The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042545	Klebsiella michiganensis strain C52 chromosome, complete genome	5876662	1696292	1778380	5876662	portal,holin,tRNA,integrase,capsid,transposase,head,protease,tail,terminase	Klebsiella_phage(61.11%)	92	1685311:1685326	1770820:1770835
1685311:1685326	attL	TTTTATCACCAACGAT	NA	NA	NA	NA
WP_038424856.1|1696292_1697468_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	92.2	8.4e-206
WP_032422780.1|1697422_1697635_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	76.1	1.2e-25
WP_004177218.1|1697767_1697989_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	87.7	2.6e-28
WP_038424853.1|1697978_1698689_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	86.2	9.8e-109
WP_038424852.1|1698694_1699213_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	88.4	4.2e-85
WP_038424851.1|1699253_1699694_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	81.9	2.3e-60
WP_004177208.1|1699690_1699909_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_038424849.1|1699880_1700135_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	94.0	2.9e-39
WP_038424848.1|1700127_1700493_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	98.3	5.8e-57
WP_004152159.1|1700661_1700850_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|1700842_1701157_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|1701326_1701995_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|1702092_1702314_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152163.1|1702288_1702582_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_038424846.1|1702842_1703214_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	92.6	7.5e-60
WP_051800680.1|1703248_1704895_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	82.4	1.8e-275
WP_071889115.1|1704896_1705859_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	8.1e-183
WP_023317656.1|1705855_1706332_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	98.7	2.6e-89
WP_038424844.1|1706328_1707111_+	antitermination protein	NA	F1C595	Cronobacter_phage	77.9	6.5e-114
WP_038424843.1|1707716_1708064_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	72.9	2.3e-39
WP_004884314.1|1708066_1708606_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
WP_038424841.1|1708602_1708950_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	1.0e-39
WP_038424839.1|1708946_1709222_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	90.1	1.3e-05
WP_038424837.1|1709172_1709370_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	86.9	5.9e-24
WP_031592522.1|1709440_1709929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031592520.1|1710013_1710403_+	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	8.7e-27
WP_038424834.1|1710469_1710715_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.9e-35
WP_038424832.1|1710789_1711251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038424831.1|1711450_1711804_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.6	9.0e-47
WP_004177162.1|1711986_1712451_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_038424829.1|1712404_1714147_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	2.4e-140
WP_038424827.1|1714146_1715454_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	6.6e-212
WP_038424825.1|1715466_1716315_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.6	1.2e-134
WP_038424824.1|1716324_1717542_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	82.2	2.7e-183
WP_038424822.1|1717584_1717872_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	68.1	1.2e-09
WP_004886703.1|1717871_1718198_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	72.2	3.6e-42
WP_038424820.1|1718267_1718465_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	95.4	2.7e-24
WP_004184710.1|1718466_1718799_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_038424818.1|1718791_1719331_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	98.9	8.8e-94
WP_038424817.1|1719327_1719693_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	96.7	1.7e-64
WP_004104226.1|1719750_1720242_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
WP_032440655.1|1720285_1720639_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	98.3	1.4e-60
WP_038424812.1|1720671_1720935_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	97.7	1.3e-42
WP_038424810.1|1721000_1721468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038424807.1|1721512_1723960_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	63.9	2.4e-263
WP_038424804.1|1723959_1724439_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	6.6e-93
WP_038424802.1|1724425_1724908_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	6.3e-83
WP_038424801.1|1724917_1725298_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.9	3.4e-68
WP_038424799.1|1725294_1728363_+	kinase	NA	A0A286S259	Klebsiella_phage	98.5	0.0e+00
WP_038424797.1|1731730_1731970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038424795.1|1732338_1732656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038424793.1|1732667_1733549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892499.1|1734095_1734518_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_038424792.1|1734923_1735172_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	71.6	4.7e-26
WP_004104655.1|1735950_1736433_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_029946935.1|1736543_1737020_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_014226445.1|1737009_1737300_+	RnfH family protein	NA	NA	NA	NA	NA
WP_004123807.1|1737366_1737708_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014839242.1|1737855_1739517_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004123797.1|1739603_1740482_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004853330.1|1740607_1741198_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014839241.1|1741262_1742552_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004853326.1|1742570_1743362_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004123779.1|1743526_1744894_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004123777.1|1745130_1745379_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014226441.1|1745397_1745946_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004104636.1|1745991_1746759_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004104634.1|1746798_1747146_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014839240.1|1747266_1747704_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032720460.1|1747758_1749129_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014226437.1|1749133_1749616_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014839238.1|1749627_1750851_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004853313.1|1750843_1751353_-	YfiR family protein	NA	NA	NA	NA	NA
