The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	1235764	1259247	5547257	holin,tail,integrase,transposase	Stx2-converting_phage(35.29%)	30	1227413:1227427	1260118:1260132
1227413:1227427	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1235764_1236970_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1236971_1238285_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1238281_1239913_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1239913_1240312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1240409_1240823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150582.1|1241218_1242427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1242502_1242805_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1242840_1243596_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1243955_1244522_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1244496_1245108_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1245104_1245770_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1245766_1246390_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1246642_1247386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1247471_1247639_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143068.1|1248046_1249900_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1250049_1250265_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1250269_1250614_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1250970_1251351_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1251347_1251695_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1251744_1252389_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1252195_1253086_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1253082_1253409_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1253626_1253896_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1254056_1254479_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1254608_1255667_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1255745_1256396_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1256578_1257169_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1257155_1257275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1257670_1257919_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1258764_1259247_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1260118:1260132	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	1536865	1637662	5547257	lysis,bacteriocin,capsid,tRNA,integrase,terminase,portal,tail,holin,transposase	Escherichia_phage(77.78%)	118	1541221:1541245	1605908:1605932
WP_001005794.1|1536865_1537396_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1537395_1537863_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1537849_1538530_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1538539_1539676_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1539850_1541008_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1541221:1541245	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1541439_1542609_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1542592_1542775_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|1542853_1543231_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|1543266_1543479_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1543438_1544065_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|1544061_1544493_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|1544548_1545226_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260980.1|1545550_1545808_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|1545936_1546134_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|1546222_1546528_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|1546570_1547140_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_000206752.1|1547402_1548026_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|1548029_1548317_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1548318_1548537_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|1548538_1548754_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|1548713_1549220_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|1549221_1550169_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000476217.1|1550165_1550405_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_000157000.1|1550397_1550601_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|1550597_1551476_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|1551583_1552027_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|1552103_1552925_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1552988_1553336_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|1553411_1553999_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187066.1|1553998_1554688_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459724.1|1554684_1555635_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|1555653_1555935_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_024175068.1|1555955_1556177_-	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	6.4e-35
WP_000917253.1|1556248_1556461_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|1556531_1557179_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|1558039_1558993_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1558989_1560459_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1560553_1561267_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1561362_1561566_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1561736_1561931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1562097_1562475_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1562468_1563989_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1563978_1564950_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|1564949_1565399_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|1565406_1565970_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|1565966_1566161_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|1566153_1566588_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_024165517.1|1566576_1566822_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001356551.1|1566836_1566989_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1567371_1568331_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1568342_1568612_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874428.1|1569097_1571035_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1571169_1571349_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1571389_1571635_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|1571712_1571928_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087729.1|1571932_1572466_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001056885.1|1572740_1573310_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1573309_1573459_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1573466_1573931_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1573962_1574256_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1574405_1574609_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|1574664_1575471_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1575451_1577158_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1577157_1579302_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1579459_1580467_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1580490_1581705_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1581760_1582150_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1582199_1582661_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1582644_1583208_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207926.1|1583207_1583858_+	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000117994.1|1583854_1585792_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1585793_1586063_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1586202_1586391_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146324.1|1586685_1588311_+	hypothetical protein	NA	A0A0N7C0A7	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1588307_1589576_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1589590_1589869_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1589874_1590492_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000998048.1|1590780_1592319_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1592368_1592716_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1592712_1593093_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_024175551.1|1593697_1593943_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	1.6e-39
WP_000078907.1|1593999_1594140_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1594196_1594598_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1594691_1595348_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1595350_1595797_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1595806_1596058_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1596068_1597334_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331692.1|1597403_1605785_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|1606006_1606939_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1605908:1605932	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|1607232_1607988_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001301650.1|1608192_1608309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952959.1|1608382_1609414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301981.1|1609778_1611119_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1611490_1611775_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_000531969.1|1611954_1613265_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426146.1|1613264_1615409_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195817.1|1615611_1616097_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033336.1|1616742_1617306_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112844.1|1617387_1620027_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000182852.1|1620049_1620808_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000675435.1|1620818_1621319_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001415277.1|1621357_1621786_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000794741.1|1621782_1622304_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301548.1|1622305_1623148_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730817.1|1623318_1623870_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001302029.1|1624035_1624968_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1625002_1626088_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043834.1|1626091_1626916_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1626915_1627725_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089225.1|1627724_1628273_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1628306_1628585_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683769.1|1628705_1630712_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1630870_1632091_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127753.1|1632365_1633544_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615801.1|1633540_1634536_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699109.1|1634634_1635771_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_001289184.1|1635836_1636850_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1636849_1637662_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	1852650	1937147	5547257	protease,tRNA,integrase,terminase,portal,tail,holin	Enterobacteria_phage(53.33%)	100	1855125:1855145	1912565:1912585
