The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	1234169	1261891	5519220	tail,transposase,integrase,holin	Stx2-converting_phage(31.58%)	33	1234115:1234174	1256049:1257359
1234115:1234174	attL	CTGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
WP_085948178.1|1234169_1235382_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000800629.1|1236922_1237774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071599.1|1237873_1238080_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1238402_1239608_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1239609_1240923_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1240919_1242551_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1242551_1242950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1243047_1243461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150580.1|1243856_1245077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1245152_1245455_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1245490_1246246_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1246599_1247166_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1247140_1247752_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1247748_1248414_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1248410_1249034_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1249286_1250030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1250115_1250283_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143067.1|1250690_1252544_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1252693_1252909_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1252913_1253258_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1253614_1253995_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1253991_1254339_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1254388_1255033_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1254839_1255730_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1255726_1256053_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1256270_1256540_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1256700_1257123_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1257252_1258311_-	T3SS effector EspW	NA	NA	NA	NA	NA
1256049:1257359	attR	GTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATGGCGCACTCATCACCGGACTGACCTTTCTTGCCCCCAAAGATGCCACACGGGTTCAGGGTTTTTTTCAGCATTTGCAGGTCAGGTTTGGTGACGGGCCGTGGCAGGATGTTAAGGGGCTGGATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGCGGTTGCGGAAAGCATGATGACCGTGAACACGGGGAGTTACTTACAGCACAGCTGCGACTGGGGCCGGCAGACATCCTGGAGTCAGATGAGAATGGCATTATCCCGGAGCAGGCCAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATCCTGCGTGCTGACGGGACGTGGGAAAATATTGGCGGGATGAAGTAACCCGACAGCTTCACAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTACGGTGGATGTTTGTTATGACTCCCTGTGTTTGGAATGAATATTTAATAACAGGTGTCTGGAAATATAGGGGCAAATCTACTGGATAGGCTATTGGGGCGTGAGAATCGAATGGAGAGAAGGGCTGTGGCTCTGGAAAGGCAATTAAATGGAGGTGTCGATTTTTTAAGGAGTGTTAATAACTATTTTCAGAGTGTCATGGCAGAACACAGAGAAAATAAAACAAGTAATAAAATATTAATGGAAAAAATAAATTCCTGTGTATTTGGAACGGATTCTAATCACTTTTCTTGCCCGGAGTCATTTTTGACATGCCCGATAACGCTGGACACACCTGCGAATGGAGTGTTCATGAGAAACTCACAAGGTGCTGAGATATGCTCTCTATATGATAAGGACACGTTAGTGCAACTTGTTGAAACTGGTGGAGCTCATCCTCTGAGTCGAGAACCTATAACAGAATCAATGATTATGAGAAAAGACGAATGTCACTTTGATTCAAAAAAAGAATCCTTTGTTGCAAGTGATGCTTAATTTTTTTTGTTGGTGTGTTTTTATATTAATAGTTTATTATAATAGTGCCATGTAAGGATATATTGTCTGAACAATTATTCAGACAATATTTTTTTCTTGCTTTATATGAAATATATAATATTTGGATCCTTAATTTCTAACCAAGGGGTCCCATGTTTTTATGTTATGATGCAGCCCATAATTTCGGGGGCTACATGCAAGAATATCTTTTTCTTCGGCGCCTGATTTGCGTAAAA	NA	NA	NA	NA
WP_001144077.1|1258389_1259040_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1259222_1259813_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1259799_1259919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1260314_1260563_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1261408_1261891_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	1539508	1640305	5519220	tail,portal,integrase,capsid,tRNA,lysis,bacteriocin,transposase,holin,terminase	Escherichia_phage(77.78%)	118	1543864:1543888	1608551:1608575
WP_001005794.1|1539508_1540039_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1540038_1540506_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1540492_1541173_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1541182_1542319_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1542493_1543651_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1543864:1543888	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1544082_1545252_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1545235_1545418_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|1545496_1545874_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|1545909_1546122_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1546081_1546708_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|1546704_1547136_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_151545389.1|1547191_1547869_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	99.6	2.3e-123
WP_001260980.1|1548193_1548451_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|1548579_1548777_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|1548865_1549171_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|1549213_1549783_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_000206752.1|1550045_1550669_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|1550672_1550960_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1550961_1551180_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|1551181_1551397_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|1551356_1551863_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|1551864_1552812_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000476217.1|1552808_1553048_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_000157000.1|1553040_1553244_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|1553240_1554119_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|1554226_1554670_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|1554746_1555568_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1555631_1555979_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|1556054_1556642_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187066.1|1556641_1557331_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459724.1|1557327_1558278_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|1558296_1558578_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_024175068.1|1558598_1558820_-	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	6.4e-35
WP_000917253.1|1558891_1559104_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|1559174_1559822_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|1560682_1561636_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1561632_1563102_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1563196_1563910_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1564005_1564209_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1564379_1564574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1564740_1565118_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1565111_1566632_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1566621_1567593_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|1567592_1568042_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|1568049_1568613_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|1568609_1568804_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|1568796_1569231_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_024165517.1|1569219_1569465_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001356551.1|1569479_1569632_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1570014_1570974_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1570985_1571255_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874428.1|1571740_1573678_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1573812_1573992_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1574032_1574278_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|1574355_1574571_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087729.1|1574575_1575109_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001056885.1|1575383_1575953_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1575952_1576102_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1576109_1576574_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1576605_1576899_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1577048_1577252_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|1577307_1578114_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1578094_1579801_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1579800_1581945_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1582102_1583110_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1583133_1584348_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1584403_1584793_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1584842_1585304_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1585287_1585851_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207926.1|1585850_1586501_+	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000117994.1|1586497_1588435_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1588436_1588706_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1588845_1589034_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146324.1|1589328_1590954_+	hypothetical protein	NA	A0A0N7C0A7	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1590950_1592219_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1592233_1592512_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1592517_1593135_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000998048.1|1593423_1594962_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1595011_1595359_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1595355_1595736_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_024175551.1|1596340_1596586_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	1.6e-39
WP_000078907.1|1596642_1596783_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1596839_1597241_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1597334_1597991_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1597993_1598440_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1598449_1598701_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1598711_1599977_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331692.1|1600046_1608428_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|1608649_1609582_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1608551:1608575	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|1609875_1610631_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001301650.1|1610835_1610952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952959.1|1611025_1612057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301981.1|1612421_1613762_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1614133_1614418_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_000531969.1|1614597_1615908_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426146.1|1615907_1618052_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195817.1|1618254_1618740_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033336.1|1619385_1619949_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112844.1|1620030_1622670_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000182852.1|1622692_1623451_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000675435.1|1623461_1623962_+	fimbrial protein	NA	NA	NA	NA	NA
