The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	449377	506575	5068785	transposase,integrase	uncultured_Caudovirales_phage(21.74%)	54	447555:447570	509765:509780
447555:447570	attL	CTGCCGCTGATCCTGG	NA	NA	NA	NA
WP_087653979.1|449377_450367_+|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	33.1	9.7e-06
WP_032646931.1|450366_452493_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006785988.1|452622_452922_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_101828536.1|452999_455201_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	1.9e-134
WP_006785990.1|455709_456168_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_006785991.1|456430_456784_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
WP_006785992.1|456880_458164_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
WP_006785993.1|458213_458642_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
WP_023202699.1|458698_459412_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
WP_006785996.1|459417_459753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023202698.1|459801_461034_-	MFS transporter	NA	NA	NA	NA	NA
WP_020899215.1|461030_461558_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
WP_006786000.1|461656_462556_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006786002.1|462749_463190_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_023202697.1|463231_464506_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
WP_023202696.1|464555_465590_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	57.9	3.4e-110
WP_020899213.1|465742_466288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020899212.1|466348_467047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006786007.1|467978_468878_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_020899211.1|468946_469564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464944.1|469968_471115_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	4.3e-146
WP_006785878.1|471179_471812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006785879.1|471978_472329_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.4	1.0e-18
WP_006785880.1|472477_472909_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555738.1|473158_474634_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_000697968.1|474626_475307_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475503.1|475496_476882_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|476910_477264_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001485328.1|477377_478670_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|478680_481827_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_002436620.1|481913_482354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129244003.1|482451_484923_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-83
WP_000843497.1|484963_485161_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|485194_485932_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_001023257.1|486220_486670_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|486903_488721_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_020899208.1|488720_489617_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|489656_490037_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|490041_490971_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|491025_491706_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_006785898.1|491702_493103_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_004388336.1|493318_493753_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_032646944.1|494679_495660_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.7e-183
WP_006781398.1|496234_496567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781400.1|497080_497446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006781402.1|497530_498178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006781404.1|498253_498856_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_006781405.1|498923_499271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006781408.1|499352_500339_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.7	4.9e-50
WP_006781409.1|500444_501377_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_006781411.1|501485_502169_+	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.1	7.9e-31
WP_006781413.1|502297_503806_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	31.1	7.0e-48
WP_006781415.1|503872_505516_+	Helicase/Zfx / Zfy transcription activation region domain protein	NA	NA	NA	NA	NA
WP_006781417.1|505573_506575_+|integrase	site-specific integrase	integrase	M1TW19	Prochlorococcus_phage	21.4	4.9e-05
509765:509780	attR	CCAGGATCAGCGGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	1281983	1327844	5068785	terminase,head,holin,integrase	Cronobacter_phage(29.09%)	68	1281924:1281970	1328025:1328071
1281924:1281970	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
WP_139152760.1|1281983_1283006_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	97.6	6.2e-197
WP_071888795.1|1283023_1283359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032668696.1|1283367_1283568_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	98.5	7.1e-33
WP_032104950.1|1283728_1283926_-	hypothetical protein	NA	S4TWN3	Salmonella_phage	50.0	1.1e-12
WP_047058280.1|1284010_1284196_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	50.0	5.3e-06
WP_059452782.1|1284205_1284445_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	1.2e-10
WP_032668698.1|1284407_1284761_-	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	41.5	5.9e-14
WP_059452783.1|1284839_1285055_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.9	2.2e-16
WP_032647498.1|1285146_1285347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080337312.1|1285343_1285616_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
WP_151608580.1|1285612_1285807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049108575.1|1285826_1286321_-	hypothetical protein	NA	A0A291AXJ6	Shigella_phage	48.4	3.1e-29
WP_151608472.1|1286317_1286869_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.7	1.2e-53
WP_047058769.1|1287029_1287458_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
WP_059452769.1|1287454_1288135_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	96.0	3.1e-128
WP_059452768.1|1288131_1289049_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	89.8	3.9e-158
WP_059452767.1|1289058_1289337_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	78.5	4.8e-35
WP_001752704.1|1289415_1289622_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_022651079.1|1289773_1290022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313997.1|1290788_1290986_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	9.2e-25
WP_032655965.1|1291121_1292069_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
WP_059452766.1|1292207_1292918_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.6	1.4e-91
WP_023306036.1|1293021_1293210_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	51.8	1.5e-08
WP_023306037.1|1293296_1293581_+	hypothetical protein	NA	Q5G8T2	Enterobacteria_phage	57.4	5.2e-21
WP_063142625.1|1293768_1294854_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.6	8.0e-86
WP_063938395.1|1294850_1296224_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.9	7.6e-166
WP_072258163.1|1296213_1296528_+	protein ren	NA	M1FPD5	Enterobacteria_phage	50.5	5.6e-16
WP_059452800.1|1296524_1296725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153270.1|1298065_1298731_+	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	37.1	1.6e-41
WP_032647533.1|1298924_1299374_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
WP_063133509.1|1299366_1299537_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	84.9	1.4e-18
WP_059452757.1|1299500_1300001_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	50.7	2.3e-35
WP_058647991.1|1299994_1300639_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	69.6	2.1e-73
WP_015705894.1|1300635_1300752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059452756.1|1300748_1301438_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.9e-57
WP_001514183.1|1301717_1302119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|1302115_1302391_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_023296427.1|1302393_1302936_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	1.6e-74
WP_058655468.1|1302932_1303211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059452755.1|1303161_1303356_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.9	1.4e-17
WP_057059036.1|1303680_1304199_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.2	4.6e-92
