The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032518	Cupriavidus oxalaticus strain T2 chromosome 1, complete sequence	2875465	1767530	1830665	2875465	protease,transposase,plate	Acidithiobacillus_phage(40.0%)	52	NA	NA
WP_151070206.1|1767530_1769468_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	46.2	2.4e-109
WP_151070207.1|1769589_1769853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070892.1|1769887_1770553_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_151070208.1|1770552_1770804_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_151070209.1|1771154_1771376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070210.1|1771372_1773826_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.1	1.0e-96
WP_151070211.1|1774008_1775187_-	methionine adenosyltransferase	NA	NA	NA	NA	NA
WP_151070212.1|1775379_1776027_+	LemA family protein	NA	NA	NA	NA	NA
WP_151070213.1|1776023_1776875_+	YgcG family protein	NA	NA	NA	NA	NA
WP_151070214.1|1776874_1777375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070215.1|1777415_1778693_+	DUF4010 domain-containing protein	NA	NA	NA	NA	NA
WP_151070216.1|1778960_1779308_+	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_151070218.1|1780578_1780824_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_151070219.1|1781259_1781616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070220.1|1782767_1784096_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_151070221.1|1784264_1785713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070222.1|1785721_1786495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070223.1|1786497_1787943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070224.1|1787939_1788680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070225.1|1788818_1789565_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.5	2.5e-22
WP_151070226.1|1789734_1794339_+	very short patch repair endonuclease	NA	NA	NA	NA	NA
WP_151070227.1|1794618_1795803_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_167525631.1|1796248_1797103_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_151070894.1|1797447_1797738_+	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_151070229.1|1797984_1798449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070230.1|1798747_1799056_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_151070231.1|1799553_1800066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070232.1|1800271_1800847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070191.1|1800992_1802537_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	2.5e-157
WP_151070192.1|1802564_1803302_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	56.6	6.4e-71
WP_167525632.1|1803517_1804033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070233.1|1805059_1806331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070234.1|1806891_1807380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070235.1|1807613_1809164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070236.1|1809160_1809967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151070237.1|1810197_1812270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063237702.1|1812872_1813808_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151070238.1|1813941_1815741_+	DNA alkylation response protein	NA	NA	NA	NA	NA
WP_151070239.1|1815960_1816935_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_151070240.1|1816952_1818074_+	CoA transferase	NA	NA	NA	NA	NA
WP_063237706.1|1818178_1819879_-	lactate permease LctP family transporter	NA	NA	NA	NA	NA
WP_151070241.1|1820123_1821569_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_151070242.1|1821565_1822303_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_151070243.1|1822299_1823082_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_063237789.1|1823266_1823938_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_151070244.1|1823988_1825026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070245.1|1825551_1825959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167525633.1|1825945_1826086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070246.1|1826126_1827185_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_151070247.1|1827192_1828227_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_151070248.1|1828229_1830110_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_151070249.1|1830125_1830665_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP032519	Cupriavidus oxalaticus strain T2 chromosome 2, complete sequence	3852567	823874	832774	3852567		Bacillus_phage(16.67%)	8	NA	NA
WP_063237080.1|823874_825290_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.5	2.1e-70
WP_063237081.1|825370_826315_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	4.2e-14
WP_063237082.1|826342_827338_+	ADP-glyceromanno-heptose 6-epimerase	NA	Q58M42	Prochlorococcus_phage	33.4	1.2e-27
WP_063237083.1|827507_827885_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063237085.1|828138_829440_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	65.5	2.2e-146
WP_063237086.1|829569_830472_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	42.1	1.8e-51
WP_151071313.1|830541_831648_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_151071314.1|831850_832774_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	1.1e-43
>prophage 2
NZ_CP032519	Cupriavidus oxalaticus strain T2 chromosome 2, complete sequence	3852567	2416649	2460030	3852567	head,protease,tail,portal,terminase,integrase,capsid	Burkholderia_phage(20.0%)	63	2417190:2417232	2460095:2460137
WP_063238267.1|2416649_2417021_+	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	64.7	1.1e-31
2417190:2417232	attL	TGGCGGAGAGAGGGGGATTCGAACCCCCGATAGGCTATTAACC	NA	NA	NA	NA
