The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	1426373	1478199	5869433	protease,transposase	Oenococcus_phage(12.5%)	41	NA	NA
WP_158043700.1|1426373_1427372_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158044417.1|1428049_1429858_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_158044418.1|1429902_1430367_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_158044419.1|1430792_1431875_+	mandelate racemase	NA	Q6A202	Oenococcus_phage	24.7	5.1e-16
WP_158044420.1|1433637_1433832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044421.1|1434868_1435114_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_158044422.1|1435110_1436226_+	ThiF family adenylyltransferase	NA	E3T5K6	Cafeteria_roenbergensis_virus	34.5	7.3e-10
WP_158044423.1|1436218_1436470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044424.1|1436485_1437127_+	hypothetical protein	NA	E0WM91	African_swine_fever_virus	30.3	5.2e-08
WP_158044425.1|1437087_1437684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044426.1|1437855_1438269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044427.1|1438228_1438477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044428.1|1438533_1439355_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_158044429.1|1439412_1439985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044430.1|1440609_1443177_-	hypothetical protein	NA	A0A1B0Z045	Pseudomonas_phage	32.8	1.1e-106
WP_158044431.1|1443140_1443842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044432.1|1443999_1444443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158048016.1|1444904_1446107_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	50.8	5.3e-99
WP_158048017.1|1446344_1447410_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158048018.1|1447685_1447907_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_158044433.1|1448025_1448631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044434.1|1448627_1449824_-	DUF4102 domain-containing protein	NA	Q5QF66	Pseudomonas_virus	27.0	2.1e-23
WP_158044435.1|1450700_1452734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044436.1|1452802_1455607_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_158044437.1|1455603_1459314_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_158044438.1|1459317_1459884_+	response regulator	NA	NA	NA	NA	NA
WP_158044439.1|1459960_1460257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044440.1|1460951_1461254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044441.1|1461417_1461633_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158044442.1|1461725_1462145_+	VOC family protein	NA	NA	NA	NA	NA
WP_158044443.1|1462280_1463819_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_158044444.1|1463815_1467037_+	error-prone DNA polymerase	NA	Q8W6C3	Saccharomonospora_phage	27.6	6.2e-86
WP_158044445.1|1467045_1468755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044446.1|1468869_1470231_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_158044447.1|1470633_1470819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044448.1|1470933_1471866_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_158044449.1|1471993_1473463_+	DUF2336 domain-containing protein	NA	NA	NA	NA	NA
WP_158044450.1|1473572_1476257_+	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	24.3	8.5e-12
WP_158044451.1|1476356_1476692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044452.1|1476831_1477656_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_158044453.1|1477671_1478199_-|protease	protease complex subunit PrcB family protein	protease	NA	NA	NA	NA
>prophage 2
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	1925542	1983016	5869433	protease,transposase,integrase	Leptospira_phage(33.33%)	51	1928506:1928521	1948125:1948140
WP_158044789.1|1925542_1926706_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_158044790.1|1927092_1928592_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
1928506:1928521	attL	GGGGATCGCGCCGAAG	NA	NA	NA	NA
WP_158044791.1|1928610_1929030_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_158044792.1|1929122_1930172_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158044793.1|1930516_1931536_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_158044794.1|1931874_1932756_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.7	1.3e-30
WP_158044795.1|1932766_1933966_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_158044796.1|1934396_1935116_-	ribonuclease activity regulator RraA	NA	NA	NA	NA	NA
WP_158044797.1|1935337_1936228_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_158044798.1|1936282_1937065_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_158044799.1|1937156_1937927_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_158044800.1|1940322_1940505_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_158044801.1|1940581_1942645_-	recombinase family protein	NA	A0A1P8CWN4	Bacillus_phage	25.0	3.0e-09
WP_158044802.1|1942641_1942860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044803.1|1943470_1943842_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_158044804.1|1944338_1944674_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_158044805.1|1944675_1945146_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_158044806.1|1945391_1945838_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_158044807.1|1945857_1947135_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_158044808.1|1947141_1947609_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_158044809.1|1947701_1948664_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
1948125:1948140	attR	GGGGATCGCGCCGAAG	NA	NA	NA	NA
