The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	99391	121102	5095110	holin,integrase	Morganella_phage(28.57%)	30	91433:91447	125311:125325
91433:91447	attL	CAGCGCGATAATCAG	NA	NA	NA	NA
WP_003024042.1|99391_100015_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_119174739.1|100276_101956_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.9	3.7e-21
WP_003024049.1|101952_102570_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_128295808.1|102959_103784_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	86.2	2.2e-104
WP_128295807.1|103918_104278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295806.1|104710_104902_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	62.1	3.4e-16
WP_128295805.1|104907_105093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295814.1|105258_106380_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	61.9	6.2e-134
WP_061066853.1|106719_106971_-	excisionase family protein	NA	S4TND0	Salmonella_phage	55.1	9.0e-17
WP_128295813.1|107049_107217_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTG1	Proteus_phage	63.0	6.2e-14
WP_128295804.1|107775_108237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295803.1|108293_110087_-	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	29.0	1.6e-46
WP_128295802.1|110083_110266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295812.1|110583_110799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295801.1|110928_111228_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_128295800.1|111567_114381_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.7	2.3e-294
WP_128295799.1|114373_114718_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.7	4.7e-32
WP_128295798.1|114729_115293_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	29.4	9.4e-14
WP_128295797.1|115289_115511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295796.1|115507_115771_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
WP_128295795.1|115767_115968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079938915.1|115964_116159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295811.1|116140_116371_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_128295810.1|116522_116705_+	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_079938916.1|117132_117312_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_128295794.1|117304_118135_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	49.6	1.9e-23
WP_128295793.1|118148_118583_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.9	6.1e-29
WP_049014569.1|118582_118801_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_128295792.1|118892_119831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295809.1|119827_121102_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	5.5e-195
125311:125325	attR	CAGCGCGATAATCAG	NA	NA	NA	NA
>prophage 2
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	688513	701522	5095110	tail,protease,integrase	uncultured_Caudovirales_phage(33.33%)	16	688287:688334	698785:698832
688287:688334	attL	TTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_128295651.1|688513_689938_+|integrase	integrase family protein	integrase	H7BV31	unidentified_phage	25.9	1.5e-07
WP_128295652.1|689927_690527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094137785.1|690636_690858_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003846253.1|691175_691367_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003846255.1|691500_691770_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	84.3	9.0e-39
WP_128295653.1|691762_691951_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	74.5	8.5e-12
WP_128295654.1|691943_692258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846262.1|692254_692623_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	83.6	8.8e-53
WP_128295655.1|692619_694440_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.8	2.3e-130
WP_128295656.1|695125_695320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295657.1|695316_697230_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	57.9	1.5e-215
WP_128295658.1|697376_697634_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	44.8	5.6e-06
WP_128295659.1|697620_698214_+|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	68.4	5.5e-65
WP_128295660.1|698329_698662_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_048218614.1|698987_699494_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
698785:698832	attR	TTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_016151004.1|699524_701522_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
>prophage 3
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	1802968	1811387	5095110	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_119174400.1|1802968_1803916_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.4e-22
WP_119174399.1|1803899_1804631_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1804611_1804719_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|1804770_1805502_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_003027348.1|1805727_1807413_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|1807409_1808129_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|1808175_1808646_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840158.1|1808688_1809147_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
WP_003027344.1|1809353_1811387_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 4
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	1864021	1873599	5095110	protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003840216.1|1864021_1865968_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_003036813.1|1866042_1866267_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1866590_1866911_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1866941_1869218_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003844346.1|1869487_1870849_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003036800.1|1871008_1871341_-	YegP family protein	NA	NA	NA	NA	NA
WP_128295744.1|1871476_1872199_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	6.0e-29
WP_003841761.1|1872195_1873599_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
>prophage 5
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	1915449	1921747	5095110		Enterobacteria_phage(66.67%)	6	NA	NA
WP_119174378.1|1915449_1916844_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	4.7e-22
WP_049002535.1|1917009_1917903_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.1	7.4e-45
WP_119174377.1|1918276_1919362_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.5e-100
WP_048218080.1|1919361_1920261_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	3.6e-31
WP_049002538.1|1920312_1921191_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
WP_119174376.1|1921192_1921747_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.1	7.8e-53
