The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044534	Lactobacillus frumenti strain LF145 chromosome, complete genome	1752928	117492	125176	1752928		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_057750163.1|117492_118956_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	2.5e-58
WP_057750166.1|118952_119990_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	40.1	2.5e-60
WP_057750169.1|119999_120584_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.9	8.2e-29
WP_057750174.1|120587_122126_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.1	9.9e-74
WP_057750182.1|122313_123573_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_057750185.1|123732_124419_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	33.3	6.7e-06
WP_057750187.1|124519_125176_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.8	2.6e-39
>prophage 2
NZ_CP044534	Lactobacillus frumenti strain LF145 chromosome, complete genome	1752928	388028	396568	1752928		Streptococcus_phage(33.33%)	10	NA	NA
WP_057748439.1|388028_390200_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	9.9e-253
WP_057748442.1|390312_390534_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	44.0	1.9e-10
WP_057748445.1|390781_391297_+	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-06
WP_057748448.1|391540_393349_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.4	3.4e-57
WP_057748451.1|393370_393679_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_057748455.1|393681_394281_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_057748457.1|394283_394538_+	YaaL family protein	NA	NA	NA	NA	NA
WP_057748462.1|394558_395203_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	54.1	1.4e-53
WP_057748465.1|395223_395547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057748469.1|395560_396568_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.6	4.0e-31
>prophage 3
NZ_CP044534	Lactobacillus frumenti strain LF145 chromosome, complete genome	1752928	921599	929369	1752928	integrase,transposase	Sphingomonas_phage(28.57%)	9	924649:924687	936989:937027
WP_057750873.1|921599_922403_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC8	Lactobacillus_phage	56.6	2.3e-53
WP_083482694.1|922453_923473_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_057750880.1|923488_924226_-	glucose 1-dehydrogenase	NA	W8CYX9	Bacillus_phage	37.2	2.8e-05
924649:924687	attL	AAACCGCCGTTTTCCTACATTTTAATTCCGCCCTCTACA	NA	NA	NA	NA
WP_057750884.1|924756_925605_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.2	4.5e-36
WP_057750888.1|925668_926712_-	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	34.8	1.5e-49
WP_057750891.1|926726_927308_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	43.1	1.9e-17
WP_057750894.1|927322_928192_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.8	2.0e-103
WP_083482695.1|928739_928844_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083482696.1|928859_929369_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.9	7.7e-23
936989:937027	attR	TGTAGAGGGCGGAATTAAAATGTAGGAAAACGGCGGTTT	NA	NA	NA	NA
>prophage 4
NZ_CP044534	Lactobacillus frumenti strain LF145 chromosome, complete genome	1752928	1064655	1102002	1752928	integrase,terminase,head,protease,portal,tail	Lactobacillus_phage(47.62%)	49	1067342:1067356	1103154:1103168
WP_057751250.1|1064655_1066980_-	hypothetical protein	NA	A6M964	Geobacillus_virus	43.0	2.1e-06
WP_057751253.1|1066995_1067343_-	hypothetical protein	NA	NA	NA	NA	NA
1067342:1067356	attL	AATCATCATCCCTCC	NA	NA	NA	NA
WP_057751256.1|1067346_1067640_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	50.0	3.1e-08
WP_057751259.1|1067650_1069798_-	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	55.9	4.8e-34
WP_057751262.1|1069794_1070763_-|tail	phage tail family protein	tail	A0A2H4J7E0	uncultured_Caudovirales_phage	25.2	8.3e-10
WP_057751266.1|1070768_1075034_-	tape measure protein	NA	A0A0M9JJ59	Lactobacillus_phage	28.8	1.9e-21
WP_151495793.1|1075051_1075354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751272.1|1075395_1075893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751275.1|1075970_1076702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751278.1|1076740_1077139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751281.1|1077135_1077669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751284.1|1077655_1077997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751287.1|1077984_1078326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751290.1|1078347_1079256_-	hypothetical protein	NA	A0A059NT82	Lactococcus_phage	50.4	1.7e-60
WP_057751293.1|1079272_1079884_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_057751296.1|1080068_1081007_-|head	phage head morphogenesis protein	head	A0A2P1JTW9	Anoxybacillus_phage	31.9	1.1e-06
WP_057751299.1|1080996_1082733_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	38.2	2.3e-79
WP_057751302.1|1082733_1082961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751305.1|1082975_1084244_-|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	57.9	1.9e-134
WP_057751309.1|1084218_1084704_-	hypothetical protein	NA	X2CXN2	Lactobacillus_phage	62.1	3.9e-48
WP_057751312.1|1087115_1087562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751314.1|1087647_1088061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751317.1|1088389_1088824_-	RusA family crossover junction endodeoxyribonuclease	NA	D7RWH1	Brochothrix_phage	43.7	1.2e-24
WP_057751323.1|1089193_1089382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151495794.1|1089381_1089717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057752051.1|1089713_1090100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751328.1|1090173_1090962_-	ATP-binding protein	NA	B4XYS7	Lactobacillus_phage	37.1	1.4e-36
WP_057751332.1|1090961_1091780_-	hypothetical protein	NA	A0A2D1GQ66	Lysinibacillus_phage	32.1	1.1e-18
WP_057751335.1|1091772_1092435_-	hypothetical protein	NA	A0A2D1GP81	Lactobacillus_phage	48.1	1.5e-55