WP_057059037.1|1304505_1304724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046401556.1|1304727_1305378_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	1.7e-104
WP_057059038.1|1305374_1306922_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.8	1.6e-289
WP_057059039.1|1306933_1308385_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.8	2.7e-198
WP_074135794.1|1308332_1309319_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.7	2.2e-111
WP_044704353.1|1309350_1309545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151608473.1|1309637_1311026_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.0	9.7e-153
WP_032648633.1|1311029_1311464_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
WP_048245857.1|1311473_1312571_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	2.6e-161
WP_048245855.1|1312580_1312946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048245854.1|1312948_1313329_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.7	2.0e-28
WP_059452717.1|1313328_1313502_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	53.6	1.2e-12
WP_151608475.1|1313501_1313858_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	3.0e-26
WP_059452793.1|1313860_1314268_+	hypothetical protein	NA	A0A291AXD9	Shigella_phage	51.1	2.3e-30
WP_048984796.1|1314264_1314648_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	8.9e-40
WP_151608477.1|1314711_1315455_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.4	1.3e-71
WP_045307639.1|1315514_1316198_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	61.5	4.6e-79
WP_151608479.1|1316256_1319739_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	62.8	4.8e-257
WP_032647561.1|1319738_1319975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151608481.1|1320013_1320511_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.3	2.5e-87
WP_059512182.1|1320510_1320981_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	2.4e-79
WP_151608483.1|1320990_1321383_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	92.7	3.9e-67
WP_151608484.1|1321369_1323847_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.7	0.0e+00
WP_151608486.1|1323905_1326074_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	60.6	1.1e-38
WP_151608488.1|1326164_1327136_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_151608490.1|1327281_1327521_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	69.2	5.9e-26
WP_151608492.1|1327520_1327844_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.6	3.5e-21
1328025:1328071	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	1987306	2048925	5068785	terminase,head,integrase,holin,capsid,portal,tail,tRNA	Enterobacterial_phage(29.09%)	80	1977723:1977740	2057879:2057896
1977723:1977740	attL	CCGCTTCCAGCAGCGGTT	NA	NA	NA	NA
WP_032103856.1|1987306_1988419_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032648023.1|1988459_1988933_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032648025.1|1988932_1989595_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1989712_1990963_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_022650806.1|1991038_1991284_+	YmjA family protein	NA	NA	NA	NA	NA
WP_023296321.1|1991288_1992788_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_071524166.1|1992912_1993005_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1993376_1993625_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1993678_1993753_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1993753_1993852_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032648028.1|1993897_1994926_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	1.5e-12
WP_015570791.1|1995237_1995492_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|1995572_1995878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570789.1|1995878_1996223_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032648030.1|1996374_1997082_+	CTP synthase	NA	NA	NA	NA	NA
WP_017384696.1|1997113_1998301_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_017384695.1|1998400_1999192_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|1999175_1999622_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023296324.1|1999728_2001765_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_015570785.1|2001780_2003112_-	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_015570783.1|2003520_2004021_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032668752.1|2004240_2005383_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.9e-93
WP_022650818.1|2005357_2005621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059452727.1|2006282_2006756_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	46.8	2.6e-17
WP_059452726.1|2006752_2006989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059452725.1|2006990_2007515_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	34.4	1.7e-12
WP_059452724.1|2007511_2008156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879864.1|2008639_2009665_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	89.2	1.3e-165
WP_109923562.1|2009661_2010075_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	3.1e-54
WP_059443608.1|2010123_2010444_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	6.1e-26
WP_063159425.1|2011026_2011335_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	40.5	2.6e-10
WP_063159426.1|2011631_2012228_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063159427.1|2012336_2012567_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	40.5	1.1e-05
WP_063159428.1|2012592_2013063_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	5.2e-74
WP_072044687.1|2013303_2013489_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.2e-14
WP_063159429.1|2013472_2014426_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	92.1	1.1e-168
WP_059443610.1|2014422_2014917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059452722.1|2014916_2015576_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.8	2.2e-99
WP_022650831.1|2015572_2015800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032103831.1|2015796_2016117_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	1.2e-42
WP_032103830.1|2016113_2016503_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	94.6	1.7e-67
WP_032103828.1|2016499_2017489_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	85.1	2.4e-166
WP_032103827.1|2017501_2018080_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	54.4	1.5e-46
WP_032103826.1|2018235_2018631_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	96.9	3.8e-62
WP_032103824.1|2018617_2018899_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	2.8e-43
WP_059452721.1|2018898_2019528_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	85.2	3.3e-100
WP_059452720.1|2019529_2019805_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	3.5e-30
WP_045334178.1|2019761_2019956_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	87.8	3.7e-18
WP_072258111.1|2020327_2020975_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	75.5	8.2e-62
WP_032668519.1|2021229_2022687_+	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	73.6	6.9e-218
WP_032648738.1|2022798_2023020_-	hypothetical protein	NA	Q38575	Escherichia_phage	71.2	3.7e-22
WP_032648736.1|2023184_2023778_+	hypothetical protein	NA	S4TR53	Salmonella_phage	85.8	1.8e-100
WP_032648734.1|2023770_2024139_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	91.8	3.7e-59
WP_000954404.1|2024244_2024739_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_087654008.1|2024735_2026397_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.4	0.0e+00
WP_032668517.1|2026455_2028390_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	95.0	0.0e+00
WP_032668515.1|2028593_2029949_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	98.4	1.7e-258
WP_032648723.1|2029945_2030860_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	76.9	4.3e-109
WP_032648721.1|2030856_2031183_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	90.7	3.4e-48
WP_032648717.1|2031191_2031542_+|head	phage head closure protein	head	S4TND9	Salmonella_phage	92.2	8.9e-55
WP_022648887.1|2031538_2031988_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_063922089.1|2031984_2032332_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	98.3	1.5e-57
WP_006809155.1|2032391_2032835_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_001549114.1|2032843_2033227_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_032619858.1|2033235_2033514_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_047719378.1|2033635_2033872_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	68.8	9.0e-27
