1|2659356_2660088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029701265.1|2660207_2662607_-|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	3.0e-77
WP_029701266.1|2662771_2664769_-	hypothetical protein	NA	Q716G2	Shigella_phage	98.3	0.0e+00
WP_029701268.1|2664768_2666157_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	65.1	8.2e-152
WP_029701269.1|2666166_2666859_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.1	3.5e-111
WP_029701271.1|2666861_2667317_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	5.2e-87
WP_029701273.1|2667316_2668018_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	98.3	3.9e-118
WP_021529423.1|2668017_2668512_-	hypothetical protein	NA	A0A1U9HWQ1	Salmonella_phage	46.0	5.1e-32
WP_060579113.1|2668514_2669933_-	hypothetical protein	NA	Q716G7	Shigella_phage	98.7	6.6e-274
WP_000246750.1|2669941_2670424_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_060579114.1|2670398_2670584_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	7.8e-26
WP_060579115.1|2670626_2671898_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
WP_000426735.1|2671909_2672794_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.7	8.1e-145
WP_000852333.1|2672807_2674934_-|portal	portal protein p19	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
WP_060579116.1|2674936_2676349_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
WP_021566250.1|2676345_2676786_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	100.0	3.5e-80
WP_000807788.1|2676788_2677031_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_029701280.1|2677134_2677473_-	hypothetical protein	NA	A0A1W6DXZ5	Salmonella_phage	88.3	2.1e-48
WP_001139680.1|2677712_2677865_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_029701281.1|2677852_2678320_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.7e-74
WP_000229390.1|2678316_2678793_-	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_000783734.1|2678776_2679100_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_021530015.1|2679609_2680128_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	98.3	6.5e-94
2680092:2680107	attR	GCTGCTCTTTGGTGAG	NA	NA	NA	NA
WP_000994516.1|2680124_2680313_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000006226.1|2680309_2680672_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	3.5e-62
WP_025748957.1|2680668_2680959_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	1.9e-50
WP_001286917.1|2680951_2681164_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950943.1|2681156_2681333_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	2.5e-26
WP_025748956.1|2681332_2681686_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	73.0	4.5e-38
WP_001254255.1|2681688_2681865_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_029701286.1|2681861_2682272_-	recombination protein NinB	NA	K7PJW4	Enterobacteria_phage	99.3	7.2e-72
WP_029701287.1|2682274_2682613_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.0	2.3e-31
WP_029701290.1|2682721_2682928_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.5e-30
WP_029701292.1|2683003_2684440_-	AAA family ATPase	NA	A0A220NRL4	Escherichia_phage	99.2	3.3e-273
WP_060579117.1|2684429_2685320_-	hypothetical protein	NA	K7PH45	Enterobacterial_phage	98.6	1.9e-157
WP_000251073.1|2685500_2685794_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000067728.1|2685913_2686129_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_001519589.1|2686204_2686900_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_072201588.1|2687245_2687623_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	3.1e-53
WP_000167595.1|2687631_2688102_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_060579118.1|2688245_2689214_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.4	7.7e-56
WP_000638547.1|2689238_2689370_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2689354_2689507_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|2689591_2689900_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_060579119.1|2689896_2690808_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.3	4.1e-168
WP_032153683.1|2690791_2691274_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_000753555.1|2691285_2691600_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_029701300.1|2691616_2691898_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_032153684.1|2691894_2692062_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701301.1|2692058_2692313_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_029701302.1|2692299_2692992_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
WP_000951706.1|2692993_2693203_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_029701304.1|2693199_2693991_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
WP_029701309.1|2693983_2694268_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
WP_000545716.1|2694339_2694507_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_001163428.1|2694564_2694765_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001316510.1|2695062_2695215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197021.1|2695294_2696542_-	MFS transporter	NA	NA	NA	NA	NA
WP_001551411.1|2696603_2697527_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001551412.1|2697742_2699176_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.3e-29
>prophage 9
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	2910293	2953032	5260440	terminase,tail,tRNA,head,holin	Salmonella_phage(53.33%)	56	NA	NA
WP_001295367.1|2910293_2910830_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|2910854_2911490_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|2911698_2912547_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001253100.1|2912857_2913124_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	83.0	2.7e-35
WP_001039127.1|2913425_2914271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904955.1|2914275_2914590_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.9	1.6e-39
WP_077634188.1|2914616_2915015_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.3	8.1e-12
WP_001174919.1|2915017_2915458_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_024192484.1|2915429_2916023_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.9	7.0e-60
WP_001551478.1|2916022_2916817_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	91.0	6.9e-79
WP_000049943.1|2916816_2917497_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	1.5e-103
WP_001551479.1|2917493_2918693_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	4.9e-185
WP_001270631.1|2918692_2919046_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_001551480.1|2919045_2919798_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.5	8.5e-87
WP_001551481.1|2919858_2920371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551482.1|2920367_2920703_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.2	1.7e-23
WP_072201604.1|2920702_2921122_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	72.9	4.6e-50
WP_072201605.1|2921128_2921767_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	87.3	1.3e-96
WP_000155119.1|2921769_2922072_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001298404.1|2922071_2922659_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_001551484.1|2922658_2924644_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_023141050.1|2924633_2924810_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