>prophage 6
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	2085327	2219094	5095110	tail,head,capsid,transposase,holin,portal,protease,tRNA,terminase,integrase	Salmonella_phage(28.44%)	167	2167961:2167988	2218274:2218301
WP_003034673.1|2085327_2087061_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|2087299_2087866_+	VOC family protein	NA	NA	NA	NA	NA
WP_032936856.1|2087868_2088615_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003839177.1|2088858_2089827_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|2089823_2090567_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|2090607_2091003_-	membrane protein	NA	NA	NA	NA	NA
WP_128295824.1|2091055_2091820_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.2e-56
WP_151532582.1|2091807_2093121_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.7	2.5e-235
WP_047500088.1|2093176_2093413_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	96.2	1.9e-40
WP_151532583.1|2093568_2094018_-	ATPase	NA	A0A1B5FPC7	Escherichia_phage	79.2	2.5e-25
WP_151532584.1|2094014_2094227_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	70.0	6.6e-21
WP_032652477.1|2094223_2094448_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	6.1e-17
WP_151532585.1|2094566_2095145_-	hypothetical protein	NA	A0A2I7QNC9	Vibrio_phage	28.5	1.4e-07
WP_151532586.1|2095155_2095734_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	58.3	4.7e-61
WP_151532587.1|2095730_2096138_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.8	5.5e-24
WP_151532588.1|2096307_2096502_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	79.7	1.7e-23
WP_088902161.1|2096559_2096916_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	48.7	1.6e-22
WP_088902162.1|2097015_2097306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050484865.1|2097367_2097613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902163.1|2097941_2098619_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	76.3	4.3e-98
WP_088902164.1|2098762_2099023_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	56.4	2.9e-18
WP_151532589.1|2100789_2101671_+	cell division protein ZapE	NA	Q8W641	Enterobacteria_phage	62.0	2.0e-79
WP_151532590.1|2101667_2103026_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	68.7	2.0e-174
WP_151532591.1|2103036_2103348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532592.1|2103429_2103777_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	8.8e-55
WP_151532593.1|2103789_2104176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532594.1|2104176_2104422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|2105299_2106508_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_008323296.1|2107459_2107855_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_008323297.1|2107841_2108123_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	88.2	4.2e-39
WP_151532595.1|2108122_2108740_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	79.9	4.2e-92
WP_151532596.1|2108736_2109276_+	DUF2514 family protein	NA	A0A0A0P0G7	Enterobacteria_phage	52.9	8.7e-09
WP_151532597.1|2109400_2110129_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	86.8	3.3e-112
WP_151532598.1|2110143_2110377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532599.1|2110364_2110715_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	7.8e-51
WP_151532600.1|2110871_2111345_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.2	1.7e-77
WP_151532601.1|2111344_2113102_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.8	0.0e+00
WP_038642109.1|2113249_2114476_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	9.0e-211
WP_085048946.1|2114468_2115068_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	7.8e-91
WP_151532602.1|2115077_2116295_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.1	1.7e-169
WP_038642103.1|2116372_2116693_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	2.8e-23
WP_038642100.1|2116702_2117041_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	2.3e-39
WP_149692066.1|2117037_2117487_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.2	1.4e-65
WP_065944737.1|2117483_2117831_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	76.5	1.7e-45
WP_151532603.1|2117888_2118593_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.5	3.7e-92
WP_151532604.1|2118620_2119010_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	84.5	1.2e-57
WP_016150477.1|2119018_2119297_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	93.5	2.6e-41
WP_151532605.1|2119300_2119642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532606.1|2119700_2123198_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	83.7	0.0e+00
WP_016150474.1|2123239_2123599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003841703.1|2123587_2123812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532607.1|2123977_2124571_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.4	5.3e-108
WP_151532608.1|2124570_2125155_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	2.7e-104
WP_151532609.1|2125161_2125560_+	hypothetical protein	NA	S4TR39	Salmonella_phage	90.9	8.0e-68
WP_151532610.1|2125559_2128271_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	90.5	0.0e+00
WP_151532611.1|2128270_2129215_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	3.7e-119
WP_151532612.1|2129224_2130550_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	1.5e-115
WP_151532613.1|2130685_2130928_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	75.3	2.9e-28
WP_151532614.1|2131248_2131638_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	70.5	3.3e-50
WP_151532615.1|2131638_2132307_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.6e-79
WP_101700564.1|2132431_2132548_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_003841685.1|2132629_2133196_-	hydrolase	NA	NA	NA	NA	NA
WP_100038939.1|2133152_2133389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034862.1|2133462_2135235_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003844155.1|2135236_2135680_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|2135708_2136452_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|2136486_2137008_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|2137088_2137700_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|2137708_2138719_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|2138797_2139583_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_046671223.1|2139579_2140335_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	5.0e-18