WP_000569336.1|1852650_1853577_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1853581_1854313_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1854293_1854401_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1854460_1855162_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1855125:1855145	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1855182_1856469_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1856502_1856757_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1856775_1856910_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1856913_1857156_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1857243_1857606_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1857602_1857959_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1858035_1858323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1858292_1858469_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1858470_1859418_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1859414_1859636_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1859734_1860016_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1860026_1860218_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1860190_1860373_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1860372_1861050_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1861046_1861832_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1861837_1862134_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1862209_1862416_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1862896_1863274_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1863251_1864313_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1864393_1865083_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1865187_1865418_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1865487_1866027_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415640.1|1866113_1867043_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_000788810.1|1867039_1867741_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1867737_1868040_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1868107_1868440_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1868531_1868639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1868696_1870223_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1870687_1871239_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1871248_1872046_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1872162_1872264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1872260_1872716_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1872715_1872886_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1872878_1873169_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1873165_1873528_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1873524_1873665_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1873750_1874185_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_024165948.1|1874173_1874422_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
WP_001356551.1|1874436_1874589_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1875392_1877339_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1877473_1877653_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1877693_1877939_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000284506.1|1878016_1878232_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1878236_1878770_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1879040_1879610_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1879609_1879756_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1879983_1880169_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1880686_1881163_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1881159_1882167_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|1882328_1883567_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|1883559_1883784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|1883843_1884425_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|1884405_1885125_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|1885117_1885342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1885334_1885928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1886124_1886367_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|1886363_1888178_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|1888465_1888711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1888707_1889130_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|1889596_1889791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|1889787_1891677_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|1891934_1892216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|1893708_1893921_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1893920_1895423_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1895367_1897392_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1897479_1897806_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1897798_1898080_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1898082_1898706_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1898718_1899117_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1899124_1899877_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1899890_1900313_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1900339_1900648_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1900691_1903337_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1903333_1903663_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1903662_1904361_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1904371_1905115_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1905060_1905690_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542842.1|1905930_1909407_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228289.1|1909474_1910074_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_151542844.1|1910138_1911452_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.3	4.8e-77
WP_001023381.1|1911453_1911723_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1912090_1912339_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1912853_1914539_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1912565:1912585	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1914535_1915255_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1915301_1915772_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1915813_1916275_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1916399_1918403_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1918399_1919536_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1919528_1920260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1920278_1921808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1921818_1922907_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1924147_1924465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1924526_1928156_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1928165_1929707_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1929870_1931151_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1935113_1937147_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	1962772	2000839	5547257	lysis,head,capsid,integrase,terminase,portal,tail,holin,plate	Escherichia_phage(63.64%)	50	1964553:1964580	1996513:1996540
WP_000807362.1|1962772_1963672_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1964077_1964395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|1964382_1964562_+	hypothetical protein	NA	NA	NA	NA	NA
1964553:1964580	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1964659_1965673_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1965788_1966088_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1966209_1966485_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1966662_1967163_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1967226_1967451_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1967450_1967750_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1967752_1967977_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1967973_1968249_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1968238_1970521_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1970610_1971834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1971880_1972333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1972332_1974300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542846.1|1974617_1975652_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_000156848.1|1975651_1977424_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1977597_1978452_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1978510_1979584_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1979587_1980331_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1980430_1980940_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1980939_1981143_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1981146_1981428_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1981427_1981925_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1981939_1982365_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1982352_1982778_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1982749_1982923_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1982885_1983353_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1983345_1983798_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1983864_1984500_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1984496_1984844_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1984848_1985757_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1985749_1986361_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1986357_1987677_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1987676_1988279_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1988250_1988694_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1988714_1989125_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1989155_1989749_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1989808_1990999_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1991011_1991530_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1991586_1991862_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1991894_1992014_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1992006_1994454_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1994468_1994948_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1994947_1996111_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1996192_1996411_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1996684_1998046_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
1996513:1996540	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1998193_1998526_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1998716_1999439_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1999435_2000839_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	2099925	2201009	5547257	head,integrase,terminase,portal,tail,holin,transposase	Escherichia_phage(35.19%)	107	2121013:2121072	2145609:2146918
WP_000998048.1|2099925_2101464_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2101513_2101861_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2101857_2102238_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2102599_2103145_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2103141_2103885_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2103896_2104976_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2105037_2105973_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2106429_2107347_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2107448_2108399_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2108516_2110160_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2110785_2111502_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2111844_2113299_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2113400_2114717_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2115030_2116083_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
2121013:2121072	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2121066_2122279_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151542851.1|2122319_2125640_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2126129_2126927_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2127162_2128185_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2128184_2128388_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2128446_2130918_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2131013_2131202_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2131198_2131387_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2131867_2132020_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2132294_2132939_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2133036_2133264_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2133260_2133686_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_151542853.1|2133754_2134792_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2134823_2135246_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2135280_2135979_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2136000_2136225_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2136221_2136578_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2136610_2136763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2136759_2137071_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2137197_2137761_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2137870_2137975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2138161_2138374_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2138415_2138601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2138541_2138820_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2138821_2139871_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2139883_2140243_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2140239_2140929_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2140959_2141082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|2141562_2141991_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2142468_2144319_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2144400_2145614_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2145933_2146140_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2146144_2146489_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2146539_2147073_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