WP_032668968.1|2034079_2037583_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	71.2	0.0e+00
WP_151608510.1|2037585_2037924_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	98.2	1.1e-62
WP_023305932.1|2037920_2038679_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.6	6.5e-143
WP_032668965.1|2038680_2039391_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	91.1	3.2e-136
WP_072026015.1|2039420_2039762_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	90.3	1.4e-52
WP_032668962.1|2039805_2040411_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	95.5	1.6e-99
WP_032668960.1|2040464_2044010_+	DUF1983 domain-containing protein	NA	K7PJL6	Enterobacteria_phage	92.1	0.0e+00
WP_032634448.1|2044054_2044369_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	67.6	7.8e-34
WP_032648708.1|2044369_2045041_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	7.6e-87
WP_032648706.1|2045148_2045382_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	75.3	8.6e-30
WP_063940042.1|2045441_2046740_+	hypothetical protein	NA	G8C7K5	Escherichia_phage	65.0	1.5e-152
WP_022650864.1|2046822_2047062_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	9.1e-27
WP_032668956.1|2047061_2047382_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	1.4e-25
WP_032104144.1|2047641_2048925_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
2057879:2057896	attR	CCGCTTCCAGCAGCGGTT	NA	NA	NA	NA
>prophage 4
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	2585467	2628281	5068785	plate,transposase,tRNA,integrase	Enterobacteria_phage(25.0%)	44	2601271:2601285	2624168:2624182
WP_012695466.1|2585467_2586391_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_001567369.1|2586510_2587143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|2587171_2588575_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_151608524.1|2588578_2588857_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.9	9.0e-18
WP_003856981.1|2588979_2589648_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032103593.1|2589907_2590942_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017382277.1|2591008_2591584_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151608526.1|2591732_2592251_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032103594.1|2592247_2592697_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017382275.1|2592700_2592934_-	YdcY family protein	NA	NA	NA	NA	NA
WP_017382274.1|2593035_2594634_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032648417.1|2594916_2596254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619621.1|2596258_2599240_+	virulence factor SrfB	NA	NA	NA	NA	NA
WP_032648418.1|2599236_2601411_+	virulence effector SrfC	NA	NA	NA	NA	NA
2601271:2601285	attL	CAGCCTGTCCATGCG	NA	NA	NA	NA
WP_032648420.1|2601444_2602203_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.0	2.0e-06
WP_003856960.1|2602289_2602463_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_015570441.1|2602706_2603033_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_003856958.1|2603060_2603414_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_003856955.1|2603417_2603600_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_032668860.1|2603635_2605060_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015570440.1|2605199_2606624_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_017693360.1|2606706_2606895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570438.1|2607288_2608683_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_015570437.1|2608688_2609699_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_017693358.1|2609698_2609827_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_015570436.1|2609950_2610388_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_003856935.1|2610389_2610656_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032648422.1|2610926_2614451_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_032648423.1|2614838_2615957_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	60.5	2.7e-121
WP_032648425.1|2615991_2616414_-	GFA family protein	NA	NA	NA	NA	NA
WP_003856931.1|2616417_2616615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123912599.1|2616835_2617027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524108.1|2617034_2617235_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.8e-20
WP_001186974.1|2617284_2618220_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.9	2.2e-140
WP_032648427.1|2618263_2619637_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	2.8e-51
WP_100160517.1|2619985_2620183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006810774.1|2620121_2621105_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_080344888.1|2621195_2622326_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_032648431.1|2622642_2623131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032648433.1|2623159_2624476_-	membrane protein	NA	NA	NA	NA	NA
2624168:2624182	attR	CGCATGGACAGGCTG	NA	NA	NA	NA
WP_015570427.1|2624499_2624955_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032648436.1|2624954_2625500_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032648437.1|2625477_2626563_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032648439.1|2626526_2628281_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	2882869	3072376	5068785	head,terminase,coat,protease,integrase,holin,portal,capsid,lysis,tail,tRNA	Enterobacteria_phage(19.11%)	229	2907895:2907911	3050292:3050308
WP_003859899.1|2882869_2883751_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_015570296.1|2883944_2885993_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859895.1|2886012_2886699_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_006811006.1|2886795_2887293_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_020480541.1|2887425_2888709_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_017693254.1|2888677_2891311_+	PqiB family protein	NA	NA	NA	NA	NA
WP_017693253.1|2891367_2892831_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003859885.1|2892937_2893177_+	YebV family protein	NA	NA	NA	NA	NA
WP_032648594.1|2893211_2893856_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	48.8	2.1e-54
WP_032648596.1|2894023_2895004_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_032648598.1|2895433_2896702_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.8	9.9e-229
WP_032648600.1|2896701_2897007_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	39.6	1.0e-14
WP_032648602.1|2897119_2897482_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
WP_032648604.1|2897478_2898420_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	7.2e-160
WP_032648605.1|2898416_2899898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032668808.1|2899927_2901943_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.8	5.5e-40
WP_032668806.1|2902001_2904479_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.1	0.0e+00
WP_032648608.1|2904465_2904858_-	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	87.9	1.6e-65
WP_032648609.1|2904867_2905338_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	8.2e-80
WP_032648610.1|2905337_2905835_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	3.5e-89
WP_032648612.1|2905834_2908765_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	46.8	1.8e-161
2907895:2907911	attL	GGTTACGCATCAGCGTT	NA	NA	NA	NA
WP_048983890.1|2908819_2909176_-	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	47.0	5.9e-14
WP_032648615.1|2909175_2909556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032648617.1|2909603_2910296_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.5	1.8e-54
WP_045324988.1|2910353_2911097_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	86.0	5.9e-72
WP_032648620.1|2911160_2911544_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_032648622.1|2911540_2912005_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	43.5	2.2e-29
WP_032648626.1|2912007_2912364_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	6.1e-27
WP_023300380.1|2912363_2912537_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	5.1e-11
WP_032648628.1|2912536_2912917_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	2.4e-29
WP_032648630.1|2912919_2913285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884000.1|2913294_2914392_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	7.6e-161
WP_032648633.1|2914401_2914836_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
WP_032648636.1|2914839_2916228_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	2.0e-153