WP_014226435.1|1751697_1752768_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
WP_014226434.1|1752777_1753899_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014226433.1|1753967_1754840_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004853306.1|1754836_1755997_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_101706155.1|1756103_1756151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104616.1|1756258_1756594_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004853303.1|1756865_1757603_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004853302.1|1757735_1758716_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_032720461.1|1758712_1759444_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_014226431.1|1759571_1762145_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
WP_032721880.1|1767971_1768427_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	47.6	1.1e-31
WP_038424788.1|1768700_1769999_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.8e-44
WP_038424787.1|1770001_1770328_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_014230410.1|1770367_1771723_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
1770820:1770835	attR	TTTTATCACCAACGAT	NA	NA	NA	NA
WP_038424785.1|1771816_1774495_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_014839228.1|1774530_1775229_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004104599.1|1775298_1775724_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
WP_004123719.1|1775927_1777001_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_038424783.1|1777051_1778380_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP042545	Klebsiella michiganensis strain C52 chromosome, complete genome	5876662	2044991	2117150	5876662	holin,integrase,plate,transposase,protease	Pseudomonas_phage(13.33%)	58	2040455:2040472	2073178:2073195
2040455:2040472	attL	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
WP_014839116.1|2044991_2045543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839114.1|2045968_2046505_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014230248.1|2046567_2047230_+	molecular chaperone	NA	NA	NA	NA	NA
WP_038424737.1|2047260_2049810_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014230246.1|2049829_2050870_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014839112.1|2050882_2051392_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025106684.1|2051425_2051956_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_038424736.1|2052002_2052923_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_004852808.1|2053107_2053569_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038424735.1|2053666_2054962_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_038424734.1|2055039_2056710_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_038424733.1|2056706_2057465_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_004123101.1|2057479_2058337_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_032694823.1|2058336_2059302_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_038424732.1|2059298_2060690_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_038424731.1|2060666_2061290_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_014230236.1|2061395_2062916_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_032718777.1|2062927_2063359_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_038424730.1|2063374_2064355_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014230233.1|2064489_2065164_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_038424729.1|2065150_2066566_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014230231.1|2066557_2066983_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
WP_038424728.1|2067120_2068113_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.3	4.2e-73
WP_014230229.1|2068161_2069610_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_004123076.1|2069879_2070422_+	membrane protein	NA	NA	NA	NA	NA
WP_014230228.1|2070518_2071715_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_004852774.1|2071919_2072702_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839100.1|2072715_2073921_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
2073178:2073195	attR	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
WP_004852770.1|2073973_2075263_+	MFS transporter	NA	NA	NA	NA	NA
WP_014839099.1|2075277_2076081_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_014839098.1|2076103_2077282_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_038424727.1|2077278_2078538_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_014230223.1|2078527_2080150_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_014230222.1|2080421_2081768_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_014230221.1|2081777_2082845_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
WP_038424726.1|2082849_2083806_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038424725.1|2083850_2085395_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.2	6.8e-38
WP_004104002.1|2085587_2085842_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_004852757.1|2085841_2086972_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_014839096.1|2087075_2089361_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_014230217.1|2089705_2090434_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_004852752.1|2090619_2093253_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
WP_014230216.1|2093383_2096230_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
WP_004103995.1|2096274_2096925_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_014230215.1|2096941_2099602_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_014230214.1|2100373_2101492_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
WP_014230213.1|2101594_2102647_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230212.1|2102719_2103784_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230211.1|2103783_2104434_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014230210.1|2104510_2106154_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014230209.1|2106322_2107759_+	magnesium transporter	NA	NA	NA	NA	NA
WP_014230208.1|2107721_2108969_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