WP_151545437.1|1624000_1624429_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000794741.1|1624425_1624947_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301548.1|1624948_1625791_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730817.1|1625961_1626513_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001302029.1|1626678_1627611_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1627645_1628731_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043834.1|1628734_1629559_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1629558_1630368_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089225.1|1630367_1630916_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1630949_1631228_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683769.1|1631348_1633355_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1633513_1634734_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127753.1|1635008_1636187_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615801.1|1636183_1637179_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699109.1|1637277_1638414_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_001289184.1|1638479_1639493_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1639492_1640305_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	1855292	1939789	5519220	tail,portal,integrase,tRNA,protease,holin,terminase	Enterobacteria_phage(53.33%)	100	1857767:1857787	1915207:1915227
WP_000569336.1|1855292_1856219_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1856223_1856955_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1856935_1857043_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1857102_1857804_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1857767:1857787	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1857824_1859111_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1859144_1859399_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1859417_1859552_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1859555_1859798_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1859885_1860248_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1860244_1860601_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1860677_1860965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1860934_1861111_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1861112_1862060_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1862056_1862278_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1862376_1862658_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1862668_1862860_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1862832_1863015_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1863014_1863692_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1863688_1864474_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1864479_1864776_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1864851_1865058_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1865538_1865916_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1865893_1866955_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1867035_1867725_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1867829_1868060_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1868129_1868669_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415640.1|1868755_1869685_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_000788810.1|1869681_1870383_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1870379_1870682_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1870749_1871082_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1871173_1871281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1871338_1872865_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1873329_1873881_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1873890_1874688_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1874804_1874906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1874902_1875358_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1875357_1875528_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1875520_1875811_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1875807_1876170_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1876166_1876307_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1876392_1876827_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_024165948.1|1876815_1877064_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
WP_001356551.1|1877078_1877231_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1878034_1879981_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1880115_1880295_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1880335_1880581_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000284506.1|1880658_1880874_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1880878_1881412_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1881682_1882252_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1882251_1882398_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1882625_1882811_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1883328_1883805_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1883801_1884809_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|1884970_1886209_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|1886201_1886426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|1886485_1887067_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|1887047_1887767_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|1887759_1887984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1887976_1888570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1888766_1889009_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|1889005_1890820_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|1891107_1891353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1891349_1891772_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|1892238_1892433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|1892429_1894319_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|1894576_1894858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|1896350_1896563_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1896562_1898065_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1898009_1900034_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1900121_1900448_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1900440_1900722_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1900724_1901348_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1901360_1901759_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1901766_1902519_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1902532_1902955_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1902981_1903290_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1903333_1905979_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1905975_1906305_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_151545393.1|1906304_1907003_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	4.9e-129
WP_000194798.1|1907013_1907757_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1907702_1908332_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542842.1|1908572_1912049_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228302.1|1912116_1912716_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1912780_1914094_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1914095_1914365_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1914732_1914981_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1915495_1917181_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1915207:1915227	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1917177_1917897_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1917943_1918414_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1918455_1918917_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1919041_1921045_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1921041_1922178_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1922170_1922902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1922920_1924450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1924460_1925549_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1926789_1927107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1927168_1930798_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1930807_1932349_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1932512_1933793_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1937755_1939789_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	2070607	2139144	5519220	tail,portal,integrase,head,transposase,holin,terminase	Escherichia_phage(36.96%)	71	2091695:2091754	2116291:2117600
WP_000998048.1|2070607_2072146_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2072195_2072543_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2072539_2072920_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2073281_2073827_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2073823_2074567_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2074578_2075658_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2075719_2076655_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2077111_2078029_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2078130_2079081_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2079198_2080842_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2081467_2082184_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2082526_2083981_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2084082_2085399_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2085712_2086765_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
2091695:2091754	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2091748_2092961_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151542851.1|2093001_2096322_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2096811_2097609_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2097844_2098867_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2098866_2099070_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2099128_2101600_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2101695_2101884_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2101880_2102069_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2102549_2102702_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2102976_2103621_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2103718_2103946_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2103942_2104368_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_151542853.1|2104436_2105474_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2105505_2105928_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2105962_2106661_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2106682_2106907_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2106903_2107260_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2107292_2107445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2107441_2107753_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2107879_2108443_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2108552_2108657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2108843_2109056_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2109097_2109283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2109223_2109502_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2109503_2110553_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2110565_2110925_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2110921_2111611_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2111641_2111764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|2112244_2112673_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2113150_2115001_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2115082_2116296_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2116615_2116822_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2116826_2117171_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2117221_2117755_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