2145609:2146918	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACTGGCTAAGAAGGATAGTTGGGTTTCACATGATACTTATATCTGGCAGTACATTTTCTGACAGACAGTGATGGGTGTTGTCAAGATATTGTGTCATTTATAACCTGAATCAGGGGGGGGAGCCGGAATGTTATCTGGCATTTTTAGCAGAGCCTGAATGCCATAATCACGGCTCCCGGCGTTGGCCGTCAGTGGGCGACACTGGCGGCTTTTTGTTTTCCTTTACTTTCATTTTCTGTCGGCGGTGACGGAGACATACATCAGATGGAAAAAATCACAACAGGTGTGTCATACACCACGTCAGCGGTGGGGACGGGATACTGGTTACTGCAGCTGCTGGACAAAGTCTCTCCGTCCCAGTGGGTGGCAATCGGTGTGCTGGGGAGTCTGCTGTTTGGCCTGCTGACGTATCTGACTAACCTGTATTTCAAAATCAGAGAGGACCGTCGTAAGGCGGCGCGGGGGGAGTAAAGCGATGAAGAAAAAATACGAACTGGGTGTTAAAGGGATAAATAATTACCCGGATAAGATTACTGTTACTGTGGCACCGGAAATTGGTGGGTATCCGTCACTGTTGTTGCCAGATGTGGCGATTAGTCTTGACCGTACTGAAGGTGCCACGCTGGAGTTTTACGAAGCTGAGGCGAAAAAGCAGGCGAAGCAGTTTTTCATGGATGTTGCTGCCGGGTTATGTGAAGGGGATGGTCCGTTGCCGGAAAAGCGCCCCGTAATTTTAGAGGCGCAGGATGTGTTGATAACCTACAGAGGAAAACTACCGGGAATAATTACGGGTTCTCTGAAGACTCCACCGCTGGCCTGAAGACTTAACATATCCAGGGATTTGAAATCGATAAACCCTGATAAATATCCATGAACGCAAAAATCAGATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGGTGCAGGGGCGTCTGCGCCTGAAATCCTCGACCAGTTTCTTGACGAAAAAGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGCGGTGCCATCCTGGTGGATGGTAAACCTGTCGTTCCGGGCATGAAGTTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGAGTGGGTGGAGCGCAATATTAAAGTACCGCTGACCGAACCCCAGAAAGCGGGGATCGCGTCATTCTGTCCGTACAACATTGGTCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGAA	NA	NA	NA	NA
WP_001303555.1|2147228_2147411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2147423_2147555_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2147782_2147968_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2148494_2148809_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2148890_2149115_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2149509_2150019_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2151903_2152110_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2152106_2153699_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2153688_2155194_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2155230_2155578_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2155635_2155902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2155883_2156624_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2156637_2157069_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2157095_2157509_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082465.1|2157489_2160069_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000847298.1|2160065_2160395_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072612784.1|2160394_2161093_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000194798.1|2161103_2161847_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2161792_2162422_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542855.1|2162662_2166142_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230508.1|2166209_2166809_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151542857.1|2166873_2168187_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	2.8e-77
WP_001023407.1|2168188_2168458_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_010917831.1|2168583_2169597_-	Tir-cytoskeleton coupling protein TccP	NA	NA	NA	NA	NA
WP_000022458.1|2169921_2170575_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_010904783.1|2170782_2171142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079078.1|2171711_2172242_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
WP_115801852.1|2172584_2173256_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240083.1|2173491_2174127_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740078.1|2174127_2175132_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2175239_2175653_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2175785_2176457_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826732.1|2176456_2177815_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
WP_000218228.1|2177922_2178774_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000365585.1|2181522_2182218_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157239.1|2182284_2183703_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786000.1|2183683_2184154_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|2184142_2185063_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922685.1|2185235_2186153_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2186231_2186414_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001302088.1|2186584_2188279_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491488.1|2188275_2189091_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2189388_2189616_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_001347685.1|2189603_2189792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071524607.1|2189724_2189967_+	protein DsrB	NA	NA	NA	NA	NA
WP_000104001.1|2190010_2190634_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000942326.1|2190923_2191709_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2191716_2191986_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2191995_2192733_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001302429.1|2192732_2193098_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2193100_2193514_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2193510_2194515_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2194519_2194984_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620075.1|2195088_2196216_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2196212_2196656_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2196674_2198048_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282715.1|2198109_2198796_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_075335630.1|2198788_2199742_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_085948178.1|2199795_2201009_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	2227351	2247336	5547257	tail,integrase,transposase	Enterobacteria_phage(78.26%)	27	2240472:2240485	2250478:2250491
WP_032161583.1|2227351_2228488_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2228438_2228762_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2228919_2230104_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000665314.1|2230669_2231035_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2231070_2231199_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2234001_2234490_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2234646_2235219_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2235262_2235679_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2236884_2237199_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2237203_2238163_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2238239_2241062_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2240472:2240485	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2241068_2241434_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2241506_2241737_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2242059_2242359_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2242355_2242622_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2242618_2242822_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2242845_2243262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2243354_2243468_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2243464_2243707_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2243718_2243997_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2244007_2244358_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2244379_2244583_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2244654_2244792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2244881_2245286_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2245301_2245952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2245981_2246329_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2246334_2247336_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2250478:2250491	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	2313294	2403695	5547257	protease,tRNA,integrase,terminase,portal,tail,holin	Escherichia_phage(36.92%)	110	2325993:2326010	2372277:2372294
WP_000916763.1|2313294_2313525_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2313663_2314038_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2314041_2314914_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2314926_2315268_+	YebY family protein	NA	NA	NA	NA	NA
WP_045893699.1|2315660_2316737_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.1	1.7e-96
WP_001311878.1|2316702_2316984_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|2317090_2317279_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2317271_2317466_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166313.1|2317522_2318332_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000102194.1|2318324_2320994_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_001427414.1|2321074_2321245_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560228.1|2321244_2321466_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_062882198.1|2321512_2322364_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	67.5	3.2e-66
WP_001169149.1|2322778_2322931_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000233812.1|2322941_2323076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253182.1|2323311_2323776_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_062881721.1|2323880_2324156_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	64.6	9.2e-23
WP_000702023.1|2324139_2324562_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|2324574_2325432_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_062881720.1|2325438_2326185_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.5	3.1e-113
2325993:2326010	attL	GCATCAGATTGTTGATCG	NA	NA	NA	NA
WP_151542863.1|2326206_2326968_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	92.5	1.3e-122
WP_151542866.1|2326984_2327407_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000072553.1|2327512_2327725_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_100004899.1|2327810_2327975_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.0e-16
WP_151542868.1|2327976_2328240_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.8e-29
WP_000207986.1|2328250_2329120_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278450.1|2329235_2329340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542871.1|2329529_2329742_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_000119356.1|2329953_2330133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|2330151_2330637_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_062882632.1|2331098_2331698_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.0e-106
WP_000228018.1|2331697_2331988_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|2331984_2332539_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_071525387.1|2332535_2332760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370386.1|2333286_2333472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151542873.1|2334080_2336027_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.0	0.0e+00
WP_000143464.1|2336163_2336343_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_024246943.1|2336383_2336629_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	2.0e-16
WP_001072899.1|2336706_2336922_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001015166.1|2336925_2337567_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000282141.1|2337576_2337891_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_109063312.1|2338019_2338553_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.2e-100