WP_014230207.1|2109248_2110883_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_014230206.1|2110927_2111419_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_009653963.1|2111621_2112728_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230205.1|2113709_2114207_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_014230204.1|2114243_2115794_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014839089.1|2115812_2117150_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 3
NZ_CP042545	Klebsiella michiganensis strain C52 chromosome, complete genome	5876662	2264152	2272547	5876662		Bacillus_phage(33.33%)	8	NA	NA
WP_014230106.1|2264152_2265016_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.4	1.1e-08
WP_014230105.1|2265026_2265800_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_032693715.1|2266216_2267017_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230103.1|2267003_2267474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654032.1|2267474_2268368_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_025107782.1|2268612_2269974_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.0	1.6e-200
WP_014230101.1|2270292_2271015_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_032693716.1|2271011_2272547_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
>prophage 4
NZ_CP042545	Klebsiella michiganensis strain C52 chromosome, complete genome	5876662	3545544	3566459	5876662	tail,holin	Cronobacter_phage(25.0%)	18	NA	NA
WP_004112629.1|3545544_3546534_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_014229134.1|3546659_3547100_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004101621.1|3547096_3547369_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_077255406.1|3547654_3557989_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.0	0.0e+00
WP_038424422.1|3558036_3558651_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	70.1	5.5e-68
WP_038423189.1|3558818_3559553_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.6	5.3e-126
WP_014229131.1|3559554_3560307_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.7	2.5e-115
WP_014229130.1|3560303_3560651_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.9	5.4e-36
WP_014229129.1|3560673_3561783_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
WP_071881731.1|3561867_3562113_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	41.2	6.1e-10
WP_014229128.1|3562175_3562487_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
WP_014229127.1|3562559_3563222_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
WP_004850340.1|3563341_3563761_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
WP_038424420.1|3563816_3564359_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.1	1.5e-69
WP_032749344.1|3564366_3564639_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_009653048.1|3564628_3565021_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032720808.1|3565097_3565460_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	58.3	7.1e-31
WP_009653037.1|3565922_3566459_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
>prophage 1
NZ_CP042546	Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence	195216	1319	132757	195216	integrase,transposase	Escherichia_phage(25.58%)	119	NA	NA
WP_032752117.1|1319_2060_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	7.0e-25
WP_077254524.1|2116_2443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151641814.1|2524_3907_-	hypothetical protein	NA	E5G6M2	Salmonella_phage	25.6	3.8e-16
WP_089617520.1|3927_5135_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_040118422.1|5210_5567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118423.1|6838_7582_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	5.7e-51
WP_040118424.1|7623_7953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118425.1|8261_8930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032752086.1|9018_9291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007374408.1|10168_11077_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_032752126.1|11484_11835_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	7.9e-19
WP_007374411.1|11980_12412_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_040118426.1|12657_14133_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697968.1|14125_14806_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475503.1|14995_16381_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|16409_16763_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_023602553.1|16876_18169_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|18179_21326_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_002436620.1|21412_21853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142132150.1|21950_24422_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	1.7e-83
WP_000843497.1|24462_24660_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|24693_25431_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|25719_26169_-	copper resistance protein	NA	NA	NA	NA	NA
WP_040118428.1|26403_28221_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|28220_29117_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|29156_29537_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|29541_30471_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|30525_31206_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_002436614.1|31202_32603_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_004118347.1|32818_33253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654306.1|33631_33751_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|33716_33896_-	antitoxin	NA	NA	NA	NA	NA
WP_009310051.1|34209_34473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310052.1|34469_35036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213594.1|35066_35561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150739.1|35621_35825_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000227969.1|37059_38136_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032716625.1|38890_40444_-	L-lactate permease	NA	NA	NA	NA	NA
WP_003033249.1|40879_42577_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001102107.1|42651_43371_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023895.1|43381_44809_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_004118595.1|44801_45497_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003031542.1|45546_45984_-	gluconate transporter	NA	NA	NA	NA	NA
WP_004118600.1|46137_46449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990392.1|46445_46865_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
WP_003031541.1|46901_48104_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	63.6	3.9e-126
WP_004118613.1|48096_48426_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	65.1	6.7e-36