WP_158044810.1|1948738_1949479_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158044811.1|1950144_1950549_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_158044812.1|1950962_1951436_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_158044813.1|1951723_1952371_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158044814.1|1952367_1954458_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_158044815.1|1955669_1956035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044816.1|1956053_1958858_-	AsmA family protein	NA	NA	NA	NA	NA
WP_158044817.1|1958945_1959983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044818.1|1959775_1960813_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158044819.1|1961364_1961700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044820.1|1962191_1962416_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_158044821.1|1962516_1964754_-	chloride channel protein	NA	NA	NA	NA	NA
WP_158044822.1|1964509_1965508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044823.1|1965533_1966409_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_158044824.1|1967755_1967977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044825.1|1968093_1968615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044826.1|1968652_1969357_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_158044827.1|1969576_1971085_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.9	1.1e-27
WP_158044828.1|1971189_1972248_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_158044829.1|1972493_1972679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044830.1|1972922_1973171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044831.1|1973489_1973810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044832.1|1973831_1974104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044833.1|1974156_1974828_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_158044834.1|1974977_1976168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044835.1|1976229_1976466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044836.1|1976490_1978035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044837.1|1978436_1978976_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_158048061.1|1979084_1980008_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_158044838.1|1981498_1983016_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	1992980	2136688	5869433	tRNA,transposase,integrase	Haemophilus_phage(13.33%)	108	2071231:2071283	2135142:2135253
WP_158043756.1|1992980_1994336_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158043476.1|1995281_1996640_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_158044845.1|1996799_1997033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044846.1|1997503_1998571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044847.1|1998635_1999448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044848.1|1999387_2000920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044849.1|2000931_2001888_+	OmpA family protein	NA	NA	NA	NA	NA
WP_158044850.1|2002174_2003365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044851.1|2003327_2006282_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	25.7	1.6e-27
WP_158047998.1|2006195_2007398_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	50.8	4.1e-99
WP_158044852.1|2008298_2009867_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158044853.1|2010019_2010709_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158044854.1|2010725_2011085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158048063.1|2011081_2012584_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158044855.1|2013695_2013935_+	DUF3018 family protein	NA	NA	NA	NA	NA
WP_158044856.1|2013931_2014279_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_158044857.1|2015762_2015909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044858.1|2015938_2020195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158048064.1|2020372_2020873_-	DUF4231 domain-containing protein	NA	A0A2H4JD89	uncultured_Caudovirales_phage	38.2	6.6e-19
WP_158044859.1|2021444_2022062_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158044860.1|2022347_2022689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044861.1|2022706_2022904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044862.1|2023043_2024351_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_158044863.1|2024359_2025229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158048065.1|2025565_2025841_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158044864.1|2025726_2026809_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158044865.1|2027850_2028916_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158044866.1|2029462_2033647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044867.1|2034099_2037606_+	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.9	7.9e-50
WP_158044868.1|2037672_2038092_+	ASCH domain-containing protein	NA	A0A2I7R6Q1	Vibrio_phage	44.4	1.4e-17
WP_158044869.1|2038095_2038443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044870.1|2044774_2045881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044789.1|2046075_2047239_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_158044871.1|2047240_2047882_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_158044872.1|2048903_2050220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044873.1|2051009_2051591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044874.1|2051792_2053112_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	23.0	1.1e-12