WP_001208683.1|2339071_2339257_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	8.1e-23
WP_000373407.1|2339732_2340209_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077621.1|2340205_2341213_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_151542875.1|2341374_2342613_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.0	5.4e-62
WP_001095275.1|2342625_2342829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542877.1|2342887_2343469_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	5.8e-51
WP_151542961.1|2343449_2344160_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000551742.1|2344163_2344529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542879.1|2344521_2344755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728900.1|2344951_2345242_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_151542881.1|2345238_2346993_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_151542883.1|2347340_2347592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126694.1|2347588_2347999_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|2348459_2348654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|2348650_2350540_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|2350797_2351079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|2352571_2352784_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|2352783_2354286_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_151542885.1|2354230_2356240_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.1	0.0e+00
WP_001097065.1|2356327_2356654_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2356646_2356928_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2356930_2357554_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2357566_2357965_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2357972_2358725_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2358738_2359161_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|2359187_2359496_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|2359539_2362185_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|2362181_2362511_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|2362510_2363209_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|2363219_2363963_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2363908_2364538_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542887.1|2364778_2368255_+	DUF1983 domain-containing protein	NA	Q687E8	Enterobacteria_phage	96.0	0.0e+00
WP_001230508.1|2368322_2368922_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151542857.1|2368986_2370300_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	2.8e-77
WP_151542888.1|2370301_2370571_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_000812736.1|2371300_2371957_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_151542963.1|2371964_2372150_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001295499.1|2372254_2372491_-	DUF1480 family protein	NA	NA	NA	NA	NA
2372277:2372294	attR	GCATCAGATTGTTGATCG	NA	NA	NA	NA
WP_001302304.1|2372608_2374048_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2374128_2376762_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2376730_2378014_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2378143_2378641_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431368.1|2378737_2379436_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2379455_2381504_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2381695_2382577_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127211.1|2382622_2383996_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|2384172_2384964_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211007.1|2385107_2385347_-	membrane protein	NA	NA	NA	NA	NA
WP_000714550.1|2385506_2385650_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006862.1|2385724_2386012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2386680_2386824_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2386836_2387046_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010147.1|2387211_2388021_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2388017_2388584_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156258.1|2389013_2389472_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2389526_2390378_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2390390_2391191_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2391253_2392225_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394973.1|2392687_2394238_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001302042.1|2394241_2395840_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624305.1|2395970_2397335_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2397518_2398097_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854987.1|2398100_2399462_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|2399535_2399715_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2399834_2400194_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2400555_2400900_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2401031_2402942_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220997.1|2402999_2403695_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	2623449	2715672	5547257	protease,lysis,head,capsid,terminase,portal,tail,holin,transposase	Enterobacteria_phage(35.48%)	106	NA	NA
WP_001260835.1|2623449_2624271_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2624370_2624454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2624546_2624882_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2625278_2626532_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2626638_2627532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2627666_2628887_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2629011_2629707_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2629659_2630952_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2631109_2631724_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2631766_2632621_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2632622_2633240_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2633250_2635674_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2635734_2638161_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2638359_2638665_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2638772_2639483_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2639485_2640046_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2640080_2640422_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2640556_2640883_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2641055_2641181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2641871_2642108_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2642195_2644667_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2644759_2644951_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2644947_2645136_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2645536_2645701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2645704_2645923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2645994_2646294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2646645_2646924_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2646925_2647117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2647137_2647509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2647606_2647909_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2647905_2648331_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2648353_2649316_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2649322_2650063_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2650873_2651269_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2651325_2651910_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2652025_2652130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2652318_2652531_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2652698_2652977_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2652978_2654028_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2654040_2654400_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2654396_2655086_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2655116_2655239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2655722_2656151_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_085948178.1|2658364_2659578_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151542899.1|2660240_2660447_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	97.1	1.2e-30
WP_000731241.1|2660451_2660796_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2660846_2661380_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2661650_2662220_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2662219_2662366_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|2662373_2662841_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|2663304_2663619_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2663700_2663925_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2663940_2664198_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2664311_2664857_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2664831_2666757_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2666753_2666960_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2666956_2668558_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2668538_2669858_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2669867_2670200_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2670255_2671281_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2671322_2671721_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2671732_2672086_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2672100_2672634_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2672630_2673026_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2673033_2673786_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2673799_2674222_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2674248_2674662_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_072643101.1|2674642_2677255_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000847298.1|2677251_2677581_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2677580_2678279_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2678289_2679033_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_122989782.1|2678978_2679608_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|2679848_2682704_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|2682771_2683371_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|2683522_2684827_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|2684828_2685098_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2686124_2687450_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|2687717_2687906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|2689047_2689170_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2689276_2690188_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2690253_2690823_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2691788_2693327_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2693376_2693724_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2693720_2694101_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2694440_2694719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2695146_2695293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2695429_2696077_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2696260_2696851_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2698579_2699008_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2699601_2699820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|2700321_2700828_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2700873_2701374_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2701459_2701639_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2702019_2702826_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2702825_2704019_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|2704030_2705389_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|2705392_2706988_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2706987_2708550_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2708641_2708686_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2708823_2709705_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2709701_2710322_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2710349_2711933_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2712145_2713018_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2713057_2713648_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2713644_2714403_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2714622_2715672_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	2986907	3037613	5547257	head,capsid,integrase,terminase,tail,holin	Stx2-converting_phage(38.78%)	64	3012385:3012398	3038951:3038964
