The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	1524122	1534160	4964300	protease	Vibrio_phage(33.33%)	7	NA	NA
WP_023332529.1|1524122_1526063_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.9e-37
WP_008499993.1|1526133_1526355_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_006174393.1|1526622_1526943_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
WP_014831269.1|1526970_1529250_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.4e-164
WP_045307508.1|1529680_1530124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023337010.1|1531083_1532067_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	35.9	4.7e-45
WP_080297787.1|1532063_1534160_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.2	1.1e-51
>prophage 2
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	1582412	1674562	4964300	capsid,protease,tRNA,tail,terminase,portal,holin,head	Enterobacteria_phage(30.19%)	96	NA	NA
WP_014883226.1|1582412_1583192_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_014883227.1|1583195_1584518_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_008499954.1|1584498_1585203_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_014883228.1|1585202_1589654_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_014883229.1|1589832_1591656_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_078310576.1|1591822_1592383_+	YcbK family protein	NA	NA	NA	NA	NA
WP_014883231.1|1592403_1593051_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014883232.1|1593103_1594294_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_072093609.1|1594478_1595582_-	porin	NA	Q1MVN1	Enterobacteria_phage	52.5	1.4e-98
WP_014883234.1|1596192_1597593_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	1.4e-79
WP_014883235.1|1597758_1598961_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	2.9e-44
WP_151571563.1|1599145_1600438_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	93.7	2.0e-237
WP_013097283.1|1600482_1600740_-	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
WP_151571564.1|1600723_1601110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045285663.1|1601097_1601841_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.3	8.6e-132
WP_126786655.1|1601852_1602431_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	68.2	1.3e-74
WP_047363364.1|1602430_1602844_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	65.4	4.0e-46
WP_072159686.1|1602840_1603062_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
WP_151571565.1|1603033_1603444_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.4	1.2e-47
WP_016240231.1|1603424_1603628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635104.1|1603764_1604424_-	AP2 domain-containing protein	NA	L0AQZ0	Klebsiella_phage	44.0	2.4e-45
WP_032665917.1|1604914_1605127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635107.1|1605317_1606007_-	helix-turn-helix domain-containing protein	NA	K7PK07	Enterobacteria_phage	64.8	4.6e-71
WP_001064664.1|1606118_1606346_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032635108.1|1606371_1606668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058671039.1|1606664_1607576_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	62.6	1.8e-91
WP_017384391.1|1607591_1608473_+	ATPase AAA	NA	Q8W641	Enterobacteria_phage	64.1	6.7e-83
WP_151571566.1|1608469_1609849_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	68.4	1.1e-175
WP_126293354.1|1609876_1610659_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	7.2e-113
WP_015570940.1|1610953_1611439_+	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
WP_015570939.1|1611623_1612049_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
WP_017384388.1|1612045_1612201_+	DUF3927 domain-containing protein	NA	S4TRP5	Salmonella_phage	68.8	5.0e-10
WP_017384387.1|1612929_1613319_+	membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_017384386.1|1613308_1613587_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.7e-37
WP_126293352.1|1613586_1614216_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	3.2e-103
WP_042863378.1|1614223_1614499_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.8	1.9e-12
WP_052215449.1|1614683_1615289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032665382.1|1615346_1616804_+	glycosyl transferase	NA	S4TSQ9	Salmonella_phage	89.9	1.8e-266
WP_023296835.1|1616815_1617151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296834.1|1617104_1617362_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	96.3	9.2e-33
WP_058661917.1|1617527_1618118_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	81.1	1.3e-95
WP_032682360.1|1618117_1618468_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	9.2e-52
WP_022650844.1|1618625_1619099_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	2.3e-85
WP_016063095.1|1619098_1620835_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
WP_049108598.1|1620834_1622130_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.5e-232
WP_049108597.1|1622152_1623001_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	1.6e-137
WP_032622508.1|1623010_1624222_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	8.9e-195
WP_151571567.1|1624264_1624591_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	79.6	5.4e-46
WP_022648888.1|1624599_1624938_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022648887.1|1624934_1625384_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_022648886.1|1625380_1625728_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_006809155.1|1625787_1626231_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_045324981.1|1626239_1626623_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	3.3e-63
WP_006809154.1|1626631_1626910_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
WP_032665364.1|1626965_1627301_+	membrane protein	NA	S4TR42	Salmonella_phage	93.7	4.0e-52
WP_151571568.1|1627348_1630840_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.2	0.0e+00
WP_023330760.1|1630842_1631181_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	58.9	1.2e-37
WP_045350814.1|1631177_1631936_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_023296258.1|1631938_1632649_+	NlpC/P60 family protein	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_049108984.1|1632648_1633233_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	1.1e-54
WP_088466242.1|1638107_1638686_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	55.1	1.4e-33
WP_069602022.1|1638816_1639083_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.8e-39
WP_014883236.1|1639507_1642120_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	1.2e-18
WP_014883237.1|1642222_1642993_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	6.4e-29
WP_014883238.1|1642989_1643781_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_014883239.1|1643790_1644936_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_014883240.1|1644932_1645895_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014883241.1|1645887_1646463_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_014883242.1|1646712_1647723_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014883243.1|1647888_1648431_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_014883244.1|1648427_1649537_-	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	39.1	4.1e-05
WP_023332608.1|1649635_1651744_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_014883246.1|1651756_1653664_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	6.2e-49
WP_014883247.1|1653677_1654931_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_014883248.1|1654935_1656576_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_014883249.1|1656572_1657139_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|1657395_1657563_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227926.1|1657634_1658153_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_014883250.1|1658221_1659982_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_023332611.1|1660168_1660621_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_014883252.1|1660685_1661741_-	porin OmpA	NA	NA	NA	NA	NA
WP_014883253.1|1662096_1662606_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_014883254.1|1662823_1663450_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_014883255.1|1663406_1665569_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_014883256.1|1665588_1666035_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_014883257.1|1666158_1668213_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.1e-18
