The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044499	Lactobacillus dextrinicus strain LH506 chromosome, complete genome	1836976	390263	399185	1836976		Bacillus_phage(33.33%)	9	NA	NA
WP_151425823.1|390263_391379_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	35.0	1.1e-05
WP_057754027.1|391397_392114_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.7	2.0e-32
WP_057754024.1|392091_392979_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_057754021.1|393171_393870_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	1.6e-34
WP_057754018.1|393859_395578_+	hypothetical protein	NA	W8CYF6	Bacillus_phage	32.4	3.4e-22
WP_057754015.1|395692_396553_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	M1U9L0	Synechococcus_phage	28.0	5.7e-10
WP_057754012.1|396549_397476_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_057754009.1|397475_398372_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_057754007.1|398375_399185_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	26.8	5.7e-12
>prophage 2
NZ_CP044499	Lactobacillus dextrinicus strain LH506 chromosome, complete genome	1836976	657723	673000	1836976		Streptococcus_phage(81.82%)	13	NA	NA
WP_057756805.1|657723_659022_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	63.1	1.7e-143
WP_057756807.1|659105_660506_+	CoA-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.3	8.1e-14
WP_057756810.1|660615_661521_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	41.6	2.8e-60
WP_057756811.1|661536_662544_-	transglycosylase SLT domain-containing protein	NA	A0A1S5SEZ8	Streptococcus_phage	52.7	1.9e-97
WP_057756851.1|662540_664649_-	ABC transporter permease	NA	A0A1S5SF30	Streptococcus_phage	49.3	3.3e-128
WP_057756813.1|664648_667105_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	65.4	0.0e+00
WP_057756815.1|667101_667482_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	66.1	1.1e-39
WP_057756817.1|667541_668057_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	39.7	3.6e-28
WP_057756819.1|668061_668283_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	82.2	2.2e-27
WP_057756821.1|668328_669513_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	47.8	4.5e-98
WP_057756823.1|670112_670706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057756826.1|670702_671563_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_057756828.1|671674_673000_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	61.7	1.1e-148
>prophage 3
NZ_CP044499	Lactobacillus dextrinicus strain LH506 chromosome, complete genome	1836976	816972	897159	1836976	integrase,holin,head,terminase,capsid,tail,portal	Lactobacillus_phage(33.33%)	112	861328:861387	899328:899405
WP_057755915.1|816972_818070_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	48.8	1.3e-99
WP_057755913.1|818257_819046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755910.1|819042_819711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057755907.1|819807_820128_-	DUF898 family protein	NA	NA	NA	NA	NA
WP_057755904.1|820166_820949_-	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	65.9	2.8e-08
WP_057755890.1|821052_821529_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_057755889.1|821627_822029_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P0ZLA0	Lactobacillus_phage	35.2	2.5e-13
WP_057755886.1|822042_822399_-	helix-turn-helix domain-containing protein	NA	A0A2P0ZLA1	Lactobacillus_phage	36.4	2.8e-16
WP_083479523.1|822667_823363_+	hypothetical protein	NA	F8J1E2	Lactobacillus_phage	48.0	1.0e-46
WP_057755884.1|823394_823610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755881.1|823709_823958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057755878.1|824283_824478_+	helix-turn-helix transcriptional regulator	NA	B3GVX6	Streptococcus_phage	53.4	1.0e-07
WP_057755872.1|824490_824811_+	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	58.1	2.7e-18
WP_057755868.1|824824_825007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083479522.1|825101_825905_+	ERF family protein	NA	A0A059T676	Listeria_phage	39.6	7.9e-22
WP_057755865.1|825904_826822_+	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_057755863.1|826824_827532_+	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	39.9	2.9e-36
WP_057755852.1|828426_828828_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	62.8	1.3e-46
WP_057755847.1|828842_829601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755837.1|829590_829818_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057755825.1|829814_830006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755823.1|830002_830374_+	hypothetical protein	NA	C1KFT7	Lactobacillus_virus	32.8	2.3e-08
WP_057755821.1|830374_830596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755819.1|830576_830987_+	hypothetical protein	NA	E9LUP5	Lactobacillus_phage	43.8	2.4e-19
WP_057755817.1|831200_831503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057756090.1|831579_831999_+|terminase	terminase	terminase	Q9AZ67	Lactococcus_phage	72.8	1.7e-44