2116291:2117600	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACTGGCTAAGAAGGATAGTTGGGTTTCACATGATACTTATATCTGGCAGTACATTTTCTGACAGACAGTGATGGGTGTTGTCAAGATATTGTGTCATTTATAACCTGAATCAGGGGGGGGAGCCGGAATGTTATCTGGCATTTTTAGCAGAGCCTGAATGCCATAATCACGGCTCCCGGCGTTGGCCGTCAGTGGGCGACACTGGCGGCTTTTTGTTTTCCTTTACTTTCATTTTCTGTCGGCGGTGACGGAGACATACATCAGATGGAAAAAATCACAACAGGTGTGTCATACACCACGTCAGCGGTGGGGACGGGATACTGGTTACTGCAGCTGCTGGACAAAGTCTCTCCGTCCCAGTGGGTGGCAATCGGTGTGCTGGGGAGTCTGCTGTTTGGCCTGCTGACGTATCTGACTAACCTGTATTTCAAAATCAGAGAGGACCGTCGTAAGGCGGCGCGGGGGGAGTAAAGCGATGAAGAAAAAATACGAACTGGGTGTTAAAGGGATAAATAATTACCCGGATAAGATTACTGTTACTGTGGCACCGGAAATTGGTGGGTATCCGTCACTGTTGTTGCCAGATGTGGCGATTAGTCTTGACCGTACTGAAGGTGCCACGCTGGAGTTTTACGAAGCTGAGGCGAAAAAGCAGGCGAAGCAGTTTTTCATGGATGTTGCTGCCGGGTTATGTGAAGGGGATGGTCCGTTGCCGGAAAAGCGCCCCGTAATTTTAGAGGCGCAGGATGTGTTGATAACCTACAGAGGAAAACTACCGGGAATAATTACGGGTTCTCTGAAGACTCCACCGCTGGCCTGAAGACTTAACATATCCAGGGATTTGAAATCGATAAACCCTGATAAATATCCATGAACGCAAAAATCAGATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGGTGCAGGGGCGTCTGCGCCTGAAATCCTCGACCAGTTTCTTGACGAAAAAGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGCGGTGCCATCCTGGTGGATGGTAAACCTGTCGTTCCGGGCATGAAGTTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGAGTGGGTGGAGCGCAATATTAAAGTACCGCTGACCGAACCCCAGAAAGCGGGGATCGCGTCATTCTGTCCGTACAACATTGGTCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGAA	NA	NA	NA	NA
WP_001303555.1|2117910_2118093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2118105_2118237_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2118464_2118650_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2119176_2119491_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2119572_2119797_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2120191_2120701_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2122589_2122796_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2122792_2124385_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2124374_2125880_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2125916_2126264_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2126321_2126588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2126569_2127310_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2127323_2127755_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2127781_2128195_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|2128175_2130755_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2130751_2131081_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2131080_2131779_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_151545396.1|2131789_2132533_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	5.0e-148
WP_071601640.1|2132478_2133108_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_151545398.1|2133348_2136828_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.5	0.0e+00
WP_001230508.1|2136895_2137495_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151542857.1|2137559_2138873_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	2.8e-77
WP_001023407.1|2138874_2139144_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	2197297	2218023	5519220	tail,transposase,integrase	Enterobacteria_phage(78.26%)	27	2211159:2211172	2221165:2221178
WP_085948178.1|2197297_2198511_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000132765.1|2199125_2199449_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2199606_2200791_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000665314.1|2201356_2201722_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2201757_2201886_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2204688_2205177_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2205333_2205906_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2205949_2206366_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2207571_2207886_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2207890_2208850_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2208926_2211749_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2211159:2211172	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2211755_2212121_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2212193_2212424_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2212746_2213046_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2213042_2213309_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2213305_2213509_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2213532_2213949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2214041_2214155_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2214151_2214394_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2214405_2214684_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2214694_2215045_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2215066_2215270_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2215341_2215479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2215568_2215973_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2215988_2216639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2216668_2217016_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2217021_2218023_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2221165:2221178	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	2283981	2374397	5519220	tail,portal,integrase,tRNA,protease,holin,terminase	Escherichia_phage(36.92%)	110	2296680:2296697	2342979:2342996
WP_000916763.1|2283981_2284212_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2284350_2284725_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2284728_2285601_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2285613_2285955_+	YebY family protein	NA	NA	NA	NA	NA
WP_045893699.1|2286347_2287424_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.1	1.7e-96
WP_001311878.1|2287389_2287671_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|2287777_2287966_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2287958_2288153_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166313.1|2288209_2289019_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000102194.1|2289011_2291681_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_001427414.1|2291761_2291932_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560228.1|2291931_2292153_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_062882198.1|2292199_2293051_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	67.5	3.2e-66
WP_001169149.1|2293465_2293618_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000233812.1|2293628_2293763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253182.1|2293998_2294463_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_062881721.1|2294567_2294843_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	64.6	9.2e-23
WP_000702023.1|2294826_2295249_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|2295261_2296119_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_062881720.1|2296125_2296872_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.5	3.1e-113
2296680:2296697	attL	GCATCAGATTGTTGATCG	NA	NA	NA	NA
WP_151542863.1|2296893_2297655_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	92.5	1.3e-122
WP_151542866.1|2297671_2298094_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000072553.1|2298199_2298412_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_100004899.1|2298497_2298662_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.0e-16
WP_151542868.1|2298663_2298927_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.8e-29
WP_000207986.1|2298937_2299807_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278450.1|2299922_2300027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542871.1|2300216_2300429_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_000119356.1|2300640_2300820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|2300838_2301324_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_062882632.1|2301785_2302385_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.0e-106
WP_000228018.1|2302384_2302675_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|2302671_2303226_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_071525387.1|2303222_2303447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370386.1|2303973_2304159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151542873.1|2304767_2306714_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.0	0.0e+00
WP_000143464.1|2306850_2307030_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_024246943.1|2307070_2307316_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	2.0e-16
WP_001072899.1|2307393_2307609_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001015166.1|2307612_2308254_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000282141.1|2308263_2308578_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_109063312.1|2308706_2309240_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.2e-100
WP_001208683.1|2309758_2309944_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	8.1e-23
WP_000373407.1|2310419_2310896_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077621.1|2310892_2311900_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_151542875.1|2312061_2313300_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.0	5.4e-62
WP_001095275.1|2313312_2313516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542877.1|2313574_2314156_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	5.8e-51
WP_151542961.1|2314136_2314847_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000551742.1|2314850_2315216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542879.1|2315208_2315442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728900.1|2315638_2315929_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_151542881.1|2315925_2317680_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_151542883.1|2318027_2318279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126694.1|2318275_2318686_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|2319146_2319341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|2319337_2321227_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|2321484_2321766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|2323258_2323471_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|2323470_2324973_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2324917_2326942_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2327029_2327356_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2327348_2327630_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2327632_2328256_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2328268_2328667_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2328674_2329427_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2329440_2329863_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|2329889_2330198_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|2330241_2332887_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|2332883_2333213_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|2333212_2333911_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|2333921_2334665_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2334610_2335240_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542887.1|2335480_2338957_+	DUF1983 domain-containing protein	NA	Q687E8	Enterobacteria_phage	96.0	0.0e+00