WP_000214712.1|2986907_2987111_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2987146_2988607_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2988695_2989979_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2990038_2990353_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|2990349_2990484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143804.1|2990514_2991156_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2991237_2991867_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2991939_2992515_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2992628_2992898_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268849.1|2992899_2994213_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230508.1|2994277_2994877_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000143597.1|2994944_2997458_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_050439450.1|2999364_2999997_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2999942_3000686_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|3000696_3001395_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|3001394_3001736_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_151542907.1|3001728_3004971_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_001453698.1|3005022_3005232_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3005327_3005702_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3005707_3006424_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3006482_3006827_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3006823_3007270_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3007266_3007617_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000125988.1|3007626_3007953_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3009993_3010215_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_151542909.1|3010259_3012197_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001303179.1|3012260_3013922_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
3012385:3012398	attL	AGAATGGCGTTACC	NA	NA	NA	NA
WP_000958392.1|3013918_3014482_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_032164199.1|3014673_3014808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000279786.1|3014770_3015136_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3015177_3015405_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3015829_3016015_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3016242_3016389_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3016388_3016958_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3017228_3017762_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3017812_3018157_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3018161_3018377_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3018526_3020380_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|3020499_3020685_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000917750.1|3022384_3022582_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3022823_3023354_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3023362_3023722_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3023734_3024781_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3024782_3025061_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3025130_3025388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3025608_3025821_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3026099_3026858_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3027556_3027721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3027717_3028299_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|3028485_3028908_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|3028939_3029980_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3029951_3030503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3030486_3030714_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3030790_3031198_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3031461_3031761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3031833_3032052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3032074_3032482_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3032459_3032693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3032686_3032854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3033251_3033440_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|3033436_3033628_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3033720_3036192_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3036256_3036505_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3036482_3037613_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3038951:3038964	attR	GGTAACGCCATTCT	NA	NA	NA	NA
>prophage 10
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	3090496	3193036	5547257	protease,lysis,head,capsid,tRNA,integrase,portal,terminase,tail,holin,transposase	Enterobacteria_phage(50.0%)	113	3121220:3121235	3186939:3186954
WP_000152933.1|3090496_3091081_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3091197_3092289_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3093132_3096018_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3096117_3098037_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3098264_3099335_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3099345_3099978_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3099988_3101407_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|3101719_3101848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|3101953_3103411_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|3103438_3103639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3103746_3104769_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3104768_3105749_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3105745_3106504_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000904019.1|3106513_3107158_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|3107102_3107384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|3107322_3108177_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3108202_3110173_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3110222_3110477_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|3110677_3111274_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|3111325_3112538_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|3112726_3113338_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3113437_3114352_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3114447_3116184_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|3116286_3116376_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_085949318.1|3116341_3117555_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000197859.1|3117892_3118963_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_053889839.1|3118972_3120271_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3120633_3122166_+	SpoVR family protein	NA	NA	NA	NA	NA
3121220:3121235	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3122217_3122937_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3123158_3124700_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3124845_3125376_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3125421_3126690_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3126689_3127109_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3127481_3128393_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3128599_3129061_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3129137_3129797_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3129868_3130162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3130402_3130804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3130906_3131275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3131794_3132490_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3132513_3133326_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3133329_3133596_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3134835_3135420_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3135918_3136872_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3137058_3138543_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3138845_3140384_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3140433_3140781_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3140777_3141158_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3141233_3141482_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3141538_3142207_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3142704_3142887_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3142965_3143466_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3143502_3144009_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3144027_3144918_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3145037_3145619_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3145618_3148534_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3148598_3149198_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3149264_3152663_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3152723_3153356_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3153292_3154036_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3154041_3154740_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3154739_3155069_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3155065_3157615_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3157607_3158042_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3158023_3158446_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3158461_3159202_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3159209_3159605_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3159601_3160180_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3160191_3160545_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3160556_3160955_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3160996_3162022_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3162077_3162410_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3162419_3163739_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3163719_3165321_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3165317_3165524_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3165520_3167446_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3167420_3167966_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3168354_3168549_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3168713_3168920_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3169205_3169616_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_085948178.1|3169804_3171018_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738495.1|3171220_3171514_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3171604_3171787_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3172003_3172480_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3172466_3172772_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3173093_3173783_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3173779_3173920_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3173916_3174279_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3174275_3174566_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3174558_3174729_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3174728_3175184_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3175374_3175566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|3175685_3177212_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3177269_3177392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3177456_3177789_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3177856_3178159_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3178155_3178857_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3178853_3179678_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3179781_3180018_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3180007_3181150_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3181263_3182514_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3182685_3183339_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3183348_3183810_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3183863_3184970_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3185005_3185647_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3185650_3187021_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3186939:3186954	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3187189_3187861_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3187860_3189321_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3189921_3190203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3190458_3191001_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3191206_3191620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3191632_3191968_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3191980_3193036_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	3199128	3304397	5547257	head,capsid,integrase,portal,terminase,tail,holin,transposase	Stx2-converting_phage(32.46%)	136	3289964:3289984	3311053:3311073