WP_032648637.1|2916273_2916630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050594995.1|2916817_2917465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045324987.1|2917532_2918540_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.7	2.4e-113
WP_032668796.1|2918457_2919909_-	phage protein	NA	F1C5D7	Cronobacter_phage	50.1	8.1e-118
WP_032668795.1|2919920_2921393_-	phage DNA Packaging protein	NA	G0ZND4	Cronobacter_phage	86.3	5.5e-255
WP_032648641.1|2921379_2921940_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	76.3	2.0e-77
WP_123912597.1|2921961_2922483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032648644.1|2922586_2922994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072258132.1|2923057_2923495_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	65.0	3.7e-42
WP_032648647.1|2923536_2923977_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	76.5	1.4e-57
WP_122008274.1|2923963_2924269_-|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_032648648.1|2924683_2925373_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	2.5e-56
WP_087654012.1|2925369_2925486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032648649.1|2925482_2925845_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.2	1.6e-51
WP_032648651.1|2925841_2926132_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	90.6	1.8e-45
WP_032648654.1|2926124_2926295_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	94.3	7.7e-20
WP_032648655.1|2926294_2926750_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_032648657.1|2927162_2927651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123912596.1|2927651_2928554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032648661.1|2928803_2929493_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	95.2	1.3e-126
WP_032648664.1|2929489_2930398_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	99.3	2.9e-158
WP_032648667.1|2930483_2931026_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	79.4	3.2e-75
WP_032648669.1|2931055_2931283_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	57.7	1.4e-16
WP_032648671.1|2931318_2932074_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	59.6	2.1e-77
WP_032668793.1|2932085_2932673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048983716.1|2933185_2933374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045325037.1|2933838_2934018_+	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	55.1	9.6e-05
WP_006809788.1|2934169_2934379_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_032647507.1|2934451_2934736_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.7e-48
WP_032648679.1|2934754_2935600_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	2.1e-70
WP_032648682.1|2935596_2936277_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	93.8	7.1e-125
WP_032647502.1|2936593_2937145_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.4	9.7e-56
WP_006176198.1|2937141_2937360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080337312.1|2937356_2937629_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
WP_032647498.1|2937625_2937826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032648685.1|2937917_2938133_+	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	61.4	3.2e-15
WP_032648687.1|2938421_2939174_+	methyltransferase	NA	A0A1P8VVC9	Erythrobacter_phage	41.4	9.9e-35
WP_023300430.1|2939333_2939606_+	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
WP_023300431.1|2939574_2940660_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	1.6e-147
WP_003859787.1|2940982_2941321_-	YebY family protein	NA	NA	NA	NA	NA
WP_017693249.1|2941337_2942207_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_032648690.1|2942208_2942580_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003859784.1|2942717_2942948_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_015570289.1|2943059_2943710_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_015570288.1|2943734_2944397_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_032648692.1|2944378_2946454_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_015570286.1|2946529_2947180_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_032648694.1|2947351_2948530_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003859774.1|2948604_2949246_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_017384346.1|2949285_2951097_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003859771.1|2951330_2952806_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
WP_003859769.1|2953162_2954032_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859767.1|2954146_2955589_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_015570283.1|2955632_2956604_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003859762.1|2956721_2958041_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_032650053.1|2958056_2959001_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023296807.1|2959078_2959834_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
WP_015570280.1|2959830_2960616_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003859753.1|2960668_2961679_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_003859751.1|2961687_2962302_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859749.1|2962382_2962904_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859747.1|2962938_2963679_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859745.1|2963706_2964150_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_017384352.1|2964151_2965924_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032648699.1|2966186_2966753_+	hydrolase	NA	NA	NA	NA	NA
WP_032668791.1|2967117_2967384_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	93.2	1.5e-38
WP_063842612.1|2967479_2968241_-	hypothetical protein	NA	G8C7K5	Escherichia_phage	67.6	4.0e-92
WP_032648706.1|2968828_2969062_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	75.3	8.6e-30
WP_032648708.1|2969169_2969841_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	7.6e-87
WP_032634448.1|2969841_2970156_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	67.6	7.8e-34
WP_032648710.1|2970200_2973761_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	69.9	0.0e+00
WP_032648711.1|2973813_2974401_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	6.1e-48
WP_022648880.1|2974400_2975111_-	NlpC/P60 family protein	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_022648881.1|2975113_2975872_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	2.3e-95
WP_022648882.1|2975868_2976207_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032668973.1|2976209_2979512_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	85.2	0.0e+00
WP_059452786.1|2979569_2979911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619858.1|2979966_2980245_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|2980253_2980637_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|2980645_2981089_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_063922089.1|2981148_2981496_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	98.3	1.5e-57
WP_022648887.1|2981492_2981942_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_032648717.1|2981938_2982289_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	92.2	8.9e-55
WP_032648721.1|2982297_2982624_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	90.7	3.4e-48
WP_032648723.1|2982620_2983535_-|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	76.9	4.3e-109
WP_032668515.1|2983531_2984887_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	98.4	1.7e-258
WP_032668517.1|2985090_2987025_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	95.0	0.0e+00
WP_087654008.1|2987083_2988745_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.4	0.0e+00
WP_000954404.1|2988741_2989236_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_032648734.1|2989341_2989710_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	91.8	3.7e-59
WP_032648736.1|2989702_2990296_-	hypothetical protein	NA	S4TR53	Salmonella_phage	85.8	1.8e-100
WP_032648738.1|2990460_2990682_+	hypothetical protein	NA	Q38575	Escherichia_phage	71.2	3.7e-22
WP_032668768.1|2990793_2992251_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	73.6	1.0e-216
WP_151608536.1|2992262_2992913_-	DUF1983 domain-containing protein	NA	K7PH02	Enterobacteria_phage	79.3	9.5e-34
WP_047719375.1|2993214_2993403_-	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	77.0	2.7e-18
WP_047719374.1|2993432_2993624_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	74.6	1.2e-18
WP_074128402.1|2993574_2993850_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.0	7.8e-30
WP_032668767.1|2993857_2994487_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	5.4e-103