WP_151072159.1|2417570_2417984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167525708.1|2417965_2418151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072160.1|2418147_2418561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072161.1|2418544_2418883_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_151072162.1|2418918_2419449_-	hypothetical protein	NA	A0A0H5BBZ5	Pseudomonas_phage	56.0	1.9e-40
WP_151072163.1|2419986_2420244_-	hypothetical protein	NA	I6NSG3	Burkholderia_phage	42.6	1.7e-10
WP_151072164.1|2420322_2420616_-	hypothetical protein	NA	A0A0M4RBJ6	Mycobacterium_phage	41.5	7.8e-12
WP_151072165.1|2420612_2422319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072166.1|2422340_2422733_-	hypothetical protein	NA	Q6VSZ7	Vibrio_phage	38.8	2.0e-10
WP_151072167.1|2422794_2423397_-|tail	tail fiber assembly protein	tail	K4NXJ9	Burkholderia_phage	34.5	2.5e-20
WP_151072168.1|2423408_2424074_-|tail	phage tail protein	tail	A0A1W6JT73	Escherichia_phage	52.1	1.2e-28
WP_167525709.1|2424089_2427281_-	hypothetical protein	NA	A0A1B1IRL4	uncultured_Mediterranean_phage	29.0	1.2e-73
WP_167525710.1|2427291_2427693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072170.1|2427692_2428244_-	hypothetical protein	NA	A0A2P1CL89	Pantoea_phage	28.2	5.8e-16
WP_151072171.1|2428243_2428834_-	hypothetical protein	NA	A0A0E3GML3	Enterobacteria_phage	38.5	1.9e-25
WP_151072172.1|2428837_2431597_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	33.0	4.7e-82
WP_151072173.1|2431586_2432030_-	hypothetical protein	NA	A0A0S2SXK7	Bacillus_phage	33.3	3.0e-07
WP_151072174.1|2432029_2432275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072175.1|2432725_2433370_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_151072176.1|2433430_2433778_-	DUF3168 domain-containing protein	NA	C4ML11	Xanthomonas_virus	35.7	8.1e-08
WP_151072177.1|2433770_2434109_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_151072178.1|2434105_2434432_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q3HQT2	Burkholderia_phage	41.6	1.2e-16
WP_151072179.1|2434433_2434691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072873.1|2434751_2435966_-|capsid	phage major capsid protein	capsid	I7HDH9	Xanthomonas_virus	66.4	1.9e-128
WP_151072180.1|2436085_2436955_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	61.8	1.2e-76
WP_151072181.1|2436951_2438253_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	73.9	1.1e-174
WP_151072182.1|2438252_2439938_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	71.2	2.8e-231
WP_151072183.1|2439942_2440446_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	47.9	9.3e-21
WP_151072184.1|2440961_2441192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072185.1|2441204_2441411_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_151072186.1|2441998_2442652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072188.1|2442929_2443493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072189.1|2443680_2444025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072190.1|2444021_2444414_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	42.0	7.2e-13
WP_151072191.1|2444584_2444800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072192.1|2444796_2445840_-	helix-turn-helix domain-containing protein	NA	A4JX55	Burkholderia_virus	39.8	1.9e-44
WP_151072193.1|2446339_2446633_-	DUF1364 family protein	NA	NA	NA	NA	NA
WP_151072194.1|2446632_2446926_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167525711.1|2446934_2447111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072195.1|2447107_2447299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072196.1|2447295_2447598_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_151072197.1|2447755_2447965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072198.1|2448057_2448312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072874.1|2448308_2448572_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151072199.1|2448705_2449404_+	XRE family transcriptional regulator	NA	Q94MM0	Bordetella_phage	50.0	5.4e-35
WP_151072200.1|2449423_2449954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072201.1|2449987_2450377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072202.1|2450369_2450945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072203.1|2450996_2451194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072204.1|2451392_2451665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072205.1|2451661_2451895_+	hypothetical protein	NA	R4JG80	Burkholderia_phage	57.7	6.6e-06
WP_151072875.1|2452503_2453157_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_151072876.1|2453255_2453621_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_151072877.1|2453803_2454169_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_151072206.1|2454189_2454543_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_151072207.1|2454763_2455951_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.5	5.0e-49
WP_151072208.1|2457093_2457300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072209.1|2457299_2457587_+	DUF4031 domain-containing protein	NA	A0A125RNQ7	Pseudomonas_phage	61.1	3.7e-22
WP_151072210.1|2457589_2458273_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_151072211.1|2458269_2458548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072878.1|2458696_2458909_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_151072879.1|2459079_2460030_+|integrase	integrase	integrase	NA	NA	NA	NA
2460095:2460137	attR	TGGCGGAGAGAGGGGGATTCGAACCCCCGATAGGCTATTAACC	NA	NA	NA	NA
>prophage 3
NZ_CP032519	Cupriavidus oxalaticus strain T2 chromosome 2, complete sequence	3852567	3018716	3028000	3852567	protease	Methanothermobacter_phage(16.67%)	9	NA	NA
WP_063240196.1|3018716_3019919_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.6	3.4e-37
WP_063240197.1|3019949_3020450_+	dUTP diphosphatase	NA	A0A289ZTC1	Serratia_phage	54.9	7.3e-42