WP_000393954.1|2924821_2925274_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109249.1|2925277_2925718_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_001551485.1|2925728_2926874_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	5.2e-160
WP_001349562.1|2926877_2927441_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001551486.1|2927415_2927805_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_001551487.1|2927791_2928346_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	7.4e-80
WP_001551489.1|2928342_2928750_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.5e-69
WP_001107515.1|2928715_2928937_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001551491.1|2928978_2929920_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.6e-154
WP_001066732.1|2929931_2930438_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
WP_001551492.1|2930441_2931662_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	9.3e-200
WP_136759112.1|2931676_2932411_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_001551494.1|2932301_2933768_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	6.0e-262
WP_001551495.1|2933767_2935390_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000162796.1|2935392_2935965_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001551496.1|2936026_2936551_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.7	2.6e-42
WP_001194119.1|2936534_2937011_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2937014_2937356_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001551497.1|2937888_2938311_-	hypothetical protein	NA	Q8W638	Enterobacteria_phage	65.0	8.0e-42
WP_000034494.1|2938336_2938627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551498.1|2938942_2941204_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_000016208.1|2941207_2941408_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_001551499.1|2941549_2942224_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_001551500.1|2942599_2943169_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	52.7	3.2e-38
WP_001551501.1|2943539_2944442_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001551502.1|2944444_2945746_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	5.2e-132
WP_000769005.1|2945761_2946310_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_000551014.1|2946362_2946992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551504.1|2947038_2949102_+	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	6.7e-275
WP_001551506.1|2949166_2949928_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_001551508.1|2950163_2950358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551509.1|2950357_2950642_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.3e-27
WP_001551510.1|2950657_2951575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551511.1|2951637_2953032_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	1.0e-210
>prophage 10
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	3093510	3121250	5260440	tRNA,transposase	Escherichia_phage(36.36%)	33	NA	NA
WP_001067858.1|3093510_3094215_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001208066.1|3094337_3094745_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081550.1|3094865_3095858_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3095920_3097060_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3097199_3097826_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3097819_3098581_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000568924.1|3098561_3099611_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001219242.1|3099607_3100087_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_000246131.1|3100086_3100797_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000517476.1|3100815_3101127_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_001551549.1|3101320_3101644_-	DUF3561 family protein	NA	NA	NA	NA	NA
WP_001173673.1|3101693_3102299_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001551550.1|3102298_3103726_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_000372108.1|3103727_3104636_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_001551551.1|3104887_3105925_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000063172.1|3106619_3106913_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_001067858.1|3107035_3107740_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012477590.1|3107773_3108694_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.7e-175
WP_000557454.1|3109908_3110769_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|3110781_3111324_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|3111805_3111997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|3112002_3112248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579135.1|3112298_3113426_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|3113462_3114167_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|3114288_3115194_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|3115190_3116429_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|3116428_3117013_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|3116958_3117315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|3117505_3118270_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024143553.1|3118298_3118481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130000.1|3118496_3118802_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|3118812_3120018_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000427623.1|3120245_3121250_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	3124767	3162530	5260440	transposase,integrase	Escherichia_phage(61.54%)	35	3119731:3119744	3156117:3156130
3119731:3119744	attL	GGCAGACGGCAGCG	NA	NA	NA	NA
WP_000845048.1|3124767_3125781_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067858.1|3126272_3126977_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001237173.1|3127124_3127718_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_011790968.1|3128293_3129544_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_000562982.1|3130492_3130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104457.1|3130767_3132132_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|3132220_3132997_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3133001_3133640_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001551546.1|3133636_3134899_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_000847985.1|3134895_3135804_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|3135999_3136767_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|3136817_3137474_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272891.1|3137579_3140141_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001551545.1|3140427_3140772_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_000301062.1|3140810_3141239_-	transporter	NA	NA	NA	NA	NA
WP_001067858.1|3141576_3142281_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_138585042.1|3142257_3142662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|3142938_3143799_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|3144270_3144975_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_060579132.1|3145008_3145896_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_000281438.1|3145892_3146543_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_001551553.1|3146524_3147271_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_000206445.1|3147281_3148337_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_000029331.1|3148351_3148888_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_001551554.1|3148884_3150447_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_001551555.1|3150544_3153244_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_000956458.1|3153438_3153591_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001521160.1|3153855_3154590_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_001290706.1|3154663_3156376_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