WP_032668766.1|2994486_2994768_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	91.4	2.0e-41
WP_032668765.1|2994754_2995150_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	97.7	7.7e-63
WP_032668764.1|2995305_2995884_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	1.3e-45
WP_032668763.1|2995896_2996886_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	90.0	8.7e-180
WP_022650833.1|2996882_2997272_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.1	9.2e-69
WP_032668762.1|2997268_2997592_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	78.8	2.5e-43
WP_032668761.1|2997588_2998248_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.1	6.5e-99
WP_032668760.1|2998247_2998742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032668759.1|2998738_2999665_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	55.6	3.4e-69
WP_044703888.1|2999627_2999834_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	2.9e-13
WP_072026008.1|2999997_3000558_-	hypothetical protein	NA	A5LH68	Enterobacteria_phage	51.1	1.6e-45
WP_032668783.1|3000574_3000778_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.0	1.2e-16
WP_032668758.1|3000878_3001511_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	56.7	1.1e-50
WP_047719372.1|3001889_3002342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032668756.1|3003058_3004081_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	89.5	8.7e-167
WP_050594993.1|3004067_3004487_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	50.0	1.1e-22
WP_050594992.1|3004483_3005128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080346148.1|3005052_3005328_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_050594991.1|3005324_3005597_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	50.8	2.4e-07
WP_032668754.1|3005598_3005907_+	hypothetical protein	NA	O64351	Escherichia_phage	90.2	4.6e-47
WP_032668753.1|3005903_3006170_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	93.0	3.8e-13
WP_022650818.1|3006205_3006469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032668752.1|3006443_3007586_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.9e-93
WP_032668956.1|3007965_3008286_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	1.4e-25
WP_022650864.1|3008285_3008525_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	9.1e-27
WP_047719380.1|3008607_3009906_-	hypothetical protein	NA	G8C7K5	Escherichia_phage	64.8	1.0e-151
WP_032104413.1|3009965_3010931_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	7.4e-59
WP_151608538.1|3010932_3014514_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	91.0	0.0e+00
WP_045618223.1|3014564_3015155_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	93.4	1.4e-97
WP_048984735.1|3015142_3015874_-	peptidase P60	NA	K7PJX1	Enterobacterial_phage	97.0	2.1e-143
WP_151608540.1|3015875_3016634_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.2	9.4e-142
WP_017384364.1|3016630_3016969_-|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	99.1	5.0e-63
WP_151608542.1|3016968_3020475_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	68.4	0.0e+00
WP_071698626.1|3020533_3020875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045342758.1|3020961_3021246_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.6	2.7e-41
WP_001549114.1|3021254_3021638_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_032624422.1|3021646_3022090_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
WP_045359093.1|3022149_3022497_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	95.7	9.4e-57
WP_022648887.1|3022493_3022943_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_032648717.1|3022939_3023290_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	92.2	8.9e-55
WP_032648721.1|3023298_3023625_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	90.7	3.4e-48
WP_032648723.1|3023621_3024536_-|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	76.9	4.3e-109
WP_032668515.1|3024532_3025888_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	98.4	1.7e-258
WP_151608544.1|3026091_3028026_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	90.7	0.0e+00
WP_087654008.1|3028084_3029746_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.4	0.0e+00
WP_000954404.1|3029742_3030237_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_032648734.1|3030342_3030711_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	91.8	3.7e-59
WP_032648736.1|3030703_3031297_-	hypothetical protein	NA	S4TR53	Salmonella_phage	85.8	1.8e-100
WP_032648738.1|3031461_3031683_+	hypothetical protein	NA	Q38575	Escherichia_phage	71.2	3.7e-22
WP_032668519.1|3031794_3033252_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	73.6	6.9e-218
WP_032667396.1|3033268_3033496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087654025.1|3033508_3034333_-	hypothetical protein	NA	K7PH02	Enterobacteria_phage	77.4	2.9e-19
WP_032668522.1|3034533_3034749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032668524.1|3035641_3036187_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	69.4	7.1e-51
WP_087654026.1|3036186_3036636_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	79.7	1.7e-58
WP_032668529.1|3036632_3036917_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	51.1	1.2e-17
WP_020454456.1|3036903_3037284_-|holin	holin	holin	F1C592	Cronobacter_phage	80.2	1.9e-50
WP_045347645.1|3037395_3037590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570940.1|3037695_3038181_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
WP_023306760.1|3038475_3039258_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	9.4e-113
WP_032648754.1|3039254_3039566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186531.1|3039567_3041439_-	AAA family ATPase	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
WP_050594988.1|3041542_3042565_-	hypothetical protein	NA	V5URT9	Shigella_phage	55.2	3.1e-47
WP_023063376.1|3042557_3042767_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024262726.1|3042768_3042984_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_023296237.1|3043137_3043830_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_032610623.1|3044001_3044295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032666061.1|3044855_3045089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032668534.1|3045081_3045489_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	78.6	1.1e-43
WP_072159686.1|3045460_3045682_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
WP_032648760.1|3045678_3046092_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	67.2	1.6e-47
WP_032648761.1|3046092_3046317_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	58.3	3.7e-14
WP_023294930.1|3046467_3046704_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	85.9	4.8e-36
WP_032648762.1|3046759_3048073_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	85.3	6.0e-221
WP_045324953.1|3048051_3048825_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
WP_003859737.1|3048876_3049272_+	membrane protein	NA	NA	NA	NA	NA
WP_003859735.1|3049312_3050056_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
WP_032648765.1|3050052_3051024_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
3050292:3050308	attR	AACGCTGATGCGTAACC	NA	NA	NA	NA
WP_099975470.1|3050978_3051218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384404.1|3051198_3051942_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032648766.1|3052020_3052581_-	VOC family protein	NA	NA	NA	NA	NA
WP_059452731.1|3052819_3054553_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.6	2.0e-86
WP_032650070.1|3054587_3055727_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_023303900.1|3055731_3057315_-	MFS transporter	NA	NA	NA	NA	NA
WP_023303901.1|3057575_3057968_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_003859723.1|3057967_3060046_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006811100.1|3060038_3061187_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_032648768.1|3061337_3061982_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763862.1|3061992_3062382_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_003859716.1|3062399_3063449_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_017384409.1|3063445_3064312_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_032648770.1|3064331_3065933_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	73.9	1.3e-07
WP_032648771.1|3065977_3067645_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_032648773.1|3067730_3068693_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032648775.1|3068689_3071074_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_015570266.1|3071049_3071811_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032103963.1|3071827_3072376_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	3123426	3168558	5068785	head,terminase,holin,integrase	Cronobacter_phage(32.0%)	63	3152918:3152933	3171046:3171061