WP_063240256.1|3020506_3021355_-	VOC family protein	NA	NA	NA	NA	NA
WP_151072470.1|3021402_3022401_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_029045978.1|3022561_3024856_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	3.1e-172
WP_010814998.1|3024852_3025179_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	1.3e-12
WP_063240199.1|3025710_3025917_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.8	1.9e-20
WP_063240200.1|3026140_3026602_-	glyoxalase	NA	NA	NA	NA	NA
WP_063240201.1|3026749_3028000_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.1e-11
>prophage 4
NZ_CP032519	Cupriavidus oxalaticus strain T2 chromosome 2, complete sequence	3852567	3051274	3061756	3852567		Roseobacter_phage(14.29%)	9	NA	NA
WP_063240223.1|3051274_3052804_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	32.3	3.9e-22
WP_063240224.1|3052804_3053332_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_151072482.1|3053363_3054005_+	deoxynucleoside kinase	NA	A0A1J0F9Q3	Only_Syngen_Nebraska_virus	28.2	1.7e-06
WP_151072483.1|3054111_3054933_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	31.7	6.3e-35
WP_063240227.1|3054937_3055636_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_151072484.1|3055632_3056316_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	6.9e-11
WP_151072485.1|3056338_3058261_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	36.5	7.6e-47
WP_063240230.1|3058489_3059635_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.8	1.7e-22
WP_151072486.1|3059806_3061756_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	2.8e-145
>prophage 5
NZ_CP032519	Cupriavidus oxalaticus strain T2 chromosome 2, complete sequence	3852567	3389384	3459064	3852567	integrase,protease,capsid,transposase	Ralstonia_phage(16.67%)	49	3389158:3389205	3458448:3458495
3389158:3389205	attL	TGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAATCA	NA	NA	NA	NA
WP_151072610.1|3389384_3390749_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A221SAN4	Ralstonia_phage	22.4	3.8e-08
WP_151072611.1|3390700_3390919_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151072612.1|3391216_3391510_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	43.9	2.2e-14
WP_151072613.1|3391527_3394212_-	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_151072614.1|3394208_3396224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072615.1|3396220_3397537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072904.1|3397801_3398629_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_151072616.1|3398943_3400575_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_151072617.1|3400691_3401627_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_151072618.1|3401635_3405016_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_151072619.1|3405012_3407676_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_151072620.1|3407909_3408671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072621.1|3408677_3409745_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_167525721.1|3409999_3411415_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_167525722.1|3411411_3413568_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_151072624.1|3413658_3414072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072905.1|3414424_3416524_+	AAA family ATPase	NA	A0A1C9EG55	Acidianus_two-tailed_virus	33.8	1.8e-09
WP_151072625.1|3416547_3417792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072626.1|3417867_3418848_-	hypothetical protein	NA	G3M9X5	Bacillus_virus	25.9	1.2e-16
WP_151072627.1|3418967_3420110_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	52.3	1.3e-97
WP_151072906.1|3420241_3420682_-	DUF3293 domain-containing protein	NA	NA	NA	NA	NA
WP_151069397.1|3420743_3422120_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	25.4	4.2e-15
WP_151072628.1|3422972_3425876_-	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_151072629.1|3425889_3428745_-	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	25.1	6.2e-29
WP_151072630.1|3428786_3432305_-	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.7	2.1e-50
WP_151072631.1|3432333_3433230_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_151072632.1|3434234_3435200_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.7	3.7e-58
WP_151072633.1|3435270_3436287_+	endonuclease	NA	A6XMH8	Bacillus_virus	40.4	9.9e-54
WP_151072634.1|3436280_3437192_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_151072635.1|3437188_3438160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072636.1|3438260_3438563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072637.1|3438585_3438933_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167525741.1|3439147_3440953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072638.1|3441136_3441505_+	hypothetical protein	NA	A0A1L7N0T7	Ralstonia_phage	65.6	1.0e-40
WP_151072639.1|3441547_3441907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072640.1|3442127_3443774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151070364.1|3443831_3444377_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_151070365.1|3444345_3444870_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_151072641.1|3444900_3445494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072642.1|3445497_3446664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072908.1|3447045_3447231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072643.1|3447281_3448076_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151072644.1|3448079_3449405_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_151072645.1|3449539_3450070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072646.1|3450142_3452152_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_151072647.1|3452800_3453934_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_151072648.1|3455381_3457211_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_151072649.1|3457470_3458223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063241213.1|3458575_3459064_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	47.5	2.2e-19