WP_008499922.1|1668271_1668730_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_014883258.1|1668810_1669473_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_014883259.1|1669646_1670060_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_008499919.1|1670096_1670414_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_014883260.1|1670474_1671665_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_014883261.1|1671839_1672397_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_014883262.1|1672407_1673196_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014883263.1|1673207_1673489_+	acylphosphatase	NA	NA	NA	NA	NA
WP_014883264.1|1673485_1673815_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_014883265.1|1673902_1674562_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 3
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	2453602	2475084	4964300	transposase,integrase,tail	Enterobacteria_phage(50.0%)	20	2447022:2447036	2459804:2459818
2447022:2447036	attL	TTCTCGGCCAAACAT	NA	NA	NA	NA
WP_139125921.1|2453602_2453767_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_038421140.1|2454055_2454733_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	8.5e-78
WP_038421139.1|2454797_2456543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038421138.1|2459251_2459878_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.9	2.7e-54
2459804:2459818	attR	TTCTCGGCCAAACAT	NA	NA	NA	NA
WP_050511272.1|2459984_2460500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032643326.1|2460573_2461302_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	84.3	3.1e-126
WP_146051933.1|2461303_2463139_-|tail	phage tail tape measure protein	tail	A0A0A7NV08	Shigella_phage	33.8	4.4e-68
WP_151571579.1|2463243_2463495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074162859.1|2463569_2464022_-	hypothetical protein	NA	M9NZI9	Enterobacteria_phage	95.2	2.3e-26
WP_063409976.1|2464740_2465574_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	79.4	5.1e-125
WP_025913038.1|2465935_2466142_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	78.8	3.5e-27
WP_063409977.1|2466141_2466744_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	83.5	4.7e-96
WP_074162861.1|2466783_2467026_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	69.1	7.3e-24
WP_151571678.1|2467132_2467204_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_085949497.1|2467204_2468352_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_151571580.1|2468412_2468589_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	66.7	7.7e-15
WP_087451024.1|2468959_2470079_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_151571581.1|2470072_2470945_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_080297785.1|2470960_2472400_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000227969.1|2474007_2475084_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	2480925	2487854	4964300	integrase,tRNA	Escherichia_phage(50.0%)	9	2470420:2470433	2496825:2496838
2470420:2470433	attL	TGTTATGCTTTAAG	NA	NA	NA	NA
WP_020882485.1|2480925_2481168_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_014884030.1|2481232_2481445_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_038421132.1|2481446_2482685_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.5	4.6e-170
WP_014884032.1|2482734_2483670_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	4.0e-142
WP_014884033.1|2483712_2485086_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	6.2e-51
WP_000025608.1|2485113_2485296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337353.1|2485435_2485633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884034.1|2485571_2486555_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023338360.1|2486711_2487854_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.7e-09
2496825:2496838	attR	CTTAAAGCATAACA	NA	NA	NA	NA
>prophage 5
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	2554051	2613788	4964300	capsid,integrase,protease,lysis,tail,plate,head,terminase,holin,portal	Erwinia_phage(27.5%)	72	2597298:2597316	2616114:2616132
WP_014884092.1|2554051_2555098_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	2.8e-19
WP_014884093.1|2555349_2556111_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	1.8e-07
WP_023337380.1|2556107_2556698_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014884095.1|2556733_2557612_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|2557708_2558329_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_032645259.1|2558325_2559207_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|2559346_2559391_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_023330555.1|2559487_2561050_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_047028333.1|2561049_2562645_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	2.5e-51
WP_023337383.1|2562648_2564007_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	5.6e-36
WP_014884100.1|2564017_2565211_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_014884101.1|2565210_2566020_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_014884102.1|2566286_2567543_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014884103.1|2567698_2567911_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	8.4e-24
WP_032629007.1|2568402_2569008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884106.1|2569071_2569731_-	DsbA family protein	NA	NA	NA	NA	NA
WP_047028334.1|2569860_2570340_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014884108.1|2570480_2571302_+	alpha/beta hydrolase	NA	A0A1D8EW21	Mycobacterium_phage	25.3	3.7e-11
WP_014884109.1|2571378_2572146_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023337386.1|2572402_2573422_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038421128.1|2573521_2574301_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023337388.1|2574538_2575087_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023337389.1|2575264_2576476_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_014884113.1|2576472_2576706_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_014884114.1|2576831_2577170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884115.1|2577216_2577849_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_014884116.1|2578130_2578535_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014884117.1|2578560_2579304_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_014884118.1|2579361_2579901_+	septation protein A	NA	NA	NA	NA	NA
WP_008502796.1|2580005_2580401_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_014884119.1|2580437_2581166_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_023330569.1|2581388_2581685_+	YciI family protein	NA	NA	NA	NA	NA
WP_032609363.1|2581830_2582307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609364.1|2582363_2583254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609365.1|2583370_2583592_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	69.9	6.0e-25
WP_032609366.1|2583668_2584838_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	76.9	4.0e-160
WP_032609367.1|2584834_2585299_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	4.2e-60
WP_038421127.1|2585311_2587759_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.4	2.5e-284
WP_032609370.1|2587748_2587871_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	1.0e-13
WP_032609371.1|2587903_2588206_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_038421126.1|2588262_2588781_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.1	9.4e-77
WP_032609374.1|2588793_2589987_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	8.3e-185
WP_038421125.1|2590361_2590877_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	36.3	4.9e-17
WP_032609378.1|2592732_2593263_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.5e-90
WP_032609381.1|2593255_2594164_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	83.1	3.2e-136
WP_023338715.1|2594169_2594520_-	hypothetical protein	NA	A0A0M4RE59	Salmonella_phage	69.8	1.5e-38
WP_032609382.1|2594516_2595158_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	83.1	1.6e-97
WP_032609384.1|2595289_2596021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609386.1|2596090_2596540_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.5	2.6e-51