WP_151608552.1|3123426_3125643_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	62.1	1.0e-39
WP_151608554.1|3125700_3128178_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.6	0.0e+00
WP_048245973.1|3128164_3128530_-	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	85.7	3.3e-60
WP_032668726.1|3128553_3129018_-	HNH endonuclease	NA	S4TVL1	Salmonella_phage	42.4	5.5e-28
WP_059512182.1|3129094_3129565_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	2.4e-79
WP_151608481.1|3129564_3130062_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.3	2.5e-87
WP_032647561.1|3130100_3130337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151608479.1|3130336_3133819_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	62.8	4.8e-257
WP_045307639.1|3133877_3134561_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	61.5	4.6e-79
WP_151608477.1|3134620_3135364_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.4	1.3e-71
WP_048984796.1|3135427_3135811_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	8.9e-40
WP_059452793.1|3135807_3136215_-	hypothetical protein	NA	A0A291AXD9	Shigella_phage	51.1	2.3e-30
WP_151608475.1|3136217_3136574_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	3.0e-26
WP_059452717.1|3136573_3136747_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	53.6	1.2e-12
WP_048245854.1|3136746_3137127_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.7	2.0e-28
WP_048245855.1|3137129_3137495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048245857.1|3137504_3138602_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	2.6e-161
WP_032648633.1|3138611_3139046_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
WP_151608473.1|3139049_3140438_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.0	9.7e-153
WP_044704353.1|3140530_3140725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074135794.1|3140756_3141743_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.7	2.2e-111
WP_057059039.1|3141690_3143142_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.8	2.7e-198
WP_057059038.1|3143153_3144701_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.8	1.6e-289
WP_046401556.1|3144697_3145348_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	1.7e-104
WP_057059037.1|3145351_3145570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057059036.1|3145876_3146395_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.2	4.6e-92
WP_059452755.1|3146719_3146914_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.9	1.4e-17
WP_058655468.1|3146864_3147143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023296427.1|3147139_3147682_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	1.6e-74
WP_001514184.1|3147684_3147960_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|3147956_3148358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059452756.1|3148637_3149327_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.9e-57
WP_015705894.1|3149323_3149440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647991.1|3149436_3150081_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	69.6	2.1e-73
WP_059452757.1|3150074_3150575_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	50.7	2.3e-35
WP_063135696.1|3150538_3150709_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	90.6	7.7e-20
WP_023330218.1|3150708_3151146_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.1	7.4e-59
WP_024191555.1|3151381_3151579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063135697.1|3151578_3151848_-	hypothetical protein	NA	NA	NA	NA	NA
3152918:3152933	attL	CCAGCGCCTTAACCAG	NA	NA	NA	NA
WP_032647527.1|3153130_3153649_-	HNH endonuclease	NA	K9K8J2	Salmonella_phage	49.1	2.4e-32
WP_072258162.1|3153626_3153944_-	protein ren	NA	O48423	Enterobacteria_phage	52.6	2.7e-18
WP_151608556.1|3153933_3155307_-	AAA family ATPase	NA	E5AGF0	Erwinia_phage	62.4	4.9e-165
WP_045325428.1|3156706_3157273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760151.1|3157303_3157525_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	98.6	1.8e-32
WP_047345172.1|3157642_3158362_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	95.0	6.6e-129
WP_032655965.1|3158523_3159471_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
WP_023313997.1|3159606_3159804_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	9.2e-25
WP_063133514.1|3160737_3160947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006809788.1|3161103_3161313_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_047058761.1|3161359_3161869_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.1	1.8e-35
WP_047058763.1|3161865_3162144_+	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	92.5	3.6e-43
WP_047058765.1|3162153_3163071_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	3.9e-158
WP_047058767.1|3163067_3163748_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.7	2.2e-126
WP_047058769.1|3163744_3164173_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
WP_048245863.1|3164333_3164885_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.5	3.7e-55
WP_045307574.1|3164881_3165100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045307575.1|3165096_3165663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045307576.1|3165659_3165851_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	3.2e-14
WP_045307577.1|3165942_3166158_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	57.1	1.9e-15
WP_023332830.1|3166157_3166397_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	51.3	9.8e-13
WP_045307579.1|3166762_3166963_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	97.0	1.0e-31
WP_045307580.1|3166971_3167217_+	excisionase	NA	S4TND0	Salmonella_phage	60.0	1.0e-25
WP_045307581.1|3167262_3168558_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	68.4	5.6e-179
3171046:3171061	attR	CTGGTTAAGGCGCTGG	NA	NA	NA	NA
>prophage 7
NZ_CP042551	Enterobacter hormaechei strain C45 chromosome, complete genome	5068785	3261523	3268946	5068785		Enterobacteria_phage(33.33%)	6	NA	NA
WP_032103480.1|3261523_3262528_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	2.5e-33
WP_003859477.1|3262576_3263743_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_017693097.1|3263995_3265402_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.8e-37
WP_023295000.1|3265537_3266086_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_032103483.1|3266999_3267866_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.2e-110
WP_032103484.1|3267881_3268946_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
>prophage 1
NZ_CP042552	Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence	288659	71652	123797	288659	transposase,protease	Escherichia_phage(25.0%)	57	NA	NA
WP_001585166.1|71652_72732_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|72733_73507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|73499_74642_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|74651_75710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|76030_76612_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|76611_77769_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|77791_78247_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78269_79310_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|79358_79937_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|80005_80581_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|81009_82251_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|82341_82797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|83037_83229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|83320_83662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|84648_84903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|84905_86945_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|86941_87928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|88848_89241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|89219_89531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|89899_90556_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|90595_90778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|90758_91256_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|91260_92649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|93049_93343_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|93347_94673_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|94733_94940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