3458448:3458495	attR	TGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAATCA	NA	NA	NA	NA
>prophage 6
NZ_CP032519	Cupriavidus oxalaticus strain T2 chromosome 2, complete sequence	3852567	3623610	3629684	3852567		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_063240918.1|3623610_3624198_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.7	3.4e-14
WP_063240917.1|3624251_3624647_-	YraN family protein	NA	NA	NA	NA	NA
WP_151072699.1|3624662_3625583_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	41.0	3.5e-34
WP_063240973.1|3625671_3626361_-	septal ring lytic transglycosylase RlpA family protein	NA	H2BCY4	Synechococcus_phage	53.2	2.7e-18
WP_151072700.1|3626733_3627384_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_151072701.1|3627388_3628045_+	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	41.0	6.0e-36
WP_063240913.1|3628253_3628487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063240912.1|3628568_3628928_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	43.6	4.7e-19
WP_151072702.1|3629108_3629684_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	38.5	2.0e-19
>prophage 1
NZ_CP032520	Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence	568815	59546	96441	568815	integrase,transposase	Salmonella_phage(60.0%)	30	50686:50700	103182:103196
50686:50700	attL	GGCATTGTCGCGCGC	NA	NA	NA	NA
WP_151069191.1|59546_60782_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151069190.1|60666_62295_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151069189.1|62291_64610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115737136.1|64602_65103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072924.1|65416_66112_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_151072925.1|66108_66612_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151072926.1|68926_69352_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_001138070.1|69795_72762_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_003124096.1|72764_73325_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_003132006.1|73455_74445_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003132004.1|74441_74678_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995360.1|74674_75040_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003156770.1|75057_76743_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
WP_003131987.1|76814_77090_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003131974.1|77102_77453_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131969.1|77524_77959_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_151072917.1|78064_78493_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_151073258.1|78492_78948_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_151072927.1|79897_80821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072928.1|82603_83779_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	76.2	9.3e-64
WP_151072929.1|83891_84455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151072930.1|84447_86811_+	DEAD/DEAH box helicase family protein	NA	M1HKT1	Acanthocystis_turfacea_Chlorella_virus	29.7	1.7e-32
WP_151072931.1|87030_87366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151072932.1|87708_88743_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_151072933.1|89023_89251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151072934.1|90299_90617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115737136.1|90884_91385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151069189.1|91377_93696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151069190.1|93692_95321_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151069191.1|95205_96441_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
103182:103196	attR	GCGCGCGACAATGCC	NA	NA	NA	NA
>prophage 2
NZ_CP032520	Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence	568815	347128	401569	568815	capsid,integrase,transposase	Pseudomonas_phage(30.0%)	54	337196:337211	404257:404272
337196:337211	attL	CGGCTTTGTCGCGCCG	NA	NA	NA	NA
WP_151073135.1|347128_348739_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_151073136.1|348746_349613_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151073137.1|349572_350106_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151073138.1|350815_351175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073139.1|351319_351538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135707220.1|351982_352282_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_151073141.1|352256_352514_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_151073142.1|352553_353885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116322054.1|354030_355257_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_151073143.1|355343_355922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073144.1|356621_356810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073145.1|356940_357147_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_151073146.1|357209_357731_-	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	59.9	1.5e-37
WP_151073147.1|357868_358948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151073148.1|359146_360148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167525752.1|361026_362001_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_151073150.1|362144_362879_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151073151.1|362923_364078_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151073152.1|364099_364876_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_151073153.1|364905_365658_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	7.9e-16