WP_057755816.1|831991_833365_+|terminase	phage terminase large subunit	terminase	Q2QER6	Lactococcus_phage	75.3	3.4e-206
WP_057755813.1|833375_834896_+|portal	phage portal protein	portal	D2J056	Enterococcus_phage	61.2	3.6e-177
WP_151425886.1|835191_836043_+	hypothetical protein	NA	D2J057	Enterococcus_phage	51.0	6.8e-48
WP_057755809.1|836029_836248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755808.1|836303_836507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755806.1|836634_837195_+	scaffolding protein	NA	D2J060	Enterococcus_phage	71.1	1.9e-62
WP_057755804.1|837208_838072_+	hypothetical protein	NA	A0A1P8BLL0	Lactococcus_phage	44.9	2.5e-58
WP_057755801.1|838088_838625_+	hypothetical protein	NA	D2J063	Enterococcus_phage	65.7	3.4e-61
WP_057755800.1|838624_838954_+|head	phage head closure protein	head	D2J064	Enterococcus_phage	63.0	2.1e-34
WP_057755798.1|838946_839378_+	hypothetical protein	NA	D2J065	Enterococcus_phage	68.3	3.4e-48
WP_057755796.1|839380_839764_+	hypothetical protein	NA	D2J066	Enterococcus_phage	64.0	2.8e-41
WP_057755795.1|839750_840374_+	hypothetical protein	NA	D2J067	Enterococcus_phage	72.6	4.9e-80
WP_057755792.1|840373_840796_+	hypothetical protein	NA	D2J068	Enterococcus_phage	62.1	1.0e-41
WP_151425887.1|840936_841125_+	peptide methionine sulfoxide reductase	NA	D2J069	Enterococcus_phage	50.0	7.4e-08
WP_057755790.1|841124_843587_+	hypothetical protein	NA	D2J070	Enterococcus_phage	32.2	1.2e-23
WP_057755788.1|843599_844475_+|tail	phage tail family protein	tail	D2J071	Enterococcus_phage	72.5	4.3e-122
WP_057755786.1|844474_845560_+	hypothetical protein	NA	D2J072	Enterococcus_phage	75.6	1.3e-157
WP_057755784.1|845564_846575_+	hypothetical protein	NA	D2J073	Enterococcus_phage	58.4	2.3e-103
WP_057755782.1|846575_847007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755781.1|847021_847390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083479521.1|847389_847530_+	XkdX family protein	NA	NA	NA	NA	NA
WP_057755779.1|847541_847838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755776.1|847827_848100_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	55.4	1.5e-20
WP_057755773.1|848099_849155_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A1ERA5	Lactobacillus_phage	48.3	1.5e-49
WP_057755770.1|849633_849912_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A9D9X7	Lactobacillus_prophage	43.4	3.2e-07
WP_151425840.1|849947_850307_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	50.9	1.0e-21
WP_057755767.1|850617_850824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755766.1|851025_851865_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_057755765.1|851988_852765_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057755763.1|852939_853293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755762.1|853387_854125_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057755759.1|854121_855600_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.0	4.2e-29
WP_057755756.1|855661_857848_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.5	6.4e-167
WP_057755754.1|858118_858730_+	VanZ family protein	NA	NA	NA	NA	NA
WP_057755753.1|858862_859744_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_057755751.1|860064_861405_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
861328:861387	attL	TATAAGAAGAACATGTTTGCCCTTTTAGGTAAACCAGGCTTCGAAGATTTAGCTAAAGAC	NA	NA	NA	NA
WP_057755749.1|861506_862727_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	49.1	4.3e-104
WP_057755742.1|862837_863527_-	zinc-ribbon domain-containing protein	NA	Q9T1Z1	Lactococcus_phage	40.6	1.1e-24
WP_057755741.1|863569_864091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083479520.1|864102_864822_-	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	30.4	1.7e-15
WP_083479519.1|864886_865171_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057755738.1|865170_865353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755737.1|865445_866012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755735.1|865978_866272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755733.1|866532_866913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755731.1|866912_867692_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	52.9	2.4e-60
WP_057755730.1|867642_868482_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	48.2	1.2e-70
WP_057755729.1|868494_869445_+	DnaD domain protein	NA	A0A1B1IMY3	Lactococcus_phage	43.4	1.0e-15
WP_057755727.1|869461_869908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755725.1|869904_870147_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151425841.1|870125_870335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755720.1|870644_870869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755718.1|870894_871263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755716.1|871262_871451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755709.1|871440_871665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083479518.1|871651_872092_+	DUF1642 domain-containing protein	NA	A0A2K9VC51	Lactobacillus_phage	46.8	7.3e-30