|95040_95451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|95463_95988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|96169_97174_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|97264_97699_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287661.1|97784_100190_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|100186_101263_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000993245.1|101271_101484_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|101446_101566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|101549_101786_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|101782_102148_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|102165_103851_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|103889_104315_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|104342_104618_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|104633_104999_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|105070_105526_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|106203_106629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|107177_107486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|107501_108359_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194554.1|108420_108624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|108965_109370_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|109547_109841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|109866_110103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|110657_111323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|111380_111761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|112090_112951_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|113133_113691_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|113854_116860_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001067855.1|120873_121578_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|121657_122158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|122307_122949_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|123092_123797_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP042552	Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence	288659	127438	159539	288659	transposase	uncultured_Caudovirales_phage(46.15%)	39	NA	NA
WP_001067855.1|127438_128143_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001572372.1|128308_128785_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572373.1|128861_130481_-	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572374.1|130669_131593_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
WP_004248839.1|131676_133023_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_000723070.1|133240_133675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|133932_135048_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|135170_135443_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000193207.1|135908_136727_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001371952.1|136723_137929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121164.1|137992_138196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078513.1|138208_139528_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833380.1|139778_141206_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000464825.1|141420_141936_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975181.1|141938_142835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|142882_143197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|143270_143528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371948.1|143586_143820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|143865_144120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443289.1|144157_144445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|144514_144712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864986.1|144852_145128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000927306.1|145619_147098_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|147116_147944_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|148003_148429_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|148441_149731_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|149776_150097_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|150183_150888_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000125668.1|150920_152324_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_012695466.1|152543_153467_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_001567369.1|153586_154219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|154247_155651_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000785965.1|155864_156182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100610.1|156204_156510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|156554_157226_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001371904.1|157683_158091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|158141_158459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122966916.1|158427_158643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100185530.1|158624_159539_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
>prophage 3
NZ_CP042552	Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence	288659	202694	229533	288659	integrase,transposase,protease	Escherichia_phage(33.33%)	32	211599:211613	224625:224639
WP_000219087.1|202694_203933_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_000589001.1|204354_205695_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_085949440.1|205869_207239_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000137794.1|207571_208177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|208393_208675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|209050_209362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|209584_209785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|209824_210049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781547.1|210103_210307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143014.1|210486_210780_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
WP_001371932.1|210859_211351_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|211355_211667_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
211599:211613	attL	CATATTGATGTTATC	NA	NA	NA	NA
WP_000071366.1|212183_212504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|212682_212913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252081.1|213084_213978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|214287_214992_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000057569.1|215331_215673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248792.1|215687_216479_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000480968.1|216659_217496_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|217495_218299_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000845039.1|218456_219470_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_072058701.1|219438_219690_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019304.1|220072_220642_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_002008781.1|220641_221142_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000050481.1|221407_222949_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|223353_224193_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|224186_224522_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|224414_224780_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
224625:224639	attR	CATATTGATGTTATC	NA	NA	NA	NA
WP_004193231.1|224783_225659_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012579084.1|225844_226501_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000050481.1|226764_228306_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001389365.1|228768_229533_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 4
NZ_CP042552	Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence	288659	234492	252646	288659	integrase,transposase	Escherichia_phage(72.73%)	20	227826:227840	248877:248891
227826:227840	attL	TTTTGATCAGATGAG	NA	NA	NA	NA
WP_012695485.1|234492_235302_-	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