WP_151073154.1|365826_366924_+	CoA transferase	NA	NA	NA	NA	NA
WP_151073155.1|367027_368164_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151073156.1|368204_369395_+	lipid-transfer protein	NA	NA	NA	NA	NA
WP_151073157.1|369427_369877_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_151073158.1|369899_370319_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_151073159.1|370355_371189_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_151073160.1|371311_372871_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.3e-32
WP_151073161.1|372969_374541_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	2.7e-26
WP_151073162.1|374612_375398_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_151073163.1|375505_376477_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_151073164.1|376572_376992_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_151073165.1|377015_377465_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_151073166.1|377507_378647_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151073167.1|378742_380437_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	33.1	3.3e-38
WP_151073168.1|380475_381465_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_151073169.1|381631_384445_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151073170.1|384690_385878_+	lipid-transfer protein	NA	NA	NA	NA	NA
WP_151073171.1|385908_386739_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	2.4e-18
WP_151073172.1|387040_388252_+	CoA transferase	NA	NA	NA	NA	NA
WP_151073173.1|388285_389449_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151073174.1|389464_389941_+	acyl dehydratase	NA	NA	NA	NA	NA
WP_151073175.1|389946_390732_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_151073176.1|390781_391372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167525753.1|391524_392676_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151069397.1|393137_394514_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.4	1.1e-28
WP_151073178.1|394845_395166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151073179.1|395240_396182_+	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	31.7	4.6e-29
WP_151073180.1|396181_396451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073181.1|396450_396888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073182.1|397215_398742_+	DEAD/DEAH box helicase family protein	NA	A0A0H5ARP5	Pseudomonas_phage	37.2	1.2e-66
WP_151073183.1|398805_399702_+	hypothetical protein	NA	A0A2H4GY91	Pseudomonas_phage	31.9	3.3e-29
WP_151073184.1|399723_400170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073185.1|400250_400550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073186.1|400576_401569_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
404257:404272	attR	CGGCTTTGTCGCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP032520	Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence	568815	423218	546804	568815	integrase,transposase	Bacillus_phage(21.05%)	104	432498:432521	550807:550830
WP_167525755.1|423218_424499_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151073205.1|424591_425794_+	KfrA protein	NA	NA	NA	NA	NA
WP_151073206.1|425777_425981_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_151073207.1|426132_426486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073208.1|426577_429577_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	20.8	3.6e-51
WP_151073209.1|429569_429914_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151073210.1|430464_430812_-	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_167525756.1|430943_431450_-	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_151073212.1|432233_432584_-	hypothetical protein	NA	NA	NA	NA	NA
432498:432521	attL	CATGTCCATGCCGTCCATCGATCC	NA	NA	NA	NA
WP_151073213.1|432580_435751_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_151073214.1|435747_437292_-	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	27.0	2.8e-07
WP_151073215.1|437288_438590_-	TolC family protein	NA	NA	NA	NA	NA
WP_151073280.1|438660_439065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151073216.1|439321_439750_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_151073281.1|439812_442185_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	5.3e-90
WP_151073282.1|442783_443020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073217.1|443173_443476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073218.1|443519_443828_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_167525757.1|444099_444291_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_151073220.1|444357_445017_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_151073221.1|445075_445681_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_151073222.1|445726_446050_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_151073223.1|446148_446823_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_151073224.1|447086_447836_+	slipin family protein	NA	A0A1V0SB59	Catovirus	26.0	4.8e-13
WP_151073225.1|447966_449664_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151073226.1|449783_450044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167525758.1|450209_450365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151073227.1|450432_452760_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151073283.1|452774_452924_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_151073228.1|452965_454363_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	26.4	1.4e-21