WP_000085256.1|3199128_3200358_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3200606_3201728_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3201776_3203003_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3203252_3204389_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3204372_3205236_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|3205266_3205479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3205599_3206961_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3207021_3207297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3207376_3207502_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3209605_3213007_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3213597_3215946_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3215965_3216055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3216067_3216304_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3216249_3216987_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3217040_3217919_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3218221_3218332_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3218441_3218696_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3218712_3219411_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3219410_3219752_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212925.1|3219744_3222987_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|3223038_3223248_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3223343_3223718_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3223732_3224449_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3224514_3224859_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3224855_3225302_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3225298_3225649_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3225658_3225985_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_151542914.1|3226064_3228566_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_001063099.1|3228511_3228733_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3228777_3230715_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3230778_3232440_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958360.1|3232436_3233000_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_096220580.1|3233115_3233322_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	94.1	5.8e-30
WP_000279796.1|3233290_3233656_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|3233697_3233925_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3234349_3234535_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3234762_3234909_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3234908_3235478_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3235748_3236282_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3236332_3236677_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|3236681_3236888_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|3237335_3239186_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3239663_3240095_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3240545_3241259_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3241394_3241592_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3241816_3242371_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3242433_3242739_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3242751_3243801_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191871.1|3243802_3244075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|3244196_3244541_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3244660_3244873_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3245106_3245664_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3245665_3245884_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3246011_3246323_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3246315_3246543_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3246539_3246821_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3246853_3247570_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|3247603_3248026_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001356791.1|3248057_3249113_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000693878.1|3249181_3249607_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3249590_3249833_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3250224_3250563_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3250855_3251008_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3251019_3251658_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3251658_3251868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3252432_3252621_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3252617_3252806_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3252898_3254143_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|3254781_3255096_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3256058_3256439_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3256435_3256783_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3256832_3258371_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3258953_3259604_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_010917823.1|3259588_3259936_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001131642.1|3260314_3260890_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3261003_3261273_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_151542916.1|3261274_3262498_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|3262562_3263162_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|3263229_3263445_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_105626756.1|3263447_3266708_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001179509.1|3266895_3267333_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|3267332_3267674_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|3267666_3270909_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|3270956_3271166_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3271261_3271636_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3271650_3272367_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3272432_3272777_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3272773_3273220_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3273216_3273567_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3273576_3273903_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_086204827.1|3273905_3276485_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.1	0.0e+00
WP_001063099.1|3276430_3276652_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3276696_3278634_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3278697_3280359_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3280355_3280919_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3281208_3281574_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3281615_3281801_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3281930_3282071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3282427_3282652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3282716_3282923_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3283150_3283297_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3283296_3283866_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3284136_3284670_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3284720_3285065_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284518.1|3285069_3285285_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3285360_3285630_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3285667_3285850_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3285997_3287935_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3288249_3288417_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3289013_3289835_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3289831_3290206_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3289964:3289984	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3290218_3291268_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3291269_3291548_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3291715_3291928_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3292116_3292221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3292336_3292924_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3292926_3293118_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3293119_3293557_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3293543_3293861_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3293814_3294132_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3294121_3294424_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3294420_3294738_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3294734_3295451_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3295484_3295907_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|3295938_3296976_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3297044_3297470_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3297453_3297777_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3297901_3298378_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3298693_3298846_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3298960_3299476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3299608_3299998_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3300059_3300329_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3300297_3301416_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3301582_3302377_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3302373_3303420_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3303575_3304397_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3311053:3311073	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	3566174	3623102	5547257	protease,head,portal,tail,holin,transposase	Escherichia_phage(28.26%)	71	NA	NA
WP_000003653.1|3566174_3566762_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3566758_3567466_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3567484_3569278_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3569274_3570393_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3571010_3571193_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3572666_3572936_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3572937_3574251_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3574315_3574915_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515111.1|3574982_3578456_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|3578589_3579117_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|3579147_3579354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140439784.1|3579307_3579940_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	1.0e-101
WP_000194801.1|3579885_3580629_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3580639_3581338_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3581337_3581667_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082463.1|3581663_3584243_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3584223_3584637_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3584663_3585095_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3585108_3585849_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3585830_3586097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3586154_3586502_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3586538_3588044_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3588033_3589626_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3589622_3589829_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3591714_3591957_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3592006_3593545_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_151542921.1|3593594_3593918_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	7.4e-48