WP_057755705.1|872325_872577_+	DUF3310 domain-containing protein	NA	A0A0S2MYA1	Enterococcus_phage	41.2	1.2e-05
WP_057755704.1|872757_873231_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	64.5	3.3e-44
WP_057755702.1|873249_873663_+	hypothetical protein	NA	D2IYV6	Enterococcus_phage	40.7	1.4e-22
WP_057755698.1|874154_874643_+|terminase	terminase small subunit	terminase	A0A1P8BKR3	Lactococcus_phage	63.6	4.1e-42
WP_057755695.1|874629_875946_+|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	81.1	1.4e-214
WP_057755692.1|875959_877510_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	65.1	2.7e-188
WP_057755690.1|877506_878652_+|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	51.3	7.4e-82
WP_057755687.1|878691_878913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755686.1|879010_879583_+	hypothetical protein	NA	Q9T1B8	Listeria_phage	30.8	3.4e-11
WP_057755684.1|879594_880497_+	hypothetical protein	NA	U3PDP8	Lactobacillus_phage	66.2	1.3e-105
WP_057755682.1|880509_880944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755679.1|880940_881291_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	55.0	3.2e-28
WP_057755677.1|881291_881636_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	43.0	7.5e-22
WP_057755675.1|881635_882034_+	hypothetical protein	NA	A0A286QML6	Streptococcus_phage	39.1	4.4e-18
WP_057755672.1|882731_883196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755670.1|883202_883847_+	hypothetical protein	NA	O03936	Lactobacillus_phage	43.0	3.0e-40
WP_057755659.1|883847_888191_+	tape measure protein	NA	A0A2P0VJB7	Streptococcus_phage	35.6	9.0e-72
WP_057755656.1|888174_888903_+	hypothetical protein	NA	A0A1S5SAI1	Streptococcus_phage	40.9	1.9e-43
WP_083479517.1|888902_890891_+	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	41.3	2.9e-73
WP_057755653.1|890895_891699_+	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	42.6	6.7e-13
WP_057755651.1|891769_892255_+	hypothetical protein	NA	G1C4V7	Enterococcus_phage	43.0	4.8e-06
WP_057755643.1|892270_893290_+	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	39.3	4.6e-19
WP_057755641.1|893325_893748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755639.1|893760_894114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083479516.1|894113_894248_+	XkdX family protein	NA	NA	NA	NA	NA
WP_057755637.1|894388_895045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755634.1|895086_895380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755631.1|895376_895637_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	58.8	3.4e-19
WP_057755628.1|895633_895852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057755626.1|895848_897159_+	LysM peptidoglycan-binding domain-containing protein	NA	B5SP49	Lactococcus_phage	52.2	7.6e-115
899328:899405	attR	TATAAGAAGAACATGTTTGCCCTTTTAGGTAAACCAGGCTTCGAAGATTTAGCTAAAGACTTAAACTCTCGCTTATAG	NA	NA	NA	NA
>prophage 4
NZ_CP044499	Lactobacillus dextrinicus strain LH506 chromosome, complete genome	1836976	1124887	1131947	1836976	tRNA	Staphylococcus_phage(50.0%)	7	NA	NA
WP_057754933.1|1124887_1125736_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.4	3.0e-19
WP_083479502.1|1125992_1126535_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.3	1.2e-21
WP_057754927.1|1126494_1127454_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	57.2	3.7e-103
WP_057754924.1|1127470_1128679_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	50.7	1.8e-46
WP_083479530.1|1128881_1129745_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.1	1.2e-52
WP_057754918.1|1129796_1131068_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057754915.1|1131671_1131947_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	67.4	3.4e-25
>prophage 5
NZ_CP044499	Lactobacillus dextrinicus strain LH506 chromosome, complete genome	1836976	1448949	1456967	1836976		Lactobacillus_phage(33.33%)	9	NA	NA
WP_057757352.1|1448949_1449444_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	37.9	3.2e-18
WP_057757354.1|1449742_1450219_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_057757357.1|1450327_1451071_+	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	33.6	5.0e-31
WP_057757359.1|1451134_1451662_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_057757361.1|1451658_1452282_-	XTP/dITP diphosphatase	NA	A0A2P1DNN4	Cassava_brown_streak_virus	28.9	3.4e-12
WP_057757363.1|1452284_1453103_-	glutamate racemase	NA	NA	NA	NA	NA
WP_151425897.1|1453486_1454119_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	71.6	2.2e-91
WP_057757367.1|1454178_1454490_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.4	1.3e-17
WP_057757369.1|1454612_1456967_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	61.1	8.8e-29