WP_000611681.1|48422_48944_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	53.8	6.4e-49
WP_000124733.1|49275_49506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253206.1|49505_49862_-	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	65.2	4.2e-36
WP_001114073.1|50414_50768_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|50815_51178_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_040118429.1|51195_52947_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|52995_54285_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_000065758.1|54297_54723_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_102047566.1|54753_55020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|55093_55798_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003026799.1|56801_57068_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|57055_57538_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004118622.1|58744_60244_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038423655.1|60240_60996_+	ATPase AAA	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_000019473.1|62880_63861_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004159231.1|64037_64364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152692.1|65069_65939_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|65932_66943_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|66951_67779_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|67787_68651_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012637488.1|68647_69475_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004118541.1|69658_72667_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_040118433.1|72827_73385_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|73516_73849_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|74202_75351_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|75625_76000_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|76528_77725_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|77796_78624_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|78642_80121_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|80604_80958_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_003100847.1|81094_81652_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_040118442.1|81645_82014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|82043_82748_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003100856.1|82841_83342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812576.1|83338_83665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|83919_84276_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|84265_84667_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|84663_84954_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|85090_85795_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|86047_86752_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032427315.1|87337_87553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152286.1|87775_88858_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_032427316.1|88979_92054_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
WP_003846917.1|92105_93359_+	lactose permease	NA	NA	NA	NA	NA
WP_004152290.1|95064_97374_+	ATPase	NA	NA	NA	NA	NA
WP_004152291.1|97377_98694_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093087.1|98690_100886_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_009486390.1|101507_101696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118400.1|102372_103245_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071887233.1|103237_103309_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_040118434.1|103524_103794_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_051800686.1|103934_104501_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.8	3.0e-20
WP_071889121.1|104507_104735_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004118865.1|106608_107418_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_004118868.1|107410_108619_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_004118873.1|108630_110022_-	cytosine permease	NA	NA	NA	NA	NA
WP_040118402.1|110074_111751_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_040118404.1|114500_115058_-	HutD family protein	NA	NA	NA	NA	NA
WP_032413289.1|115054_115816_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_004118890.1|115914_117282_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_004118895.1|119001_120408_+	cytosine permease	NA	NA	NA	NA	NA
WP_004118898.1|120444_122034_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.0	3.6e-34
WP_004118901.1|122030_123023_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_077255420.1|123628_123928_+	hypothetical protein	NA	Q71TE9	Escherichia_phage	63.6	1.1e-24
WP_004118922.1|125262_126228_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004118925.1|126224_127043_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.5e-28
WP_004118928.1|127047_127710_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004118931.1|127706_128378_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004118155.1|128401_129250_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004118935.1|129406_130360_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.3	1.3e-10
WP_004118158.1|130446_131658_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_047665746.1|131833_132757_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	8.7e-166
>prophage 1
NZ_CP042547	Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence	173103	3297	111376	173103	transposase,integrase	Escherichia_phage(18.52%)	104	48203:48249	60558:60604
WP_004098871.1|3297_4275_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.9	4.4e-75
WP_101867698.1|4232_4421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098873.1|4738_6166_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_040118505.1|6182_6782_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_038423659.1|6817_8407_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	60.6	9.7e-173
WP_009309933.1|8437_8788_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	9.6e-41
WP_009309932.1|8784_9189_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	67.5	1.6e-23
WP_004098877.1|9321_10392_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_004098879.1|10988_12089_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004098881.1|12228_14154_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_004098883.1|14131_14680_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_004098885.1|14681_15047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098891.1|15116_16280_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004098893.1|16317_16746_-	heme-binding protein	NA	NA	NA	NA	NA