WP_003844151.1|2140413_2141358_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_151532616.1|2141373_2142693_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003841672.1|2142812_2143784_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034890.1|2143827_2145270_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003034893.1|2145388_2146258_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034896.1|2146625_2148101_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_119174331.1|2148334_2150146_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034901.1|2150180_2150822_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_071684720.1|2150889_2152068_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034906.1|2152199_2152490_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_003034909.1|2152611_2152965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049016040.1|2153059_2153719_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_119174330.1|2153781_2155860_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_003833802.1|2155850_2156513_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_003841657.1|2156536_2157193_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|2157299_2157530_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_151532617.1|2157678_2159430_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	5.5e-44
WP_151532618.1|2159850_2160570_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_016151033.1|2160884_2161463_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	3.2e-17
WP_151532619.1|2161707_2163459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532620.1|2164019_2164406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137397182.1|2164568_2164922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115454751.1|2165215_2165461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115454752.1|2165651_2165861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034928.1|2166117_2166492_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_032935389.1|2166495_2167368_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034934.1|2167388_2167727_+	YebY family protein	NA	NA	NA	NA	NA
2167961:2167988	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_001129310.1|2168063_2169149_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	1.1e-148
WP_151532621.1|2169117_2169390_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	3.2e-28
WP_001237028.1|2169453_2169696_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	91.1	1.0e-33
WP_151532622.1|2169682_2170390_-	hypothetical protein	NA	R9VWB9	Serratia_phage	60.7	1.9e-72
WP_151532623.1|2170382_2170727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532624.1|2170761_2171847_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.7	3.9e-125
WP_151532625.1|2171858_2174711_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	61.6	6.8e-302
WP_151532626.1|2175019_2175217_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097728169.1|2175216_2175417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137398754.1|2175841_2176066_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	6.1e-17
WP_151532627.1|2176097_2176478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532686.1|2176561_2176834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532628.1|2176955_2177366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532687.1|2177496_2178219_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	55.1	1.7e-71
WP_016156713.1|2178287_2178515_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	53.5	1.2e-15
WP_151532629.1|2178545_2179085_+	regulator	NA	K7PJT7	Enterobacteria_phage	87.2	7.7e-82
WP_151532630.1|2179214_2180216_+	replication protein	NA	A5VW95	Enterobacteria_phage	71.7	1.7e-53
WP_151532631.1|2180212_2180908_+	phage replication protein	NA	G8C7U6	Escherichia_phage	47.0	2.5e-56
WP_151532632.1|2180922_2181234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528489.1|2181844_2182057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528488.1|2182053_2182377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528487.1|2182380_2182656_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	87.1	1.8e-34
WP_151532633.1|2182652_2183309_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	44.7	9.9e-23
WP_019076919.1|2183743_2184343_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	96.5	8.5e-106
WP_071684428.1|2184342_2184549_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	8.1e-24
WP_119174318.1|2184551_2185139_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	63.4	9.1e-60
WP_000142505.1|2185135_2185273_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	86.0	2.7e-15
WP_119174317.1|2185269_2185959_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.1	9.9e-66
WP_119174316.1|2186597_2187038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119174315.1|2187246_2187435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568784.1|2187589_2187868_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_151532634.1|2187839_2188388_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	92.9	3.0e-97
WP_151532635.1|2188384_2188921_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	59.1	1.4e-11
WP_071684699.1|2188921_2189134_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_151532636.1|2189709_2190348_+	hypothetical protein	NA	I6S676	Salmonella_phage	91.0	1.5e-113
WP_023300389.1|2190379_2190835_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.0	1.4e-63
WP_125363636.1|2190831_2192085_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.7	3.4e-213
WP_125363635.1|2192217_2193570_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	92.4	3.4e-243
WP_125363634.1|2193523_2194453_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	82.5	5.9e-138
WP_151532637.1|2194456_2195722_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	86.0	1.8e-206
WP_063933408.1|2195734_2196190_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	82.8	2.3e-63
WP_151532638.1|2196204_2197302_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	83.3	1.4e-178
WP_151532639.1|2197311_2197608_+	hypothetical protein	NA	G0ZNE0	Cronobacter_phage	70.4	9.6e-34
WP_054829867.1|2197667_2198069_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	92.5	4.0e-67
WP_151532640.1|2198242_2198479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125363628.1|2198482_2198845_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	90.8	2.7e-62
WP_151532641.1|2198932_2199370_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	95.9	6.3e-74
WP_151532642.1|2199366_2199753_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	91.4	2.0e-63
WP_151532643.1|2199770_2200508_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	87.8	1.8e-118
WP_151532644.1|2200547_2201201_+	hypothetical protein	NA	A0A1V0E5Q0	Salmonella_phage	93.1	3.5e-113
WP_151532645.1|2201384_2201915_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	95.5	6.4e-89
WP_042889549.1|2202028_2202403_+	hypothetical protein	NA	H6WRV1	Salmonella_phage	98.4	9.2e-66
WP_045332252.1|2202395_2202698_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	98.0	1.1e-40