3156117:3156130	attR	GGCAGACGGCAGCG	NA	NA	NA	NA
WP_001551556.1|3156375_3158175_-	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000987944.1|3158490_3158856_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_094158903.1|3158933_3160205_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000109536.1|3160195_3160456_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_001130266.1|3160472_3161048_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_106106683.1|3161182_3162530_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.7	4.3e-73
>prophage 12
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	3248956	3256071	5260440	transposase	Salmonella_phage(33.33%)	6	NA	NA
WP_001550737.1|3248956_3249415_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_000256426.1|3249597_3251016_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000608644.1|3251453_3252716_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_012579082.1|3252965_3253841_+	class A extended-spectrum beta-lactamase CTX-M-24	NA	A0A1B0VBP7	Salmonella_phage	99.3	2.3e-152
WP_012579081.1|3253920_3254844_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_000603518.1|3255309_3256071_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 13
NZ_CP032145	Escherichia coli strain 15.TR.026_OXA chromosome, complete genome	5260440	5178587	5228738	5260440	terminase,tail,integrase,head,portal,holin	Enterobacteria_phage(43.64%)	67	5173386:5173400	5201334:5201348
5173386:5173400	attL	GATGATGATATTGAA	NA	NA	NA	NA
WP_001218280.1|5178587_5179811_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
WP_053891200.1|5180182_5181409_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_029402496.1|5181605_5181854_-	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.7e-31
WP_023154558.1|5181853_5182474_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.2	2.5e-116
WP_001242716.1|5182473_5182836_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_000008178.1|5182826_5183363_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081305.1|5183490_5184315_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	2.3e-149
WP_000135680.1|5184380_5184743_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_120785030.1|5184757_5185003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357060.1|5185204_5185708_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000450737.1|5186075_5186702_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|5186799_5187000_+	cell division protein	NA	NA	NA	NA	NA
WP_060579163.1|5187037_5187595_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_071789194.1|5187770_5187950_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_060579161.1|5187939_5188881_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	95.8	1.2e-135
WP_001305611.1|5188877_5189372_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_021518588.1|5189371_5190025_+	phage N-6-adenine-methyltransferase	NA	S5M7S1	Escherichia_phage	99.1	4.3e-127
WP_000210181.1|5190021_5190348_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_000767110.1|5190344_5190740_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|5190902_5191718_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001589620.1|5191725_5192715_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001589621.1|5192728_5193481_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.6	7.1e-134
WP_122990953.1|5193759_5193849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001589622.1|5193903_5194116_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|5194416_5194632_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|5195384_5195600_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_072201599.1|5195604_5196156_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.3e-36
WP_001557934.1|5196103_5196364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|5196477_5197011_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071778.1|5197007_5197505_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|5197868_5198081_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|5198091_5198280_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5198427_5198583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|5198755_5198929_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548594.1|5199224_5199431_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_001307652.1|5199681_5199876_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|5200264_5200810_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_019842488.1|5200784_5202710_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
5201334:5201348	attR	GATGATGATATTGAA	NA	NA	NA	NA
WP_000198149.1|5202706_5202913_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_019842487.1|5202909_5204511_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.2e-310
WP_000123236.1|5204491_5205811_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_060579022.1|5205820_5206153_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000158899.1|5207274_5207670_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|5207681_5208035_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_021528534.1|5208046_5208625_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_032244082.1|5208621_5209017_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	97.7	1.4e-69
WP_001577918.1|5209024_5209765_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_060579045.1|5209780_5210203_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.1	3.6e-58
WP_000459457.1|5210184_5210619_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_106106625.1|5210611_5213173_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.3	0.0e+00
WP_000847355.1|5213169_5213499_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_001560932.1|5213498_5214197_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	6.8e-131
WP_024177847.1|5214201_5214945_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|5214881_5215484_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000515622.1|5215544_5218940_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.5	0.0e+00
WP_094179059.1|5219007_5219607_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	2.8e-101
WP_094158907.1|5219671_5222062_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	48.5	9.9e-105
WP_000654173.1|5222058_5222340_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	7.0e-18
WP_060579084.1|5222349_5223054_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_001545206.1|5223064_5223358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|5223585_5224176_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|5224555_5224789_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_120795384.1|5224857_5224971_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001217539.1|5225397_5225646_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5225865_5227452_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5227844_5228450_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5228576_5228738_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