WP_001230428.1|2339024_2339624_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_151545402.1|2339688_2341002_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	3.3e-78
WP_001023407.1|2341003_2341273_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000812736.1|2342002_2342659_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_151542963.1|2342666_2342852_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001295499.1|2342956_2343193_-	DUF1480 family protein	NA	NA	NA	NA	NA
2342979:2342996	attR	GCATCAGATTGTTGATCG	NA	NA	NA	NA
WP_001302304.1|2343310_2344750_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2344830_2347464_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2347432_2348716_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2348845_2349343_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431368.1|2349439_2350138_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2350157_2352206_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2352397_2353279_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127211.1|2353324_2354698_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|2354874_2355666_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211007.1|2355809_2356049_-	membrane protein	NA	NA	NA	NA	NA
WP_000714550.1|2356208_2356352_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006862.1|2356426_2356714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2357382_2357526_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2357538_2357748_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010147.1|2357913_2358723_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2358719_2359286_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156258.1|2359715_2360174_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2360228_2361080_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2361092_2361893_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2361955_2362927_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394973.1|2363389_2364940_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001302042.1|2364943_2366542_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624305.1|2366672_2368037_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2368220_2368799_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854987.1|2368802_2370164_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|2370237_2370417_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2370536_2370896_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2371257_2371602_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2371733_2373644_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220997.1|2373701_2374397_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	2594151	2689001	5519220	tail,portal,capsid,lysis,head,transposase,protease,holin,terminase	Enterobacteria_phage(31.75%)	107	NA	NA
WP_001260835.1|2594151_2594973_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2595072_2595156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2595248_2595584_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2595980_2597234_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2597340_2598234_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2598368_2599589_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2599713_2600409_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2600361_2601654_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2601811_2602426_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2602468_2603323_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2603324_2603942_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2603952_2606376_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2606436_2608863_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2609061_2609367_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2609474_2610185_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2610187_2610748_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2610782_2611124_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2611258_2611585_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2611757_2611883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2612573_2612810_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_085948178.1|2614332_2615546_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001090200.1|2616774_2616966_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2616962_2617151_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2617551_2617716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2617719_2617938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2618009_2618309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2618660_2618939_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2618940_2619132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2619152_2619524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2619621_2619924_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2619920_2620346_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2620368_2621331_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2621337_2622078_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2622888_2623284_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2623340_2623925_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2624040_2624145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2624333_2624546_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2624713_2624992_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2624993_2626043_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2626055_2626415_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2626411_2627101_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2627131_2627254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2627737_2628166_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_085948178.1|2630379_2631593_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411805.1|2632255_2632462_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2632466_2632811_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2632861_2633395_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2633665_2634235_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2634234_2634381_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|2634388_2634856_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|2635319_2635634_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2635715_2635940_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2635955_2636213_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2636326_2636872_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2636846_2638772_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2638768_2638975_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2638971_2640573_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2640553_2641873_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2641882_2642215_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2642270_2643296_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2643337_2643736_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2643747_2644101_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2644115_2644649_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2644645_2645041_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2645048_2645801_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2645814_2646237_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2646263_2646677_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_072643101.1|2646657_2649270_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000847298.1|2649266_2649596_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2649595_2650294_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2650304_2651048_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_122989782.1|2650993_2651623_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|2651863_2654719_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|2654786_2655386_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|2655537_2656842_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|2656843_2657113_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2658139_2659465_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|2659732_2659921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|2661062_2661185_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2661291_2662203_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2662268_2662838_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2663803_2665342_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2665391_2665739_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2665735_2666116_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2666455_2666734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2667161_2667308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2667444_2668092_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2668275_2668866_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2670594_2671023_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2671616_2671835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|2672336_2672843_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2672888_2673389_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2673474_2673654_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2674034_2674841_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2674840_2676034_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|2676045_2677404_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|2677407_2679003_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2679002_2680565_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2680656_2680701_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2680838_2681720_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2681716_2682337_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_151545405.1|2682364_2683795_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|2683800_2685013_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001291216.1|2685474_2686347_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2686386_2686977_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2686973_2687732_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2687951_2689001_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	2960245	3010952	5519220	tail,capsid,integrase,head,holin,terminase	Stx2-converting_phage(36.73%)	63	2985723:2985736	3012290:3012303