WP_032609387.1|2596532_2597000_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	6.5e-61
WP_072163335.1|2596962_2597208_-|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
WP_151571582.1|2597095_2597521_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	70.6	2.0e-45
2597298:2597316	attL	CCGGCGGCCAGCAGTTCGC	NA	NA	NA	NA
WP_151571583.1|2597517_2598027_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	87.5	6.2e-81
WP_038421055.1|2598010_2598232_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	5.5e-26
WP_023209074.1|2598222_2598426_-|tail	phage tail X family protein	tail	A0A218M4L8	Erwinia_phage	80.6	1.1e-25
WP_038421056.1|2598425_2598932_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	1.3e-62
WP_038421057.1|2599031_2599787_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	68.1	2.3e-79
WP_048988391.1|2599790_2600858_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	7.9e-171
WP_038421059.1|2600913_2601768_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	69.4	4.9e-107
WP_038421060.1|2601935_2603705_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.4	5.5e-302
WP_151571584.1|2603706_2604732_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.2	1.6e-168
WP_032609405.1|2605059_2606259_+	ATP-binding protein	NA	A0A0P0IKU8	Acinetobacter_phage	32.6	3.4e-53
WP_032609407.1|2606261_2606780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609409.1|2607461_2608016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609411.1|2608163_2608448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609413.1|2608444_2610742_-	replication endonuclease	NA	Q858T4	Yersinia_virus	75.5	0.0e+00
WP_014884151.1|2610743_2611007_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	57.0	2.0e-22
WP_014884152.1|2611029_2611248_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
WP_047028327.1|2611314_2611815_-	hypothetical protein	NA	M1SV55	Escherichia_phage	75.3	8.2e-70
WP_014884154.1|2611981_2612257_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	6.8e-42
WP_014884155.1|2612381_2612681_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.9e-38
WP_014884156.1|2612777_2613788_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.1	1.2e-147
2616114:2616132	attR	GCGAACTGCTGGCCGCCGG	NA	NA	NA	NA
>prophage 6
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	2779862	2842579	4964300	integrase,protease,coat,tail,terminase,head,holin	Cronobacter_phage(25.81%)	86	2792118:2792147	2840368:2840397
WP_014884290.1|2779862_2780744_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_014884291.1|2780937_2782986_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.8	4.1e-83
WP_014884292.1|2783005_2783692_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_023337424.1|2783788_2784286_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023337425.1|2784418_2785702_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_014884295.1|2785670_2788304_+	PqiB family protein	NA	NA	NA	NA	NA
WP_032645266.1|2788381_2789824_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_008500472.1|2789930_2790170_+	YebV family protein	NA	NA	NA	NA	NA
WP_014884297.1|2790204_2790849_-	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	48.6	2.8e-54
WP_014884298.1|2791016_2791958_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2792118:2792147	attL	AGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_047028469.1|2792428_2792818_-	DNA polymerase V	NA	G8C7R9	Escherichia_phage	91.5	8.1e-65
WP_032665674.1|2792931_2793294_+	GtrA family protein	NA	U5P0S6	Shigella_phage	80.0	8.4e-48
WP_047028468.1|2793290_2794223_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	4.2e-160
WP_072057199.1|2794232_2795735_+	hypothetical protein	NA	Q8LTG0	Salmonella_phage	27.9	7.3e-37
WP_047028466.1|2795779_2797984_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	60.6	1.9e-38
WP_047028465.1|2798041_2800519_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.5	0.0e+00
WP_047028476.1|2800505_2800871_-	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	89.1	2.3e-61
WP_047028464.1|2800894_2801362_-	HNH endonuclease	NA	S4TVL1	Salmonella_phage	41.1	1.0e-26
WP_016245413.1|2801460_2801931_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.7	3.5e-78
WP_047028463.1|2801930_2802434_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	86.8	3.1e-85
WP_047028462.1|2802433_2805370_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	41.2	1.5e-123
WP_052768262.1|2805442_2806015_-	HNH endonuclease	NA	A0A2I6PIF0	Escherichia_phage	35.1	2.3e-23
WP_047028461.1|2806112_2806787_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	47.1	1.2e-52
WP_047028460.1|2806844_2807588_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.9	1.3e-74
WP_032608745.1|2807649_2808033_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_047028459.1|2808029_2808470_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	52.6	1.2e-32
WP_032657172.1|2808531_2808819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028458.1|2808866_2809217_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	1.7e-37
WP_039079611.1|2809227_2809545_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	66.3	1.6e-31
WP_047028457.1|2809541_2809712_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	50.0	3.8e-11
WP_047028456.1|2809711_2810092_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	1.8e-29
WP_151571588.1|2810094_2810391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028454.1|2810423_2811479_-|coat	phage coat protein	coat	R9TMI8	Aeromonas_phage	53.2	8.3e-104
WP_023294167.1|2811475_2811937_-	hypothetical protein	NA	B1GS72	Salmonella_phage	51.7	3.4e-30
WP_047028453.1|2811936_2813295_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.9	1.5e-126
WP_047028452.1|2813362_2813635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028451.1|2813670_2814666_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	2.4e-113
WP_047028450.1|2814598_2816062_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.4	1.4e-149
WP_047028449.1|2816074_2817547_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.0e-248
WP_039025437.1|2817546_2818062_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	62.2	5.2e-51
WP_039025438.1|2818073_2818253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028448.1|2818227_2818446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028447.1|2818541_2818772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080959433.1|2818895_2819102_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	80.3	1.9e-20
WP_047028446.1|2819327_2819768_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	77.2	1.8e-57
WP_001514184.1|2819771_2820047_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|2820043_2820445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028445.1|2820865_2821555_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	1.4e-56
WP_126347860.1|2821551_2821668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028444.1|2821664_2821847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028443.1|2821843_2822455_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	69.8	1.3e-40
WP_047028442.1|2822447_2823116_-	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	93.7	1.5e-122
WP_047028441.1|2823112_2823283_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	89.3	3.4e-20
WP_047028440.1|2823282_2823720_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	76.4	9.7e-59
WP_023296421.1|2823966_2824206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028439.1|2824205_2824823_-	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	52.1	1.5e-28
WP_047028438.1|2824819_2825035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028436.1|2825525_2826101_-	hypothetical protein	NA	K7PHG5	Enterobacteria_phage	39.8	7.6e-11
WP_047028435.1|2826102_2826792_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	96.5	2.2e-126
WP_047028434.1|2826788_2827754_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	96.2	3.4e-72
WP_047028433.1|2827939_2828482_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	91.1	1.0e-86
WP_006176184.1|2828485_2828686_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	51.8	4.3e-06
WP_047028432.1|2828794_2829505_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	71.0	9.8e-93
WP_022651082.1|2829643_2830486_+	hypothetical protein	NA	F5A3D6	Riemerella_phage	42.7	1.0e-51
WP_025760147.1|2830620_2830977_+	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	90.7	7.7e-54