WP_004098894.1|17139_18807_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_004098897.1|18820_19411_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_004098899.1|19407_19839_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_087786203.1|21459_22154_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_040118507.1|22439_23411_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_040118508.1|24641_25274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310015.1|26819_28352_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_004196353.1|28426_29767_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_040118509.1|30188_31427_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.4	1.9e-11
WP_032072095.1|31515_31938_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|32099_33230_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|33242_33512_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|33617_34916_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|35149_35908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|35961_36882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|36944_37316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460269.1|37716_38640_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_008460270.1|38593_39973_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
WP_004196322.1|40003_40693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|40706_41444_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_009651956.1|41487_41853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889528.1|42103_42325_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.2	1.2e-12
WP_014386184.1|43392_43551_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032426567.1|43990_44263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152758.1|44259_44610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805754.1|45121_45502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805753.1|45567_45915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805755.1|46002_46233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805751.1|46279_47113_+	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	34.7	3.1e-21
WP_032191440.1|47201_48125_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	3.6e-172
48203:48249	attL	GATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_047722685.1|49056_49677_+	serine recombinase	NA	M9Q1K0	Clostridium_phage	29.3	2.1e-06
WP_040118531.1|49696_49960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118542.1|50060_50990_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	4.2e-75
WP_040118530.1|51781_52477_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	31.6	8.6e-25
WP_040118529.1|52521_53304_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	4.9e-53
WP_040118528.1|53300_54044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722684.1|54088_54406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021312767.1|55021_55252_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021312768.1|55248_55665_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001067855.1|55852_56557_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040118527.1|59603_60527_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	1.6e-172
WP_040118421.1|60806_61832_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
60558:60604	attR	GATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_040118421.1|62444_63470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032640629.1|63682_63883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032640631.1|63886_64324_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040118421.1|64376_65402_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_040118526.1|65450_66035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|66537_67971_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_005012528.1|68004_69219_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001067855.1|69693_70398_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040118523.1|71365_71632_+	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_040118522.1|71649_72579_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_040118521.1|72642_74493_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_020323225.1|74498_76043_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_020323228.1|76289_76805_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_020323230.1|76806_77085_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_020323222.1|77130_78534_+	PTS sugar permease component	NA	NA	NA	NA	NA
WP_020323221.1|78602_80666_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_009654927.1|80768_81431_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_009654928.1|81476_82490_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_009654926.1|82499_83141_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_009654924.1|83156_83423_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_032449369.1|83556_84750_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009654921.1|84967_85597_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_009654925.1|85598_86603_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_009654922.1|86723_87626_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_020323220.1|87901_89377_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004886861.1|89453_89735_-	peptidylprolyl isomerase C	NA	NA	NA	NA	NA
WP_001067855.1|90494_91199_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077255424.1|91189_91459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051800691.1|91401_91833_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_040118519.1|91993_93553_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040118537.1|93571_94519_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040118518.1|94515_96333_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	4.0e-21
WP_040118517.1|96329_97142_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.1e-14
WP_040118516.1|97150_97921_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040118515.1|97926_98976_+	osmoprotectant NAGGN system M42 family peptidase	NA	NA	NA	NA	NA