WP_000214712.1|2960245_2960449_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2960484_2961945_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2962033_2963317_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2963376_2963691_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|2963687_2963822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143804.1|2963852_2964494_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2964575_2965205_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2965277_2965853_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2965966_2966236_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268849.1|2966237_2967551_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230508.1|2967615_2968215_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151545407.1|2968282_2970796_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_050439450.1|2972702_2973335_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2973280_2974024_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_151545409.1|2974034_2974733_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	4.9e-129
WP_000807954.1|2974732_2975074_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2975066_2978309_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2978360_2978570_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2978665_2979040_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2979045_2979762_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2979820_2980165_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2980161_2980608_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2980604_2980955_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000125988.1|2980964_2981291_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2983331_2983553_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_151542909.1|2983597_2985535_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001303179.1|2985598_2987260_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
2985723:2985736	attL	AGAATGGCGTTACC	NA	NA	NA	NA
WP_000958392.1|2987256_2987820_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_000279786.1|2988109_2988475_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2988516_2988744_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2989168_2989354_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2989581_2989728_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2989727_2990297_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2990567_2991101_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2991151_2991496_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2991500_2991716_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2991865_2993719_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|2993838_2994024_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000917750.1|2995723_2995921_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2996162_2996693_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2996701_2997061_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2997073_2998120_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2998121_2998400_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2998469_2998727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2998947_2999160_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2999438_3000197_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3000895_3001060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3001056_3001638_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|3001824_3002247_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|3002278_3003319_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3003290_3003842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3003825_3004053_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3004129_3004537_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3004800_3005100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3005172_3005391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3005413_3005821_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3005798_3006032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3006025_3006193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3006590_3006779_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|3006775_3006967_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3007059_3009531_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3009595_3009844_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3009821_3010952_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3012290:3012303	attR	GGTAACGCCATTCT	NA	NA	NA	NA
>prophage 9
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	3064129	3166669	5519220	tail,capsid,portal,integrase,tRNA,head,lysis,transposase,protease,holin,terminase	Enterobacteria_phage(50.0%)	113	3094853:3094868	3160572:3160587
WP_000152933.1|3064129_3064714_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3064830_3065922_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3066765_3069651_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3069750_3071670_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3071897_3072968_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3072978_3073611_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3073621_3075040_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|3075352_3075481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|3075586_3077044_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|3077071_3077272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3077379_3078402_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3078401_3079382_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3079378_3080137_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000904019.1|3080146_3080791_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|3080735_3081017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|3080955_3081810_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3081835_3083806_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3083855_3084110_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|3084310_3084907_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|3084958_3086171_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|3086359_3086971_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3087070_3087985_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3088080_3089817_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|3089919_3090009_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_085949318.1|3089974_3091188_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000197859.1|3091525_3092596_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_053889839.1|3092605_3093904_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3094266_3095799_+	SpoVR family protein	NA	NA	NA	NA	NA
3094853:3094868	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3095850_3096570_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3096791_3098333_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3098478_3099009_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3099054_3100323_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3100322_3100742_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3101114_3102026_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3102232_3102694_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3102770_3103430_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3103501_3103795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3104035_3104437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3104539_3104908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3105427_3106123_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3106146_3106959_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3106962_3107229_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3108468_3109053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3109551_3110505_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3110691_3112176_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|3112478_3114017_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3114066_3114414_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3114410_3114791_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3114866_3115115_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3115171_3115840_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3116337_3116520_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3116598_3117099_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3117135_3117642_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3117660_3118551_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3118670_3119252_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3119251_3122167_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3122231_3122831_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3122897_3126296_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3126356_3126989_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3126925_3127669_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3127674_3128373_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3128372_3128702_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3128698_3131248_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3131240_3131675_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3131656_3132079_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3132094_3132835_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3132842_3133238_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3133234_3133813_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3133824_3134178_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3134189_3134588_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3134629_3135655_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3135710_3136043_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3136052_3137372_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3137352_3138954_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3138950_3139157_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3139153_3141079_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3141053_3141599_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3141987_3142182_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3142346_3142553_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3142838_3143249_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_085948178.1|3143437_3144651_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738495.1|3144853_3145147_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3145237_3145420_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3145636_3146113_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3146099_3146405_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3146726_3147416_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3147412_3147553_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3147549_3147912_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3147908_3148199_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3148191_3148362_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3148361_3148817_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3149007_3149199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|3149318_3150845_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3150902_3151025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3151089_3151422_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3151489_3151792_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3151788_3152490_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3152486_3153311_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3153414_3153651_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3153640_3154783_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3154896_3156147_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3156318_3156972_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3156981_3157443_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3157496_3158603_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3158638_3159280_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3159283_3160654_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3160572:3160587	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3160822_3161494_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3161493_3162954_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3163554_3163836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3164091_3164634_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3164839_3165253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3165265_3165601_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3165613_3166669_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	3172761	3278030	5519220	tail,capsid,portal,integrase,head,transposase,holin,terminase	Stx2-converting_phage(32.46%)	136	3263597:3263617	3284687:3284707