WP_057751354.1|1092440_1093205_-	DUF1071 domain-containing protein	NA	X2CXM9	Lactobacillus_phage	48.8	9.1e-28
WP_057751364.1|1093207_1093759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751378.1|1093891_1094131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751387.1|1094120_1094354_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057751400.1|1094388_1094589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057752054.1|1094594_1094786_-	helix-turn-helix transcriptional regulator	NA	D2IZX1	Enterococcus_phage	33.9	6.0e-05
WP_057751413.1|1095376_1095643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751416.1|1095700_1095928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057751419.1|1095908_1096202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057751428.1|1096266_1096461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057751437.1|1096626_1097391_-	antirepressor	NA	Q6J1W3	Lactobacillus_phage	54.4	5.6e-70
WP_083482701.1|1097584_1097857_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057751460.1|1097979_1098312_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	53.7	2.0e-19
WP_151495819.1|1098329_1098623_+	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	63.6	6.2e-17
WP_057751479.1|1098673_1098994_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_057751488.1|1099005_1099320_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_057751502.1|1099451_1099661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057751518.1|1100164_1101280_+|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	34.2	6.1e-49
WP_057751533.1|1101370_1101652_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_057751544.1|1101675_1102002_-|protease	ribosomal-processing cysteine protease Prp	protease	D7RWI7	Brochothrix_phage	32.4	2.2e-07
1103154:1103168	attR	AATCATCATCCCTCC	NA	NA	NA	NA
>prophage 5
NZ_CP044534	Lactobacillus frumenti strain LF145 chromosome, complete genome	1752928	1323278	1364868	1752928	holin,tRNA,capsid,terminase,protease,head,portal,tail	Erysipelothrix_phage(51.85%)	42	NA	NA
WP_057752144.1|1323278_1323758_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_057752141.1|1323955_1324663_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_057752138.1|1324781_1326224_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.5	9.3e-98
WP_057752134.1|1326225_1326774_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	43.6	2.4e-30
WP_057752131.1|1326795_1327626_+	alpha/beta hydrolase	NA	A0A220T682	Eptesipox_virus	27.1	6.9e-21
WP_057752356.1|1327710_1328775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057752128.1|1328905_1329700_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.7e-08
WP_057752125.1|1330653_1331583_-	phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	1.7e-23
WP_057748676.1|1331965_1333231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083482667.1|1334028_1334781_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_057748682.1|1334866_1335754_-	DNA adenine methylase	NA	R9TL68	Synechococcus_phage	25.3	2.5e-13
WP_057748685.1|1335935_1336934_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_057748687.1|1336944_1337157_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	57.8	1.5e-12
WP_057748690.1|1337156_1339778_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_057748693.1|1339783_1341091_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_057748695.1|1341440_1341899_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_057748698.1|1341980_1342184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057748701.1|1342167_1342485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057748704.1|1342481_1343621_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	53.0	2.2e-110
WP_057748707.1|1343598_1344174_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.4	1.8e-73
WP_057748710.1|1344229_1346164_+	XRE family transcriptional regulator	NA	A0A2K5B2B0	Erysipelothrix_phage	58.0	2.7e-225
WP_003671652.1|1346230_1346635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057748713.1|1346637_1348893_+	DNA primase	NA	A0A1X9I6B6	Streptococcus_phage	48.2	7.4e-211
WP_057748716.1|1349105_1349387_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	54.4	6.1e-22
WP_057748719.1|1349367_1350723_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	65.7	1.9e-153
WP_057748722.1|1350719_1351187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083482668.1|1351333_1351711_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.4	1.3e-32
WP_057748726.1|1351830_1352373_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	58.2	7.3e-56
WP_057748728.1|1352372_1353599_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	63.1	8.6e-153
WP_057748730.1|1353671_1354292_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	45.0	4.0e-42
WP_003652780.1|1354294_1354501_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_057748733.1|1354543_1356163_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.7	1.0e-246
WP_083482669.1|1356257_1357457_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	63.6	1.4e-152
WP_003652788.1|1357453_1358125_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	3.9e-59
WP_057748740.1|1358144_1359323_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	57.7	1.1e-125
WP_003671991.1|1359339_1359618_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	41.6	2.9e-08
WP_057748742.1|1359617_1360001_+|head	phage head closure protein	head	A0A088F713	Idiomarinaceae_phage	32.7	5.2e-08
WP_057748745.1|1359987_1360401_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	63.9	2.5e-40
WP_057748748.1|1360397_1361276_+	1,4-beta-N-acetylmuramidase	NA	A0A2P1CIJ7	Microbacterium_phage	30.5	1.1e-13
WP_057748751.1|1361367_1361607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057748754.1|1361636_1363298_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.2	6.0e-101
WP_057748757.1|1363290_1364868_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	48.6	4.1e-131