WP_151073229.1|454772_455294_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_151073230.1|455789_456422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151073231.1|456771_457104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073232.1|457218_458883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073285.1|460017_461097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073284.1|461150_461954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073233.1|461971_463339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073234.1|463351_463627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167525759.1|463856_464777_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151073236.1|464871_466422_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	5.4e-35
WP_151073237.1|466431_467610_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151073238.1|467658_468645_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_151073239.1|468647_469790_+	CoA transferase	NA	NA	NA	NA	NA
WP_151073240.1|469897_471055_+	porin	NA	NA	NA	NA	NA
WP_151073286.1|471652_473065_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_151073241.1|473142_474171_+	DUF1254 domain-containing protein	NA	A0A2P0VP21	Tetraselmis_virus	38.6	5.8e-54
WP_151073242.1|474696_475677_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151073243.1|475673_476627_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151073244.1|476623_477622_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.1	3.8e-18
WP_151073245.1|477840_480840_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	20.9	1.9e-52
WP_151073246.1|480832_481177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151073247.1|482205_482544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151073248.1|482540_485711_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.7	1.0e-64
WP_151073249.1|485707_487273_-	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	26.0	4.1e-06
WP_151023068.1|487269_488577_-	TolC family protein	NA	NA	NA	NA	NA
WP_115737209.1|488649_489048_-	copper resistance protein	NA	NA	NA	NA	NA
WP_062799422.1|489209_489431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145987315.1|490025_490244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116322061.1|491230_491533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073250.1|491780_492179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151073251.1|492358_493237_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151073252.1|493585_494062_+	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_115737205.1|494191_494428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115737204.1|494729_496466_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_082371458.1|496473_497286_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_115737294.1|497250_498516_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_115737203.1|498685_498961_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_115737202.1|498974_501416_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.4	1.5e-87
WP_053823085.1|501480_501897_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_053821772.1|501958_502489_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_082371627.1|503109_503307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082371461.1|503522_503870_-	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_053821774.1|504255_504732_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_115737201.1|504800_505718_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_053823086.1|505725_506112_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_053823087.1|506150_507140_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_053821776.1|507454_509341_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_053821777.1|509543_510230_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.6e-31
WP_053821778.1|510226_511621_+	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.7	5.6e-07
WP_082371462.1|511711_512779_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	27.2	3.1e-05
WP_115737200.1|512846_513905_-	porin	NA	NA	NA	NA	NA
WP_053821780.1|514838_515123_-	periplasmic Cu(I)/Cu(II)-binding protein CopK	NA	NA	NA	NA	NA
WP_116322066.1|515212_515599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115737199.1|515837_516896_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_115737198.1|516826_518764_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_062799392.1|519029_519356_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_053821782.1|519553_521368_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_062799390.1|521368_522364_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_151073253.1|522385_524971_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_115737292.1|525676_525904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115737291.1|526961_528611_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_115737196.1|529656_530775_+	TolC family protein	NA	NA	NA	NA	NA
WP_062799361.1|530771_532313_+	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	25.9	6.8e-06
WP_151073254.1|532309_535480_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_053821791.1|535476_535830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082371464.1|536229_537126_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_053821792.1|537286_537919_+	cation transporter	NA	NA	NA	NA	NA
WP_115737195.1|538000_541033_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.9	3.4e-150
WP_053821794.1|541022_541517_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_062799357.1|541644_542337_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053821795.1|542333_542759_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_167525760.1|543024_544265_-|transposase	IS3-like element ISRme15 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.9	5.5e-131
WP_115737194.1|544767_545292_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_151070220.1|545475_546804_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.1	2.4e-52
550807:550830	attR	GGATCGATGGACGGCATGGACATG	NA	NA	NA	NA