WP_000085256.1|3172761_3173991_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3174239_3175361_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3175409_3176636_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3176885_3178022_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3178005_3178869_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|3178899_3179112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3179232_3180594_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3180654_3180930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3181009_3181135_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3183238_3186640_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3187230_3189579_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3189598_3189688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3189700_3189937_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3189882_3190620_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3190673_3191552_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3191854_3191965_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3192074_3192329_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3192345_3193044_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3193043_3193385_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_151545411.1|3193377_3196620_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.5	0.0e+00
WP_001453698.1|3196671_3196881_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3196976_3197351_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3197365_3198082_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3198147_3198492_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3198488_3198935_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3198931_3199282_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3199291_3199618_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_151542914.1|3199697_3202199_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_001063099.1|3202144_3202366_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3202410_3204348_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3204411_3206073_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958360.1|3206069_3206633_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_096220580.1|3206748_3206955_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	94.1	5.8e-30
WP_000279796.1|3206923_3207289_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|3207330_3207558_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3207982_3208168_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3208395_3208542_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3208541_3209111_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3209381_3209915_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|3209965_3210310_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|3210314_3210521_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|3210968_3212819_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3213296_3213728_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3214178_3214892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3215027_3215225_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3215449_3216004_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3216066_3216372_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3216384_3217434_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191871.1|3217435_3217708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|3217829_3218174_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3218293_3218506_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3218739_3219297_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3219298_3219517_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3219644_3219956_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3219948_3220176_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3220172_3220454_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3220486_3221203_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|3221236_3221659_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001356791.1|3221690_3222746_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000693878.1|3222814_3223240_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3223223_3223466_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3223857_3224196_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3224488_3224641_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3224652_3225291_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3225291_3225501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3226065_3226254_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3226250_3226439_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3226531_3227776_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|3228414_3228729_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3229691_3230072_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3230068_3230416_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3230465_3232004_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3232586_3233237_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_010917823.1|3233221_3233569_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001131642.1|3233947_3234523_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3234636_3234906_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_151545413.1|3234907_3236131_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	94.1	1.8e-78
WP_001230508.1|3236195_3236795_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|3236862_3237078_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_105626756.1|3237080_3240341_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001179509.1|3240528_3240966_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|3240965_3241307_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|3241299_3244542_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|3244589_3244799_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3244894_3245269_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3245283_3246000_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3246065_3246410_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3246406_3246853_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3246849_3247200_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3247209_3247536_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_086204827.1|3247538_3250118_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.1	0.0e+00
WP_001063099.1|3250063_3250285_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3250329_3252267_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3252330_3253992_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3253988_3254552_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3254841_3255207_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3255248_3255434_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3255563_3255704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3256060_3256285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3256349_3256556_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3256783_3256930_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3256929_3257499_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3257769_3258303_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3258353_3258698_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284518.1|3258702_3258918_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3258993_3259263_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3259300_3259483_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3259630_3261568_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3261882_3262050_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3262646_3263468_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3263464_3263839_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3263597:3263617	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3263851_3264901_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3264902_3265181_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3265348_3265561_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3265749_3265854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3265969_3266557_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3266559_3266751_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3266752_3267190_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3267176_3267494_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3267447_3267765_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3267754_3268057_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3268053_3268371_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3268367_3269084_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3269117_3269540_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|3269571_3270609_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3270677_3271103_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3271086_3271410_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3271534_3272011_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3272326_3272479_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3272593_3273109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3273241_3273631_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3273692_3273962_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3273930_3275049_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3275215_3276010_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3276006_3277053_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3277208_3278030_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3284687:3284707	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	3537150	3592763	5519220	tail,portal,head,transposase,protease,holin	Escherichia_phage(26.67%)	71	NA	NA