WP_047028431.1|2831031_2831406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571679.1|2832441_2832636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045342001.1|2832787_2832997_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	8.8e-34
WP_047028429.1|2833007_2833442_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	60.3	7.9e-45
WP_047028428.1|2833513_2833798_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	95.7	5.0e-48
WP_047028427.1|2833816_2834662_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	62.1	4.3e-71
WP_047028426.1|2834658_2835339_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	8.4e-126
WP_047028425.1|2835335_2835764_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	96.5	1.2e-72
WP_047028424.1|2835760_2835913_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_047028423.1|2835909_2836392_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.6	2.7e-70
WP_047028422.1|2836388_2837048_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	94.1	7.2e-122
WP_006809800.1|2837166_2837385_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	65.3	9.2e-18
WP_047028421.1|2837384_2837771_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	48.4	8.7e-27
WP_047028420.1|2837757_2838153_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	45.5	2.3e-27
WP_047028419.1|2838162_2838489_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	76.2	2.2e-39
WP_023330710.1|2838967_2839240_+	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	8.5e-29
WP_023330711.1|2839208_2840294_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.1	8.1e-147
WP_014884299.1|2840613_2840952_-	YebY family protein	NA	NA	NA	NA	NA
2840368:2840397	attR	AGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_014884300.1|2840968_2841838_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_014884301.1|2841839_2842211_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_013096102.1|2842348_2842579_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	9.1e-16
>prophage 7
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	3033004	3040432	4964300		Enterobacteria_phage(50.0%)	7	NA	NA
WP_014884474.1|3033004_3034009_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	1.7e-34
WP_014884475.1|3034060_3035227_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.0	2.0e-111
WP_014884476.1|3035481_3036888_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_014884477.1|3037023_3037572_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.4	4.1e-54
WP_014884478.1|3037582_3038479_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_014884479.1|3038485_3039352_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	4.1e-109
WP_014884480.1|3039367_3040432_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	1.1e-100
>prophage 8
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	3508560	3687501	4964300	capsid,integrase,lysis,tRNA,tail,plate,terminase,portal,head,holin,transposase	Salmonella_phage(27.21%)	224	3610537:3610552	3688415:3688430
WP_151571604.1|3508560_3509277_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	29.9	1.8e-22
WP_151571605.1|3509273_3510293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571606.1|3510292_3510568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571607.1|3510564_3511281_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.5	1.3e-28
WP_151571608.1|3511283_3513212_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	34.3	2.8e-17
WP_151571609.1|3513335_3513929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571610.1|3513931_3514369_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	37.5	4.6e-24
WP_151571611.1|3514372_3515767_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.2	3.3e-68
WP_151571612.1|3515771_3516713_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	38.3	7.7e-53
WP_151571613.1|3516696_3517131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571614.1|3517127_3517556_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	3.2e-22
WP_151571615.1|3517552_3518035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571616.1|3518102_3519134_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.2	7.4e-73
WP_151571617.1|3519150_3520011_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	42.0	1.6e-25
WP_151571618.1|3520026_3521640_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_151571619.1|3521652_3522477_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.3	6.8e-53
WP_151571620.1|3522473_3523895_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.7	3.1e-90
WP_103142407.1|3523906_3525238_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	8.4e-154
WP_151571621.1|3525239_3525980_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.6	1.4e-17
WP_045269919.1|3526036_3526294_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	94.1	4.7e-37
WP_151571622.1|3526290_3526788_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	96.4	2.2e-91
WP_151571623.1|3526949_3527204_-	peptidase	NA	Q8SBD8	Shigella_phage	67.9	2.5e-22
WP_151571624.1|3527091_3527481_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	51.6	2.2e-25
WP_151571625.1|3527477_3527969_-	glycoside hydrolase family protein	NA	A0A1V0E5Q7	Salmonella_phage	77.0	2.3e-72
WP_151571626.1|3527968_3528271_-	hypothetical protein	NA	O64361	Escherichia_phage	77.2	1.9e-37
WP_151571627.1|3528759_3529449_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	5.8e-58
WP_151571680.1|3529445_3529562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571628.1|3529770_3530412_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	92.5	1.7e-104
WP_151571629.1|3530404_3530575_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	85.7	5.9e-20
WP_032180568.1|3530574_3531012_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.9	2.6e-59
WP_023296421.1|3531258_3531498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571630.1|3531497_3532154_-	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	80.8	5.3e-24
WP_151571631.1|3532150_3532630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571632.1|3532712_3533063_-	hypothetical protein	NA	A0A096XUX1	Cronobacter_phage	40.8	2.2e-13
WP_151571633.1|3533046_3534420_-	AAA family ATPase	NA	E5AGF0	Erwinia_phage	62.4	5.4e-164
WP_151571634.1|3534416_3535502_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.6	1.8e-85
WP_151571635.1|3535741_3536284_-	regulator	NA	M9NZI6	Enterobacteria_phage	85.0	1.1e-78
WP_045343394.1|3536313_3536535_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	53.6	2.4e-13
WP_032104845.1|3536633_3537266_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.1	7.5e-36
WP_063154646.1|3537690_3538110_+	hypothetical protein	NA	A0A088FWM4	Lelliottia_phage	39.2	5.0e-20
WP_151571636.1|3538219_3538561_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	97.3	1.3e-55
WP_151571681.1|3538847_3539141_+	regulator	NA	M9P0E2	Enterobacteria_phage	95.9	4.8e-46
WP_151571682.1|3539842_3540025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058657563.1|3540176_3540386_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	5.7e-33
WP_151571637.1|3540456_3541425_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	84.8	1.7e-71
WP_049012395.1|3541432_3541717_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	95.7	2.2e-48
WP_044704466.1|3541735_3542482_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_151571638.1|3542478_3542970_+	hypothetical protein	NA	A0A291AY26	Shigella_phage	38.4	5.3e-21
WP_151571639.1|3542950_3543565_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	58.2	1.0e-58
WP_047028425.1|3543561_3543990_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	96.5	1.2e-72
WP_047028424.1|3543986_3544139_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_151571640.1|3544135_3544618_+	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.9	6.7e-69
WP_047028422.1|3544614_3545274_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	94.1	7.2e-122
WP_151571641.1|3545392_3545611_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	7.1e-18
WP_139964092.1|3545610_3546066_+	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	52.9	2.9e-37
WP_151571642.1|3546028_3546268_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_045288376.1|3546276_3546507_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	96.1	2.5e-34
WP_151571643.1|3546612_3546897_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.3	1.1e-34