WP_040118536.1|99024_99306_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_109213786.1|99235_99637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|99642_100347_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001277466.1|100487_100853_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|100870_102556_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000732275.1|103047_103323_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294654.1|103338_103719_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|103790_104246_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020803817.1|105145_106228_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|106767_108276_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_052953619.1|108584_108995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118512.1|109881_110160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805503.1|110422_111376_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
>prophage 2
NZ_CP042547	Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence	173103	121885	130215	173103		Faecalibacterium_phage(16.67%)	13	NA	NA
WP_040118454.1|121885_122587_+	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	33.8	3.4e-21
WP_020314641.1|122586_122808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118455.1|122853_123264_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_040118456.1|123311_124079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118457.1|124503_124932_+	antirestriction protein YubI	NA	A9J566	Pseudomonas_phage	30.5	3.4e-08
WP_040118458.1|124978_125485_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	5.3e-08
WP_000761848.1|125525_125717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118459.1|125917_126181_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	55.3	3.4e-14
WP_040118460.1|126204_126525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074194703.1|127171_127261_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_040118461.1|127291_127849_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.2e-48
WP_040118462.1|127897_128146_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_040118463.1|128214_130215_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.1e-23
>prophage 1
NZ_CP042548	Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence	59124	2478	51787	59124	integrase,transposase,protease	Salmonella_phage(27.27%)	60	NA	NA
WP_032493169.1|2478_3264_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_012766294.1|3671_4313_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000608644.1|5609_6872_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_032493168.1|7124_8000_+	class A extended-spectrum beta-lactamase CTX-M-62	NA	A0A1B0VBP7	Salmonella_phage	81.7	4.6e-124
WP_064754192.1|8044_8377_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_032493167.1|9207_9630_+	ArdB-like protein	NA	NA	NA	NA	NA
WP_024562319.1|9746_9938_+	hypothetical protein	NA	A0A2I7QQE5	Vibrio_phage	52.4	3.8e-07
WP_024562318.1|9941_10472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024562316.1|11645_12437_+	hypothetical protein	NA	A0A2H4PB09	Aphanizomenon_phage	41.7	1.2e-09
WP_024562315.1|12605_12875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015060066.1|12916_13117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032493186.1|13171_13669_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032493183.1|14448_14655_+	DUF905 domain-containing protein	NA	A0A192Y879	Salmonella_phage	45.6	6.9e-07
WP_032493182.1|14729_14912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032277100.1|14970_15174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099156418.1|15382_15676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032493181.1|15753_16470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029697170.1|16478_16910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001642230.1|17583_17802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032493179.1|17801_19334_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024561907.1|19338_22557_+	conjugative relaxase	NA	A0A2R8FDQ9	Cedratvirus	30.5	2.4e-05
WP_000971716.1|22553_23219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024561906.1|23211_23574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000715148.1|24501_25029_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.7	1.1e-24
WP_001076634.1|25025_26027_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000101920.1|26077_27211_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000758230.1|27210_28098_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001208352.1|28108_28804_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_032493177.1|28814_28946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014014948.1|29022_30060_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000858958.1|30076_30319_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_014014949.1|30328_31030_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_032493176.1|31045_33619_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000462629.1|33619_33937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060075.1|33976_34273_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_015060076.1|34281_34560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024562119.1|34519_35302_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000960955.1|35401_35719_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024562120.1|35722_36073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115112.1|36183_36408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156415.1|36432_36720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024562121.1|37004_37190_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	57.8	2.6e-05
WP_000275218.1|37186_37795_-	resolvase	NA	NA	NA	NA	NA
WP_151641815.1|37948_38146_-	resolvase	NA	NA	NA	NA	NA
WP_000935452.1|38077_39382_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067834.1|39428_40133_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|40254_41160_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|41156_42395_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|42394_42979_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|42924_43281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|43471_44236_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024143553.1|44264_44447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130000.1|44462_44768_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|44778_45984_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|46139_46343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|46361_46541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|46470_47310_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_012695489.1|47800_48445_+	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_003833285.1|48486_48939_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_000050481.1|50245_51787_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