WP_085948178.1|3593914_3595128_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001171554.1|3595251_3595632_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3595707_3595983_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3596733_3596940_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3596902_3597247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3597195_3597468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3597400_3597595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3597627_3598161_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3598381_3598495_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3598716_3598902_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3599429_3599744_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3599948_3601162_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3601337_3603188_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3603305_3603509_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3603955_3604669_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3604763_3605003_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3605289_3606108_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3606259_3606631_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3606620_3606992_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3607004_3608054_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3608055_3608334_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3608501_3608714_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3608758_3608896_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3609261_3610035_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_151542923.1|3610386_3610800_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	1.1e-59
WP_000450992.1|3610815_3611586_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3611607_3612354_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3612360_3613452_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3613530_3613986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3614192_3614618_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3614601_3614874_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3614982_3615384_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3615411_3615603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3615602_3615890_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3615891_3616110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3616167_3616323_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3616464_3616854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3617040_3617226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3617227_3617533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3617799_3617988_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3617984_3618176_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3618269_3620741_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3620808_3621051_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3622442_3623102_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 13
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	3730203	3741269	5547257	capsid,terminase,integrase	uncultured_Caudovirales_phage(25.0%)	16	3731415:3731429	3742688:3742702
WP_000562896.1|3730203_3731127_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_001229493.1|3731289_3731778_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
3731415:3731429	attL	GCTTAAACGCGGCAT	NA	NA	NA	NA
WP_001018605.1|3731909_3732071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|3732074_3732269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557482.1|3732399_3732651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761782.1|3732937_3734692_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	7.1e-92
WP_000770151.1|3734688_3734988_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001302929.1|3734993_3735236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|3735225_3735417_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000920689.1|3735416_3735602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224852.1|3735594_3736302_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001075374.1|3736311_3736536_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000775337.1|3736627_3737401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085207.1|3737397_3738621_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000410785.1|3739025_3739250_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|3739322_3741269_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
3742688:3742702	attR	ATGCCGCGTTTAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	3863389	3902738	5547257	protease,lysis,integrase,terminase,portal,tail,holin,transposase	Enterobacteria_phage(47.62%)	52	3862974:3862988	3902812:3902826
3862974:3862988	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3863389_3864088_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_137056741.1|3864134_3864344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951025.1|3864318_3865200_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3865369_3865531_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3866027_3867047_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3867080_3868061_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3868237_3868507_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_001233141.1|3869884_3870484_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3870554_3873968_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3874028_3874637_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001152360.1|3875257_3875956_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3875965_3876295_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_151542929.1|3876294_3877917_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	2.7e-247
WP_085948178.1|3877971_3879184_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001161009.1|3880644_3880974_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3880982_3881369_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3881429_3882173_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3882183_3882585_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3882581_3883160_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3883171_3883447_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3883439_3883763_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3883849_3885877_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3885821_3886157_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3886278_3887403_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3887330_3887543_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3887539_3889642_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3889641_3890133_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3890122_3890401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3890807_3890960_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3890947_3891415_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3891411_3891909_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3891908_3892124_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3892266_3892665_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3892745_3892904_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_151542931.1|3892989_3893733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3893916_3894606_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3894620_3894743_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3895080_3896040_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3896251_3896917_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3896913_3897534_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3897526_3897697_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3897693_3897876_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3898573_3899254_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3899250_3899433_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3899405_3899597_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3899607_3899889_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3899987_3900209_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3900419_3901022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3901146_3901332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3901264_3901432_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3901471_3901690_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3901667_3902738_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3902812:3902826	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	4445936	4542923	5547257	plate,tail,integrase,transposase	Enterobacteria_phage(26.67%)	101	4472460:4472478	4529110:4529128
WP_000998048.1|4445936_4447475_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4447524_4447872_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4447868_4448249_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4448512_4448776_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4448775_4448916_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4448985_4449177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|4449238_4449529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4450001_4450544_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4450618_4451206_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4451263_4451932_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4451957_4454483_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|4454472_4456116_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4456084_4456795_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4457107_4457437_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4457684_4458299_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070685.1|4458716_4459406_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4459402_4460359_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667043.1|4460355_4462554_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4462563_4463520_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4463698_4464826_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4464967_4466026_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4466271_4467174_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4467876_4468155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4468321_4469044_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4469142_4470042_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4470717_4471674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4471806_4474140_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