WP_151571644.1|3546874_3548104_-	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	97.8	1.7e-238
WP_014884848.1|3548535_3549012_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_023331097.1|3549008_3549962_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_014832926.1|3549961_3550612_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3550643_3551219_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_023337641.1|3551643_3553263_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_032635805.1|3553247_3553985_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014884852.1|3554117_3555446_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	7.1e-44
WP_014884853.1|3555498_3555882_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	72.8	7.3e-34
WP_014884854.1|3556196_3556886_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	1.3e-54
WP_014884855.1|3556926_3558057_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_014884856.1|3558261_3558681_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	7.7e-13
WP_023337643.1|3558750_3559449_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023337644.1|3559484_3562148_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023331103.1|3562258_3563614_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014884860.1|3563659_3563983_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_023331104.1|3563979_3565275_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.8e-44
WP_014884862.1|3570893_3573467_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.3e-128
WP_023337645.1|3573597_3574329_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_014884864.1|3574325_3575306_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_014884865.1|3575437_3576175_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_014884866.1|3576442_3576784_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100249759.1|3576888_3576936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884867.1|3577043_3578204_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_014884868.1|3578200_3579073_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_023337646.1|3579133_3580255_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014884870.1|3580265_3581336_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	9.0e-90
WP_014884871.1|3581551_3581926_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_023337647.1|3582019_3582616_+	YfiR family protein	NA	NA	NA	NA	NA
WP_014884873.1|3582608_3583829_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.9e-06
WP_014884874.1|3583841_3584327_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023337650.1|3584329_3585700_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023337651.1|3585738_3586143_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_038421071.1|3586371_3587421_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	88.3	2.3e-186
WP_038421070.1|3587443_3587782_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	86.6	6.2e-53
WP_038421069.1|3587790_3588627_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	77.7	7.7e-121
WP_038421068.1|3588747_3589119_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	97.6	1.2e-60
WP_038421067.1|3589151_3589661_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	7.5e-87
WP_023338694.1|3589668_3589869_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	4.3e-30
WP_038421066.1|3589832_3590171_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.9e-52
WP_038421065.1|3590238_3590466_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	93.3	3.2e-29
WP_038421064.1|3590465_3590690_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	91.9	2.0e-31
WP_038421063.1|3590686_3591043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038421336.1|3591035_3593267_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.5	0.0e+00
WP_023209082.1|3593380_3593563_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	96.7	2.6e-26
WP_023278476.1|3593566_3593800_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	97.4	3.1e-35
WP_038421062.1|3593887_3594145_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	51.3	6.0e-16
WP_038421061.1|3594457_3595483_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.9	4.6e-168
WP_038421060.1|3595484_3597254_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.4	5.5e-302
WP_038421059.1|3597421_3598276_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	69.4	4.9e-107
WP_048988391.1|3598331_3599399_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	7.9e-171
WP_151571645.1|3599402_3600158_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	66.5	3.6e-77
WP_032609395.1|3600257_3600764_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.2	7.1e-61
WP_032609394.1|3600763_3600967_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	76.1	6.1e-24
WP_032609392.1|3600957_3601179_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_032609391.1|3601162_3601672_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.7e-78
WP_151571646.1|3601668_3602094_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	69.3	1.6e-45
WP_080297781.1|3601981_3602227_+|holin	holin	holin	S4TNY4	Salmonella_phage	76.5	1.0e-28
WP_023338712.1|3602189_3602657_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.9	7.7e-62
WP_023338713.1|3602649_3603099_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	70.1	2.0e-51
WP_038421052.1|3603167_3603809_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	82.2	8.6e-96
WP_038421051.1|3603805_3604156_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	1.5e-38
WP_038421050.1|3604161_3605070_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	82.8	7.0e-136
WP_023333111.1|3605062_3605593_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	1.2e-90
WP_038421049.1|3605604_3607635_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	80.5	5.3e-91
WP_032665574.1|3607646_3608051_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	47.0	5.3e-27
WP_151571647.1|3608173_3609307_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	81.9	8.7e-176
WP_087451024.1|3609316_3610437_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_151571648.1|3610347_3610530_+	hypothetical protein	NA	NA	NA	NA	NA
3610537:3610552	attL	GCCAGCGCATCACCGA	NA	NA	NA	NA
WP_001207673.1|3610604_3611123_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	1.0e-78
WP_038421047.1|3611183_3611492_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_000763321.1|3611524_3611647_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.0e-13
WP_038421045.1|3614100_3614565_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	3.2e-60
WP_038421044.1|3614561_3615725_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	77.0	8.7e-163
WP_071847085.1|3615802_3616021_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	79.2	8.0e-30
WP_002914145.1|3616165_3616513_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014884877.1|3616556_3617324_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3617355_3617895_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3617910_3618159_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014884878.1|3618275_3619637_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014884879.1|3619803_3620595_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032629440.1|3620613_3621900_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014884881.1|3621951_3622545_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|3622667_3623546_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_014884882.1|3623631_3625293_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071819763.1|3625267_3625450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884883.1|3625431_3625770_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014884884.1|3625874_3626162_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023337653.1|3626151_3626628_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3626745_3627228_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_047028355.1|3628465_3629770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151571649.1|3630479_3630680_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151571650.1|3630786_3631191_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	58.4	7.4e-21
WP_151571651.1|3632146_3632827_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	79.6	3.6e-108
