The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044411	Acidithiobacillus sp. 'AMD consortium' chromosome, complete genome	2933811	334303	343092	2933811		Staphylococcus_phage(50.0%)	11	NA	NA
WP_151528016.1|334303_335548_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	54.4	3.2e-99
WP_113527387.1|335554_336046_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_113527388.1|336035_337136_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.1	3.8e-43
WP_113527389.1|337139_337796_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	6.6e-19
WP_113527390.1|337792_338926_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.3	1.6e-52
WP_113527391.1|338922_339387_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	51.0	3.6e-35
WP_113527392.1|339397_339841_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_113527393.1|339966_340254_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_113527394.1|340411_340984_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_113527395.1|341001_341355_-	LapA family protein	NA	NA	NA	NA	NA
WP_113527396.1|341409_343092_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E5W0	Micromonas_pusilla_virus	29.3	1.7e-34
>prophage 2
NZ_CP044411	Acidithiobacillus sp. 'AMD consortium' chromosome, complete genome	2933811	926460	938001	2933811		Acanthocystis_turfacea_Chlorella_virus(33.33%)	8	NA	NA
WP_126605152.1|926460_928950_-	plasma-membrane proton-efflux P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.0	3.2e-53
WP_126605153.1|929512_930466_-	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	33.4	2.7e-37
WP_126605154.1|930849_931743_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126605155.1|931899_934329_-	plasma-membrane proton-efflux P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.4	3.4e-44
WP_126605156.1|934703_935021_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	38.0	1.4e-06
WP_113526787.1|935037_935313_-	plasmid maintenance system killer	NA	A0A2L1IV28	Escherichia_phage	39.1	3.9e-13
WP_126605157.1|935702_935987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528117.1|935976_938001_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	6.5e-73
>prophage 3
NZ_CP044411	Acidithiobacillus sp. 'AMD consortium' chromosome, complete genome	2933811	1410295	1418584	2933811	tRNA	Bacillus_phage(14.29%)	7	NA	NA
WP_126605364.1|1410295_1410907_-	AAA family ATPase	NA	S5MMC6	Bacillus_phage	25.0	4.2e-07
WP_113525706.1|1410903_1411473_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	35.4	2.1e-13
WP_126605365.1|1411430_1412783_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	B5LJ39	Mycobacterium_phage	26.5	4.0e-18
WP_126605366.1|1412804_1414298_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.4	3.0e-27
WP_113525703.1|1414432_1415437_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	49.7	7.2e-81
WP_126605367.1|1415575_1417036_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.1	1.0e-91
WP_126605368.1|1417039_1418584_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.4	1.4e-14
>prophage 4
NZ_CP044411	Acidithiobacillus sp. 'AMD consortium' chromosome, complete genome	2933811	1715417	1723297	2933811	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_126605654.1|1715417_1716080_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	2.9e-30
WP_113525485.1|1717957_1718272_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	40.7	9.6e-08
WP_126604202.1|1718287_1718566_-	peptidase	NA	A0A2L1IV28	Escherichia_phage	45.7	1.3e-19
WP_126604203.1|1719051_1720002_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.8	3.1e-49
WP_126604204.1|1720009_1721794_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_126604205.1|1721805_1722141_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	47.3	4.3e-14
WP_126604206.1|1722181_1723297_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.9	1.5e-87
>prophage 5
NZ_CP044411	Acidithiobacillus sp. 'AMD consortium' chromosome, complete genome	2933811	1942542	2018172	2933811	tRNA,transposase,integrase	Bacillus_phage(23.08%)	59	2014855:2014886	2018237:2018268
WP_126605549.1|1942542_1944180_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.4	6.4e-103
WP_012536650.1|1944229_1944577_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_151528173.1|1944567_1944900_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_151528174.1|1945306_1946092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151528175.1|1946105_1946606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151528176.1|1947368_1948493_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_151528426.1|1948903_1950682_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_151528177.1|1950823_1951588_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_151528178.1|1951709_1953047_+	cardiolipin synthase B	NA	NA	NA	NA	NA
WP_151528179.1|1953614_1954058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528180.1|1954234_1955158_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151528427.1|1955640_1956168_+	NADH-quinone oxidoreductase subunit F	NA	NA	NA	NA	NA
WP_151528181.1|1956352_1956802_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_151528182.1|1956798_1957035_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_151528183.1|1957087_1957720_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F2H8	Mycobacterium_phage	29.1	3.1e-05
WP_151528184.1|1957985_1959320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528185.1|1959430_1959874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528186.1|1961224_1961461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528187.1|1961550_1966119_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_151528188.1|1966858_1967845_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.8	3.4e-67
WP_151528189.1|1967883_1970169_+	UDP-forming cellulose synthase catalytic subunit	NA	A0A1V0S9E5	Catovirus	26.2	2.3e-05
WP_151528190.1|1970195_1972277_+	cellulose synthase	NA	NA	NA	NA	NA
WP_151528191.1|1972273_1975120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528192.1|1975149_1976400_+	cellulase	NA	NA	NA	NA	NA
WP_151528193.1|1976444_1977791_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	3.7e-16
WP_151528194.1|1977787_1978111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528195.1|1978161_1978557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151528196.1|1978978_1979761_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_151528197.1|1979991_1980309_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	36.7	4.1e-06
WP_054608893.1|1982009_1982246_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_126605660.1|1982245_1982635_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_126604279.1|1982824_1986679_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	50.5	2.6e-99
WP_113526534.1|1986749_1987472_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.5	7.3e-43
WP_126604280.1|1987468_1988776_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.6	5.4e-20
WP_126604281.1|1988772_1989906_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_113526531.1|1989943_1990819_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_126604282.1|1991091_1991745_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_113526530.1|1991818_1993147_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	41.9	3.0e-10
WP_113526529.1|1993231_1993666_-	thioredoxin TrxC	NA	V5L6J2	Insectomime_virus	37.5	1.5e-14
WP_113526618.1|1993696_1993981_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	40.8	2.3e-08
WP_113526528.1|1993980_1994406_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_113526527.1|1994409_1994631_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_126604283.1|1994637_1997913_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_126604284.1|1997905_1998988_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_113526524.1|1998984_2000406_-	TolC family protein	NA	NA	NA	NA	NA
WP_012537155.1|2000654_2000957_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_126604285.1|2001256_2002729_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_113526522.1|2002753_2003626_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_113526521.1|2003638_2004031_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_113526520.1|2004141_2004888_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_113526519.1|2004887_2005703_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_113526617.1|2005835_2007065_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_126604286.1|2007054_2008242_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_113526517.1|2008253_2008517_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_151528198.1|2008520_2009411_+	ATPase	NA	NA	NA	NA	NA
WP_012537166.1|2009482_2011327_+	hypothetical protein	NA	NA	NA	NA	NA
2014855:2014886	attL	ATACCATTATGTGGCGCTTTAAAATATGTGGC	NA	NA	NA	NA
WP_012535982.1|2014998_2016243_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012535983.1|2016239_2017181_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009561339.1|2017173_2018172_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.5	1.5e-17
2018237:2018268	attR	GCCACATATTTTAAAGCGCCACATAATGGTAT	NA	NA	NA	NA