4472460:4472478	attL	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000562750.1|4474153_4474477_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|4474476_4474698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4474694_4475252_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4475248_4475509_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4476442_4477195_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4477191_4477743_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4477748_4478021_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4478168_4478372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4478430_4478997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695296.1|4478996_4479200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|4479196_4479586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4479616_4480249_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4480241_4480700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4480699_4481317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4481289_4481706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4481709_4482891_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4483853_4484597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4485420_4486194_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4486251_4486806_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4486835_4487246_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4487266_4487710_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4487681_4488275_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4488274_4489069_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4489068_4489380_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4490331_4490625_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4490743_4490944_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4491044_4491758_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4491885_4492269_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_085948178.1|4492294_4493507_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|4493834_4494080_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4495149_4496403_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4496414_4497518_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4497805_4498861_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4498899_4499301_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4499358_4500603_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4500694_4501153_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4501413_4502871_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4502927_4503464_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4503396_4503663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4503969_4504422_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4504431_4504830_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4504832_4505126_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4505177_4506233_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4506303_4507074_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|4507033_4508773_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4509590_4510364_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4510549_4510810_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4510828_4511089_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4511244_4511985_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4511955_4512723_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4512827_4513406_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4513645_4516090_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4516132_4516606_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4516759_4517530_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4517647_4518820_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4518900_4519086_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4519000_4519264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4519465_4521226_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4521228_4522365_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4522472_4522763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356573.1|4523110_4523668_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|4523736_4525269_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_000509129.1|4526283_4530516_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
4529110:4529128	attR	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000103125.1|4530591_4532733_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4532942_4533461_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4534157_4534658_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4534692_4534917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4534967_4536359_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4536449_4536863_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4536866_4538717_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4538680_4539763_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4539787_4541068_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4541064_4541589_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4541591_4542923_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 16
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	4979865	5038876	5547257	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4979865_4981218_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4981311_4981863_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4982018_4983392_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4983567_4984566_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4984598_4985594_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4985580_4986603_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4988258_4989215_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4989524_4990055_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4990134_4990485_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4990478_4990730_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4990941_4991283_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_151542951.1|4991285_4995065_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4995061_4996795_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4997000_4997639_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4997961_4999305_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4999383_4999590_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4999914_5000469_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|5000531_5001470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5001681_5002422_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|5002611_5004555_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|5004672_5005053_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5005141_5006002_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5006109_5007075_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5007182_5007845_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5007889_5009302_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5009610_5010231_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5010448_5011087_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5011221_5012430_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5012437_5012869_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5013491_5014286_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5014356_5014806_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5014847_5015075_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5015079_5015394_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5015400_5015796_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5016122_5016398_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5016526_5017213_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|5017212_5018067_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5018076_5018727_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5018740_5019205_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5019214_5019520_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5019535_5020933_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|5021287_5022352_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|5022459_5023215_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5023211_5023961_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5024142_5024472_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5024620_5024896_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5025012_5026638_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5026721_5027885_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5027887_5028526_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5028535_5028934_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5028951_5029611_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5029661_5030360_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5030378_5030780_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5030906_5031638_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5031818_5034260_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5034298_5034724_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5034928_5036227_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5036330_5036528_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5036609_5037614_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5037616_5038876_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP032795	Escherichia coli strain ERL06-2503 chromosome, complete genome	5547257	5175756	5190421	5547257	tRNA,tail,integrase	Enterobacteria_phage(37.5%)	19	5171597:5171612	5189126:5189141
5171597:5171612	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5175756_5177172_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5177254_5178238_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5178403_5178646_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5178779_5179817_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5179905_5181003_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5181064_5181313_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5181473_5182115_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5182196_5182826_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5182898_5183471_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5183582_5183852_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|5183853_5185167_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|5185231_5185831_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5187152_5187689_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5187679_5188030_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5188026_5188311_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5188320_5188500_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5188646_5188844_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5189188_5189470_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5189126:5189141	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5189887_5190421_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP032796	Escherichia coli strain ERL06-2503 plasmid pERL06-2503, complete sequence	90978	8213	52640	90978	protease,transposase,integrase	Stx2-converting_phage(37.5%)	41	39151:39165	58234:58248
WP_001034100.1|8213_12116_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|13513_13693_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14294_15116_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15115_16222_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16311_18033_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18106_19105_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|19472_19853_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|19849_20197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|20246_21785_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302198.1|22153_22369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|22431_25128_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25214_26090_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26147_28058_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28057_29563_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29564_30788_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30818_31253_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|31249_31804_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31818_32166_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32162_32762_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32758_33736_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33774_34947_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34933_35446_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35503_36337_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36428_36830_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38720_39236_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39151:39165	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|39237_42234_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42283_44404_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44407_45847_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45913_46108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46137_46422_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|46422_46620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|46590_46821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46941_47682_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47966_48944_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|49256_49445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|49351_49552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49548_50169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50165_50849_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51307_51526_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51527_51833_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51833_52640_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
58234:58248	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