WP_151571652.1|3632823_3633969_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	89.5	2.9e-187
WP_151571653.1|3634062_3634251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571654.1|3634303_3634828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571655.1|3635098_3636124_-|integrase	tyrosine-type recombinase/integrase	integrase	Q2A0C3	Sodalis_phage	27.5	7.0e-23
WP_151571656.1|3636133_3636718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571657.1|3637200_3637863_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	52.4	1.8e-56
WP_115455387.1|3637871_3638216_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	56.6	1.7e-18
WP_115455388.1|3638212_3639280_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	6.0e-110
WP_115455389.1|3639336_3640014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571658.1|3640227_3642570_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	41.1	9.9e-150
WP_151571659.1|3642566_3642785_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_151571660.1|3642788_3643010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063157402.1|3643006_3643201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063157401.1|3643193_3643376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151571661.1|3643368_3644247_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151571662.1|3644239_3644485_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_151571663.1|3645057_3645270_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151571664.1|3645390_3646623_-	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	37.4	5.7e-64
WP_151571665.1|3646864_3647218_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.0	2.5e-57
WP_047028400.1|3647220_3647874_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.0	2.6e-84
WP_072057198.1|3647935_3648331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028399.1|3648317_3649091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028398.1|3649184_3649538_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.9	8.5e-29
WP_047028397.1|3649537_3650605_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.2	3.8e-157
WP_032666013.1|3650607_3650910_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	94.0	2.2e-49
WP_047028396.1|3650909_3651497_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	90.3	1.0e-87
WP_047028395.1|3651496_3653506_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.8	0.0e+00
WP_024131618.1|3653495_3653672_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
WP_047028394.1|3653683_3654136_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	80.0	8.8e-63
WP_047028393.1|3654139_3654580_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_047028392.1|3654591_3655737_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.6	8.5e-163
WP_047028391.1|3655740_3656286_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.4	3.9e-49
WP_032625723.1|3656278_3656683_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	2.6e-42
WP_047028390.1|3656682_3657189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150225.1|3657185_3657596_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.9	4.4e-29
WP_047028389.1|3657567_3657978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247459.1|3658023_3658971_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	60.1	1.9e-107
WP_016247460.1|3658982_3659486_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.0	2.9e-30
WP_047028388.1|3659497_3660769_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.6	1.0e-79
WP_047028387.1|3661030_3661564_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	8.5e-49
WP_047028386.1|3661634_3663104_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.7	6.4e-155
WP_047028385.1|3663105_3664722_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	79.1	8.4e-265
WP_001567368.1|3664878_3666282_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|3666310_3666943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|3667062_3667986_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_032666037.1|3668270_3668873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666038.1|3669119_3670124_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1Z2	Lactococcus_phage	24.7	2.6e-06
WP_074143874.1|3670200_3670746_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	73.8	1.0e-52
WP_032666040.1|3670742_3671183_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.2	3.6e-61
WP_032666043.1|3671182_3671458_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_032666047.1|3671454_3671853_-	membrane protein	NA	NA	NA	NA	NA
WP_151571666.1|3672164_3672716_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	44.1	7.5e-40
WP_047028383.1|3672869_3673652_-	antitermination protein	NA	F1C595	Cronobacter_phage	68.6	2.1e-96
WP_047028382.1|3673648_3674509_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	88.1	8.7e-144
WP_047028381.1|3674508_3675477_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	80.4	5.2e-153
WP_047028380.1|3675473_3677090_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	90.5	4.3e-285
WP_047028403.1|3677504_3677822_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	6.9e-30
WP_032625779.1|3677793_3678018_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	89.6	1.0e-24
WP_032625781.1|3678116_3678785_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	92.8	1.3e-118
WP_045354484.1|3678955_3679171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047667549.1|3679167_3679386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047028404.1|3679446_3679833_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	59.2	2.2e-38
WP_047028405.1|3679940_3680165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047028406.1|3680165_3680531_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	76.9	5.5e-47
WP_047028407.1|3680523_3680736_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	50.0	2.8e-11
WP_080959431.1|3680707_3680929_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	8.5e-19
WP_047028408.1|3681029_3681341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045269208.1|3681330_3681540_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	95.6	1.7e-32
WP_047028409.1|3681494_3682667_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.3	1.7e-211
WP_038421043.1|3683010_3684219_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.8	1.1e-107
WP_080297780.1|3684236_3686591_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_038421041.1|3686937_3687501_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.8	1.6e-61
3688415:3688430	attR	TCGGTGATGCGCTGGC	NA	NA	NA	NA
>prophage 9
NZ_CP042578	Enterobacter kobei strain C16 chromosome, complete genome	4964300	4139095	4180028	4964300	transposase,integrase	Stx2-converting_phage(18.18%)	30	4160500:4160515	4187289:4187304
WP_087451024.1|4139095_4140216_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_017384073.1|4141084_4141381_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384071.1|4142728_4143004_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384070.1|4143038_4144148_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
WP_012561111.1|4144191_4144590_+	VOC family protein	NA	NA	NA	NA	NA
WP_012561110.1|4144654_4145491_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000227969.1|4146078_4147155_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|4148694_4149045_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_007901308.1|4151208_4152132_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_007896426.1|4152330_4153656_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|4154899_4155421_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023304425.1|4155417_4156371_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|4156457_4158782_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|4158826_4159729_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|4159725_4160724_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
4160500:4160515	attL	CCGGTGGCGTTTATCG	NA	NA	NA	NA