WP_158044875.1|2053619_2053850_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158044876.1|2054106_2054268_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158044877.1|2054669_2055599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044878.1|2056935_2057271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044879.1|2057881_2058736_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158044880.1|2058808_2059882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044881.1|2060736_2061078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044882.1|2061192_2061645_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_158044883.1|2061944_2062301_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_158044884.1|2062783_2063641_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_158048066.1|2063796_2064327_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_158044885.1|2065205_2067131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044886.1|2067130_2068093_-	hypothetical protein	NA	A0A1W6DX18	Sphingobium_phage	34.3	2.9e-07
WP_158044887.1|2067945_2069796_-	AAA family ATPase	NA	NA	NA	NA	NA
2071231:2071283	attL	CTAGGCAAGCAGGATAATAACCATGGATATCAGCGTCGTGGTGATCACGTATC	NA	NA	NA	NA
WP_158044888.1|2071284_2071530_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2071231:2071283	attL	CTAGGCAAGCAGGATAATAACCATGGATATCAGCGTCGTGGTGATCACGTATC	NA	NA	NA	NA
WP_158044889.1|2071925_2072711_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158044890.1|2072707_2074231_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158044891.1|2074554_2075553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044888.1|2076438_2076684_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158044892.1|2076905_2078267_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
2076686:2076738	attR	GATACGTGATCACCACGACGCTGATATCCATGGTTATTATCCTGCTTGCCTAG	NA	NA	NA	NA
WP_158044893.1|2078581_2079655_-|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	33.7	6.6e-32
2076686:2076738	attR	GATACGTGATCACCACGACGCTGATATCCATGGTTATTATCCTGCTTGCCTAG	NA	NA	NA	NA
WP_158044894.1|2079936_2080317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044895.1|2081091_2081622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044896.1|2081736_2082297_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	37.4	2.2e-23
WP_158044897.1|2082841_2083327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044898.1|2083740_2084121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044899.1|2084152_2086354_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	26.6	1.5e-59
WP_158044900.1|2086498_2087065_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	50.8	9.8e-11
WP_158044901.1|2087256_2089653_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_158044902.1|2090574_2090976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044903.1|2091088_2091283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044904.1|2091413_2092256_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_158044865.1|2092280_2093346_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158044905.1|2093740_2094244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044906.1|2094219_2094588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044907.1|2094679_2095093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158048067.1|2095227_2096007_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_158044908.1|2096493_2096988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044909.1|2097041_2097380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044910.1|2098527_2099724_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_158044911.1|2100067_2101216_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_158044912.1|2101418_2101877_-	response regulator	NA	NA	NA	NA	NA
WP_158044913.1|2102151_2102523_-	response regulator	NA	NA	NA	NA	NA
WP_158044914.1|2102516_2104097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044915.1|2104401_2104776_-	response regulator	NA	NA	NA	NA	NA
WP_158044916.1|2104769_2105987_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_158044917.1|2107400_2108876_+	PAS domain-containing protein	NA	A0A2K9L5I4	Tupanvirus	21.9	7.4e-10
WP_158044918.1|2108953_2109460_-	response regulator	NA	NA	NA	NA	NA
WP_158044919.1|2109874_2110285_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_158044920.1|2110359_2110818_+	VanZ family protein	NA	NA	NA	NA	NA
WP_158044921.1|2110902_2112279_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	32.6	2.0e-25
WP_158044922.1|2112377_2112896_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_158044923.1|2112979_2113468_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_158044924.1|2114075_2114810_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_158044789.1|2114811_2115975_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_158044925.1|2115939_2116194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044926.1|2118594_2118957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044927.1|2119667_2122037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158048068.1|2122501_2122987_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_158044928.1|2124273_2124750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044929.1|2126431_2126722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044930.1|2127368_2127809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044931.1|2127829_2128579_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_158044932.1|2129043_2129235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158048069.1|2129711_2130446_-	recombinase family protein	NA	NA	NA	NA	NA
WP_158044933.1|2130439_2131069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044896.1|2131373_2131934_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	37.4	2.2e-23
WP_158044895.1|2132048_2132579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158044894.1|2133353_2133734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158044893.1|2134015_2135089_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	33.7	6.6e-32
WP_158048070.1|2135542_2136688_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	2651901	2660838	5869433		Escherichia_phage(66.67%)	7	NA	NA