WP_000003653.1|3537150_3537738_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3537734_3538442_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3538460_3540254_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3540250_3541369_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3541986_3542169_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3543642_3543912_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3543913_3545227_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3545291_3545891_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515111.1|3545958_3549432_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|3549565_3550093_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|3550123_3550330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140439784.1|3550283_3550916_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	1.0e-101
WP_000194801.1|3550861_3551605_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3551615_3552314_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3552313_3552643_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082463.1|3552639_3555219_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3555199_3555613_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3555639_3556071_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3556084_3556825_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3556806_3557073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3557130_3557478_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3557514_3559020_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3559009_3560602_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3560598_3560805_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3562689_3562932_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3562981_3564520_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3564569_3564917_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3564913_3565294_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3565369_3565645_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3566395_3566602_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3566564_3566909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3566857_3567130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3567062_3567257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3567289_3567823_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3568043_3568157_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3568378_3568564_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3569090_3569405_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3569609_3570823_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3570998_3572849_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3572966_3573170_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3573616_3574330_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3574424_3574664_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3574950_3575769_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3575920_3576292_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3576281_3576653_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3576665_3577715_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3577716_3577995_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3578162_3578375_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3578419_3578557_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3578719_3578911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|3578922_3579696_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_151542923.1|3580047_3580461_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	1.1e-59
WP_000450992.1|3580476_3581247_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3581268_3582015_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3582021_3583113_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3583191_3583647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3583853_3584279_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3584262_3584535_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3584643_3585045_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3585072_3585264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3585263_3585551_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3585552_3585771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3585828_3585984_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3586125_3586515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3586701_3586887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3586888_3587194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3587460_3587649_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3587645_3587837_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3587930_3590402_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3590469_3590712_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3592103_3592763_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 12
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	3700107	3710718	5519220	terminase,capsid,integrase	uncultured_Caudovirales_phage(25.0%)	15	3701319:3701333	3712137:3712151
WP_001480033.1|3700107_3701031_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	9.1e-14
WP_001229492.1|3701193_3701682_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
3701319:3701333	attL	GCTTAAACGCGGCAT	NA	NA	NA	NA
WP_001018603.1|3701809_3701971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|3701974_3702169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557482.1|3702299_3702551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761782.1|3702837_3704592_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	7.1e-92
WP_000770151.1|3704588_3704888_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001302929.1|3704893_3705136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|3705125_3705317_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000920689.1|3705316_3705502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224852.1|3705494_3706202_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001453651.1|3706211_3706421_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.8e-15
WP_032362418.1|3706831_3708070_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	1.3e-124
WP_000410785.1|3708474_3708699_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|3708771_3710718_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
3712137:3712151	attR	ATGCCGCGTTTAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	3832838	3872252	5519220	tail,portal,integrase,lysis,transposase,protease,holin,terminase	Enterobacteria_phage(48.84%)	53	3832423:3832437	3872326:3872340
3832423:3832437	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3832838_3833537_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_137056741.1|3833583_3833793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951025.1|3833767_3834649_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3834818_3834980_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3835476_3836496_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3836529_3837510_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3837686_3837956_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_001233141.1|3839333_3839933_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3840003_3843417_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3843477_3844086_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3844022_3844766_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3844771_3845470_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3845479_3845809_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_151542929.1|3845808_3847431_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	2.7e-247
WP_085948178.1|3847485_3848698_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001161009.1|3850158_3850488_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3850496_3850883_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3850943_3851687_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3851697_3852099_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3852095_3852674_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3852685_3852961_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3852953_3853277_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3853363_3855391_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3855335_3855671_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3855792_3856917_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3856844_3857057_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3857053_3859156_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3859155_3859647_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3859636_3859915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3860321_3860474_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3860461_3860929_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3860925_3861423_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3861422_3861638_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3861780_3862179_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3862259_3862418_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_151542931.1|3862503_3863247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3863430_3864120_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3864134_3864257_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3864594_3865554_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3865765_3866431_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3866427_3867048_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3867040_3867211_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3867207_3867390_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3868087_3868768_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3868764_3868947_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3868919_3869111_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3869121_3869403_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3869501_3869723_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3869933_3870536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3870660_3870846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3870778_3870946_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3870985_3871204_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3871181_3872252_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3872326:3872340	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	4451169	4491825	5519220	tail,transposase,integrase	Escherichia_phage(30.0%)	44	4450740:4450754	4488295:4488309
4450740:4450754	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4451169_4452351_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4453313_4454057_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4454880_4455654_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4455711_4456266_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4456295_4456790_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4456789_4457383_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4457354_4457798_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001096948.1|4457818_4458529_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	86.6	1.3e-65