WP_004118246.1|4160720_4161677_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|4161677_4162445_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|4162543_4162837_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|4163167_4163446_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|4163707_4164712_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_007851507.1|4165119_4166202_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_045307685.1|4166323_4169398_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|4169449_4170703_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|4170759_4170930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384068.1|4171784_4172918_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_085949497.1|4173252_4174400_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_017384060.1|4174490_4174919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|4174922_4177040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|4177027_4178794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|4178780_4180028_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4187289:4187304	attR	CGATAAACGCCACCGG	NA	NA	NA	NA
>prophage 1
NZ_CP042579	Enterobacter kobei strain C16 plasmid pC16_001, complete sequence	275807	72031	123894	275807	transposase,protease	Enterobacteria_phage(20.0%)	55	NA	NA
WP_001585166.1|72031_73111_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|73112_73886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|73878_75021_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|75030_76089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|76409_76991_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|76990_78148_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|78170_78626_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78648_79689_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|79737_80316_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|80384_80960_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_151571685.1|81388_81748_+	protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|83497_83953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|84193_84385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|84476_84818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|85804_86059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|86061_88101_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|88097_89084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|90004_90397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|90375_90687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|91038_92185_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000462754.1|92215_92872_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|92911_93094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|93074_93572_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|93576_94965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|95365_95659_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|95663_96989_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|97049_97256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|97356_97767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|97779_98304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|98485_99490_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|99580_100015_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287661.1|100100_102506_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|102502_103579_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000993245.1|103587_103800_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|103762_103882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|103865_104102_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|104098_104464_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|104481_106167_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|106205_106631_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|106658_106934_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|106949_107315_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|107386_107842_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|108519_108945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|109493_109802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|109817_110675_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194554.1|110736_110940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|111281_111686_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|111863_112157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|112182_112419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|112973_113639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|113696_114077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|114406_115267_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|115449_116007_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|116170_119176_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001067855.1|123189_123894_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP042579	Enterobacter kobei strain C16 plasmid pC16_001, complete sequence	275807	135288	238562	275807	transposase	Escherichia_phage(33.33%)	113	NA	NA
WP_085949440.1|135288_136657_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|136832_138173_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|138594_139833_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_001515348.1|140308_140881_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_000167917.1|141080_142004_+	cation transporter	NA	NA	NA	NA	NA
WP_100280317.1|142047_142242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|142266_142506_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|142505_142793_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_001447866.1|142864_143023_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000332796.1|143631_143952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015183.1|144233_144437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743059.1|144483_144834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695474.1|144893_145496_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000778029.1|145591_146536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272971.1|147639_148824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708863.1|148889_149171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248818.1|149485_150187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856246.1|150321_150618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286108.1|150662_151100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800251.1|151167_151704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|151929_152298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442693.1|152730_153030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091367.1|153386_153671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|153736_154090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338612.1|154376_155108_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952985.1|155109_156291_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
WP_000718549.1|156301_156964_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000343600.1|156950_158060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284073.1|158059_160144_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011152.1|160143_163290_-	helicase	NA	NA	NA	NA	NA
WP_033487927.1|163299_164037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|164033_164519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|164838_165985_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000004208.1|166510_167311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140952.1|167312_167825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196727.1|168416_169463_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|169452_170868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386160.1|170876_174827_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000654195.1|174949_175456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902297.1|175465_176527_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001371950.1|176650_177208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494968.1|177290_177830_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|177977_178727_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843243.1|178751_179144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001439466.1|179339_179600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620988.1|179659_180271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031378.1|180377_181187_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000281824.1|181232_182492_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