WP_151532646.1|2202768_2203410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532688.1|2203469_2206793_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	74.6	0.0e+00
WP_042889552.1|2206795_2207143_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	91.3	1.5e-57
WP_125363623.1|2207152_2207443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532647.1|2207396_2207633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125363622.1|2207800_2208505_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.0	2.3e-134
WP_151532648.1|2208504_2209224_+|tail	phage tail protein	tail	Q5G8W2	Enterobacteria_phage	85.4	2.1e-127
WP_071697834.1|2209166_2209694_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	68.4	6.4e-57
WP_151532649.1|2209703_2212880_+	DUF1983 domain-containing protein	NA	H6WRW4	Salmonella_phage	91.0	0.0e+00
WP_151532650.1|2212879_2213824_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.4	2.5e-120
WP_151532651.1|2213833_2215159_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	5.9e-115
WP_000497432.1|2215294_2215537_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_008784491.1|2215614_2216034_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	6.1e-34
WP_054528461.1|2216035_2217304_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.0	2.1e-202
WP_151532652.1|2217296_2217968_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_128295755.1|2218452_2219094_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	3.9e-56
2218274:2218301	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 7
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	2861827	2871865	5095110	tRNA	Cedratvirus(14.29%)	10	NA	NA
WP_003836641.1|2861827_2862607_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
WP_032935936.1|2862603_2864046_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003836643.1|2864107_2864821_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|2865137_2865602_-	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003836645.1|2865679_2866429_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
WP_003030569.1|2866428_2866980_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_119174168.1|2867040_2868021_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	5.1e-15
WP_003030571.1|2868174_2868474_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|2868478_2870866_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2870881_2871865_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 8
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	2969913	2977337	5095110	transposase	uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_001339197.1|2969913_2971122_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_119174150.1|2971389_2971602_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	6.0e-22
WP_003030760.1|2971845_2972271_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_119174149.1|2972283_2973573_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.7	4.6e-165
WP_003030762.1|2973617_2973938_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_008320415.1|2974023_2974722_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_003840850.1|2975109_2975352_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|2975441_2975951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003030769.1|2976086_2977337_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 9
NZ_CP042478	Citrobacter freundii strain C50 chromosome, complete genome	5095110	5049000	5078690	5095110	tRNA,transposase,integrase	Virus_Rctr41k(22.22%)	27	5067597:5067612	5083615:5083630
WP_003023784.1|5049000_5050890_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003023788.1|5050991_5051615_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003023790.1|5052229_5052610_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_003023792.1|5052617_5053433_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003023794.1|5053479_5053719_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003023796.1|5053778_5054249_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003023799.1|5054263_5054797_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003023802.1|5054809_5056351_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003023804.1|5056401_5057265_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003023806.1|5057291_5058674_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_151532682.1|5058694_5059114_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003023811.1|5059762_5061133_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.6	2.1e-35
WP_003023813.1|5061357_5063187_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	1.1e-122
WP_001029679.1|5063346_5064168_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|5064154_5066263_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|5066259_5067927_+	AAA family ATPase	NA	NA	NA	NA	NA
5067597:5067612	attL	GCTGAAAGAGGATTAC	NA	NA	NA	NA
WP_096755719.1|5069269_5070416_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.9e-146
WP_072033343.1|5071373_5072111_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.6	3.7e-26
WP_043016701.1|5072127_5073672_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.0	4.4e-130
WP_001334979.1|5074081_5074405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|5074437_5074809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|5074869_5075367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|5075442_5076231_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|5076288_5076813_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|5076907_5077381_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|5077712_5078249_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|5078363_5078690_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
5083615:5083630	attR	GCTGAAAGAGGATTAC	NA	NA	NA	NA
>prophage 1
NZ_CP042480	Citrobacter freundii strain C50 plasmid pC50_002, complete sequence	176400	5791	58098	176400	integrase,transposase	Escherichia_phage(43.75%)	48	23500:23559	39015:39215
WP_012817690.1|5791_8800_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_071787999.1|8905_9184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|9404_9734_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|9714_9996_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|10273_11254_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_022652299.1|11576_12185_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151532707.1|12561_14373_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	79.7	7.3e-302
WP_022652297.1|14369_15743_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_022652296.1|15791_17057_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_022652295.1|17358_18543_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_022652294.1|18649_20119_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	6.9e-48