WP_006473457.1|235543_236899_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695484.1|237386_237968_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_002075255.1|238130_239144_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001550559.1|239411_239903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|239936_240641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538079.1|240631_240814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002904004.1|240777_241638_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|241658_242420_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|242410_242644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|242681_243584_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|245217_245922_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|246001_246502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|246651_247293_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|247436_248141_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000159617.1|248656_248851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|248847_249159_-	hypothetical protein	NA	NA	NA	NA	NA
248877:248891	attR	TTTTGATCAGATGAG	NA	NA	NA	NA
WP_001180999.1|249221_249461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|251276_251606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646498.1|251722_252646_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
>prophage 1
NZ_CP042553	Enterobacter hormaechei strain C45 plasmid pC45_002, complete sequence	173758	5791	58098	173758	integrase,transposase	Escherichia_phage(43.75%)	48	23500:23559	39015:39215
WP_012817690.1|5791_8800_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_071787999.1|8905_9184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|9404_9734_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|9714_9996_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|10273_11254_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_022652299.1|11576_12185_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652298.1|12561_14373_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	79.8	1.1e-302
WP_022652297.1|14369_15743_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_022652296.1|15791_17057_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_022652295.1|17358_18543_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_022652294.1|18649_20119_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	6.9e-48
WP_022652293.1|20138_21569_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_032430963.1|21786_22575_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001067834.1|22722_23427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|23460_23733_-	hypothetical protein	NA	NA	NA	NA	NA
23500:23559	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
WP_000845039.1|23701_24715_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|24867_25608_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|25839_26172_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|26298_26853_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|26947_27580_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000846390.1|27648_28449_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001206316.1|28465_29257_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_020956917.1|29745_30645_+	class A extended-spectrum beta-lactamase VEB-3	NA	NA	NA	NA	NA
WP_151532708.1|31650_32136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039272567.1|35330_38363_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039272634.1|38359_38953_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
WP_120783633.1|38987_39248_-|transposase	transposase	transposase	NA	NA	NA	NA
39015:39215	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
WP_063840321.1|40304_40859_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|40989_41820_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|41957_42590_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|42674_43127_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|43349_43697_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|43690_44530_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|44459_44639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|44657_44861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|45016_46222_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|46232_46538_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|46553_46736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|46764_47529_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|47719_48076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|48021_48606_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|48605_49844_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|49840_50746_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|50867_51572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|51804_52665_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|53033_53738_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000215515.1|56634_56991_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067848.1|57393_58098_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP042553	Enterobacter hormaechei strain C45 plasmid pC45_002, complete sequence	173758	69400	123522	173758	integrase,transposase	Escherichia_phage(21.74%)	48	102809:102824	125307:125322
WP_001395480.1|69400_70432_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001118618.1|71253_72177_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_022652268.1|74918_75902_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	1.3e-47
WP_001166628.1|75995_76451_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|76522_76918_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|76933_77209_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|77236_77662_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|77700_79386_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|79403_79769_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_022652270.1|79765_80002_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|79985_80105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|80067_80280_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|80479_81184_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|81510_82011_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_087893729.1|82084_83357_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_016947617.1|83663_84644_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|84921_85203_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|85183_85513_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_022652300.1|85931_86885_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|87505_88216_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|88217_89423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|89419_90571_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|90567_91176_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652300.1|91363_92317_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032645789.1|92571_92757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050483874.1|92907_93417_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021314637.1|94588_94819_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_022652307.1|95096_95300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032430841.1|95381_96209_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652309.1|96226_97705_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430957.1|98211_99234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059331197.1|99991_100135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652310.1|100309_101050_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022652311.1|101375_102365_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
102809:102824	attL	TACCTGCTCCTGCCAG	NA	NA	NA	NA
WP_022652312.1|103220_103490_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652313.1|103493_104024_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077873527.1|104155_105049_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
WP_022652315.1|106150_107302_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001201739.1|107410_107794_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|107790_108138_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|108187_109723_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_032430835.1|109779_111138_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
WP_022652317.1|111963_113130_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_022652318.1|113129_114095_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652236.1|116123_118262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652237.1|118565_119999_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_022652238.1|120032_121247_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_022652239.1|121395_123522_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
125307:125322	attR	TACCTGCTCCTGCCAG	NA	NA	NA	NA