WP_000788819.1|4458528_4458840_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4459791_4460085_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4460203_4460404_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4460504_4461218_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4461345_4461729_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_085948178.1|4461754_4462967_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|4463294_4463540_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4464609_4465863_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4465874_4466978_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4467265_4468321_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4468359_4468761_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4468818_4470063_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4470154_4470613_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4470873_4472331_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4472387_4472924_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4472856_4473123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4473429_4473882_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4473891_4474290_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4474292_4474586_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4474637_4475693_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4475763_4476534_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|4476493_4478233_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4479050_4479824_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4480009_4480270_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4480288_4480549_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4480704_4481445_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4481415_4482183_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4482287_4482866_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4483105_4485550_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4485592_4486066_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4486219_4486990_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4487107_4488280_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4488360_4488546_+	protein YncO	NA	NA	NA	NA	NA
4488295:4488309	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4488460_4488724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4488925_4490686_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4490688_4491825_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	4951828	5010839	5519220	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4951828_4953181_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4953274_4953826_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4953981_4955355_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4955530_4956529_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4956561_4957557_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4957543_4958566_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4960221_4961178_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4961487_4962018_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4962097_4962448_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4962441_4962693_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4962904_4963246_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_151542951.1|4963248_4967028_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4967024_4968758_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4968963_4969602_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4969924_4971268_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4971346_4971553_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4971877_4972432_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4972494_4973433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4973644_4974385_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4974574_4976518_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4976635_4977016_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4977104_4977965_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4978072_4979038_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4979145_4979808_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4979852_4981265_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4981573_4982194_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4982411_4983050_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4983184_4984393_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4984400_4984832_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4985454_4986249_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4986319_4986769_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4986810_4987038_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4987042_4987357_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4987363_4987759_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4988085_4988361_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4988489_4989176_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4989175_4990030_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4990039_4990690_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4990703_4991168_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4991177_4991483_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4991498_4992896_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4993250_4994315_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4994422_4995178_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4995174_4995924_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4996105_4996435_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4996583_4996859_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4996975_4998601_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4998684_4999848_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4999850_5000489_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5000498_5000897_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5000914_5001574_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5001624_5002323_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5002341_5002743_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5002869_5003601_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5003781_5006223_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5006261_5006687_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5006891_5008190_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5008293_5008491_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5008572_5009577_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5009579_5010839_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP032801	Escherichia coli strain ERL06-2442 chromosome, complete genome	5519220	5147719	5162384	5519220	tRNA,tail,integrase	Enterobacteria_phage(37.5%)	19	5143560:5143575	5161089:5161104
5143560:5143575	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5147719_5149135_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5149217_5150201_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5150366_5150609_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5150742_5151780_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5151868_5152966_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5153027_5153276_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5153436_5154078_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5154159_5154789_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5154861_5155434_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5155545_5155815_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|5155816_5157130_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|5157194_5157794_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5159115_5159652_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5159642_5159993_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5159989_5160274_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5160283_5160463_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5160609_5160807_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5161151_5161433_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5161089:5161104	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5161850_5162384_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP032802	Escherichia coli strain ERL06-2442 plasmid pERL06-2442, complete sequence	90995	8213	52657	90995	protease,transposase,integrase	Stx2-converting_phage(37.5%)	42	39168:39182	58251:58265
WP_001034100.1|8213_12116_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|13513_13693_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14294_15116_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15115_16222_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16311_18033_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18106_19105_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|19472_19853_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|19849_20197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|20246_21785_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_115446889.1|22060_22267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302198.1|22170_22386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|22448_25145_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25231_26107_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26164_28075_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28074_29580_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29581_30805_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30835_31270_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|31266_31821_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31835_32183_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32179_32779_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32775_33753_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33791_34964_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34950_35463_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35520_36354_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36445_36847_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38737_39253_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39168:39182	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|39254_42251_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42300_44421_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44424_45864_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45930_46125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46154_46439_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|46439_46637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|46607_46838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46958_47699_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47983_48961_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|49273_49462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|49368_49569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49565_50186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50182_50866_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51324_51543_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51544_51850_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51850_52657_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
58251:58265	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