WP_022652293.1|20138_21569_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_032430963.1|21786_22575_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001067834.1|22722_23427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|23460_23733_-	hypothetical protein	NA	NA	NA	NA	NA
23500:23559	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
WP_000845039.1|23701_24715_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|24867_25608_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|25839_26172_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|26298_26853_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|26947_27580_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000846390.1|27648_28449_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001206316.1|28465_29257_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_020956917.1|29745_30645_+	class A extended-spectrum beta-lactamase VEB-3	NA	NA	NA	NA	NA
WP_151532708.1|31650_32136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039272567.1|35330_38363_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039272634.1|38359_38953_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
WP_120783633.1|38987_39248_-|transposase	transposase	transposase	NA	NA	NA	NA
39015:39215	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
WP_063840321.1|40304_40859_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|40989_41820_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|41957_42590_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|42674_43127_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|43349_43697_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|43690_44530_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|44459_44639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|44657_44861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|45016_46222_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|46232_46538_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|46553_46736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|46764_47529_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|47719_48076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|48021_48606_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|48605_49844_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|49840_50746_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|50867_51572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|51804_52665_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|53033_53738_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000215515.1|56634_56991_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067848.1|57393_58098_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP042480	Citrobacter freundii strain C50 plasmid pC50_002, complete sequence	176400	69400	126164	176400	integrase,transposase	Escherichia_phage(20.0%)	50	102809:102824	127949:127964
WP_001395480.1|69400_70432_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001118618.1|71253_72177_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_022652268.1|74918_75902_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	1.3e-47
WP_001166628.1|75995_76451_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|76522_76918_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|76933_77209_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|77236_77662_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|77700_79386_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|79403_79769_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_022652270.1|79765_80002_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|79985_80105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|80067_80280_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|80479_81184_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|81510_82011_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_087893729.1|82084_83357_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_016947617.1|83663_84644_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|84921_85203_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|85183_85513_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_022652300.1|85931_86885_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004393990.1|87072_87681_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652304.1|87677_88829_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_022652303.1|88825_90031_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652302.1|90032_90743_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652300.1|91363_92317_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032645789.1|92571_92757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050483874.1|92907_93417_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021314637.1|94588_94819_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_022652307.1|95096_95300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032430841.1|95381_96209_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652309.1|96226_97705_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430957.1|98211_99234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059331197.1|99991_100135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652310.1|100309_101050_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022652311.1|101375_102365_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
102809:102824	attL	TACCTGCTCCTGCCAG	NA	NA	NA	NA
WP_022652312.1|103220_103490_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652313.1|103493_104024_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077873527.1|104155_105049_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
WP_072033343.1|105581_106319_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.1	2.9e-55
WP_043016701.1|106335_107880_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.0	4.4e-130
WP_022652315.1|108792_109944_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001201739.1|110052_110436_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|110432_110780_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|110829_112365_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_032430835.1|112421_113780_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
WP_022652317.1|114605_115772_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_022652318.1|115771_116737_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652236.1|118765_120904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652237.1|121207_122641_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_022652238.1|122674_123889_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_022652239.1|124037_126164_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
127949:127964	attR	TACCTGCTCCTGCCAG	NA	NA	NA	NA