WP_158045346.1|2651901_2652990_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	70.4	1.6e-105
WP_158045347.1|2652989_2654246_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	59.1	6.8e-129
WP_158048110.1|2654271_2655057_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	48.8	3.8e-61
WP_158045348.1|2655227_2656184_+	SDR family oxidoreductase	NA	A0A2C9DSV6	Western_grey_kangaroopox_virus	34.8	1.6e-05
WP_158045349.1|2656243_2657647_+	GntP family permease	NA	NA	NA	NA	NA
WP_158045350.1|2657669_2658305_+	aldolase	NA	A0A077SK32	Escherichia_phage	47.3	3.2e-42
WP_158045351.1|2658294_2660838_-	response regulator	NA	A0A1V0SGX0	Hokovirus	38.5	9.4e-53
>prophage 5
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	3461095	3468390	5869433	tRNA	uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_158048170.1|3461095_3462313_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8CWQ1	Bacillus_phage	33.1	2.1e-10
WP_158045998.1|3462438_3463104_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.6	3.4e-31
WP_158045999.1|3463874_3465149_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.8	5.3e-105
WP_158048171.1|3465270_3466032_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	53.1	4.2e-57
WP_158046000.1|3466675_3466987_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	53.3	4.7e-07
WP_158046001.1|3467100_3468390_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.2	1.8e-15
>prophage 6
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	4616695	4625293	5869433	terminase	Escherichia_phage(33.33%)	9	NA	NA
WP_158046922.1|4616695_4617250_-	ribokinase	NA	A0A1D9CA16	Salinivibrio_phage	44.7	3.4e-16
WP_158046923.1|4617246_4617750_-	cell wall hydrolase	NA	A0A1B0VMI2	Pseudomonas_phage	36.7	5.1e-11
WP_158046924.1|4617746_4618070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158046925.1|4618144_4619656_-|terminase	phage terminase large subunit	terminase	A0A2L0HPI9	Escherichia_phage	35.5	1.5e-26
WP_158046926.1|4619662_4620004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158046927.1|4620020_4622051_-	hypothetical protein	NA	A0A0F6N5Q1	Escherichia_phage	50.7	1.7e-09
WP_158046928.1|4622202_4622811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158046929.1|4622810_4624724_-	hypothetical protein	NA	A0A0F7L404	uncultured_marine_virus	31.8	3.6e-81
WP_158046930.1|4624720_4625293_-	hypothetical protein	NA	A0A1B1IVM6	uncultured_Mediterranean_phage	33.1	4.1e-17
>prophage 7
NZ_CP030265	Skermanella sp. W17 chromosome, complete genome	5869433	5310676	5357694	5869433	holin,transposase	Catovirus(25.0%)	38	NA	NA
WP_158047470.1|5310676_5311633_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_158047471.1|5311669_5313205_-|holin	choline-sulfatase	holin	A0A1V0SA98	Catovirus	21.4	2.1e-15
WP_158047472.1|5313394_5314315_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158047473.1|5314329_5314515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158047474.1|5315097_5316585_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_158043337.1|5317092_5318235_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_158048333.1|5318727_5319870_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	A0A1D8KP97	Synechococcus_phage	38.4	7.0e-08
WP_158047475.1|5319897_5321184_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_158047476.1|5321310_5322684_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	35.3	1.1e-50
WP_158047477.1|5322680_5323481_+	2-keto-4-methylthiobutyrate aminotransferase	NA	NA	NA	NA	NA
WP_158047478.1|5323515_5324412_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158047479.1|5324457_5325366_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_158047480.1|5325370_5326705_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	34.4	3.9e-26
WP_158047481.1|5326769_5327543_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_158047482.1|5327535_5328765_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_158047483.1|5328761_5330654_-	DUF3483 domain-containing protein	NA	NA	NA	NA	NA
WP_158047484.1|5330662_5332699_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_158047485.1|5332896_5333919_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_158048334.1|5333954_5335271_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.6	1.1e-100
WP_158047486.1|5335299_5336679_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_158047487.1|5336707_5337298_-	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_158047488.1|5337290_5340314_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_158047489.1|5340310_5340643_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_158047490.1|5340660_5341914_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_158047491.1|5342038_5342947_+	EamA family transporter	NA	NA	NA	NA	NA
WP_158047492.1|5343025_5343331_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_158047493.1|5343327_5343597_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_158047494.1|5343691_5344069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158047495.1|5344055_5344352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158043490.1|5344671_5346195_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	5.0e-25
WP_158047496.1|5346613_5347690_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_158047497.1|5347686_5348694_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_158047498.1|5348830_5350546_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.9	1.8e-52
WP_158047499.1|5350595_5352065_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_158043385.1|5352226_5353810_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158043490.1|5354071_5355595_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	5.0e-25
WP_158047500.1|5355993_5356581_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_158047501.1|5356701_5357694_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