WP_000111290.1|182475_182910_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_100185530.1|184220_185135_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
WP_122966916.1|185116_185332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|185300_185618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|185668_186076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|186533_187205_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|187249_187555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|187577_187895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|188108_189512_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|189540_190173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|190292_191216_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_000125668.1|191435_192839_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|192871_193576_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|193662_193983_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|194028_195318_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|195330_195756_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|195815_196643_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|196661_198140_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|198631_198907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|199047_199245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000443289.1|199314_199602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|199639_199894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371948.1|199939_200173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|200231_200489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|200562_200877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|200924_201821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|201823_202339_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|202553_203981_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078513.1|204231_205551_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|205563_205767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|205830_207036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|207032_207851_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|208316_208589_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|208711_209827_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|210084_210519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|210736_212083_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_001572374.1|212166_213090_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
WP_001572373.1|213278_214898_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|214974_215451_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|215616_216321_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|216354_216846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|216952_217690_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|217686_217911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|218121_219615_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|219645_219897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|219790_220093_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|220179_220995_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|221324_221501_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|221682_222687_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|222765_225732_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001067855.1|225852_226557_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538079.1|226547_226730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002904004.1|226693_227554_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|227574_228336_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|228326_228560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|228597_229500_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|231133_231838_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|231917_232418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|232567_233209_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|233352_234057_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000159617.1|234572_234767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|234763_235075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|235137_235377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|237192_237522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646498.1|237638_238562_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
>prophage 1
NZ_CP042580	Enterobacter kobei strain C16 plasmid pC16_002, complete sequence	82010	2110	44059	82010	integrase,protease,transposase	Escherichia_phage(25.0%)	57	10460:10474	48950:48964
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7465_8305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|8234_8414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|8432_8705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|8886_9891_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|10118_11324_+	chromate efflux transporter	NA	NA	NA	NA	NA
10460:10474	attL	GCAGGGCGCGTTGCA	NA	NA	NA	NA
WP_000130000.1|11334_11640_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|11655_11838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|11866_12631_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|12821_13178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|13123_13708_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|13707_14946_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|14942_15848_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|15969_16674_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|16906_17767_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|17779_18322_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|18803_18995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|19000_19246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|19296_20433_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|20547_21918_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|22738_23599_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|24267_24777_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|24824_26912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|26924_27875_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|27885_29148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|29192_29468_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|29692_30076_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|30155_30809_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011091026.1|30901_31159_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_015243648.1|31091_31493_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_011091030.1|31837_32272_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.4	4.7e-29
WP_011091031.1|32220_33525_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.8	1.2e-112
WP_015058924.1|33547_34396_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	5.0e-27
WP_004187415.1|34398_34719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050868822.1|34863_35115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|35570_35780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091034.1|35782_36001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091035.1|36045_36729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091036.1|36725_36998_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012579093.1|37015_38290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091038.1|38816_39173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091039.1|39150_39735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091040.1|39731_40451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012579094.1|40612_41158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091042.1|41298_41760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187394.1|41756_42005_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_011091043.1|41997_42585_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_011091044.1|42581_43067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091045.1|43063_43312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091046.1|43330_44059_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.3e-22
48950:48964	attR	TGCAACGCGCCCTGC	NA	NA	NA	NA
