The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	0	4785	4635862		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001301979.1|967_1387_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|1394_2900_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|2904_3870_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056271.1|3894_4785_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	2.5e-05
>prophage 2
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	28293	33707	4635862		Bacillus_phage(33.33%)	4	NA	NA
WP_001238899.1|28293_30315_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.2e-113
WP_001295254.1|30361_31846_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|31981_33247_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|33377_33707_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 3
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	37749	43893	4635862		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001340422.1|37749_38880_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006621.1|38876_40139_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|40138_41206_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|41224_42106_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|42083_42758_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|42762_43893_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 4
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	51968	53624	4635862		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395863.1|51968_53624_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 5
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	63903	67762	4635862		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|63903_64800_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|64799_65516_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|65599_67762_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 6
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	73480	75310	4635862		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|73480_75310_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 7
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	87842	91129	4635862		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|87842_89483_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|89561_89831_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|89834_90350_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|90352_91129_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 8
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	100108	100723	4635862		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|100108_100723_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 9
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	114582	117369	4635862		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|114582_117369_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 10
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	121485	123956	4635862		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|121485_122895_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|122906_123956_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 11
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	140291	143071	4635862		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|140291_141188_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|141355_142252_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|142285_143071_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 12
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	150388	153439	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|150388_153439_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 13
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	164994	169855	4635862		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_000122641.1|164994_165615_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|165874_166858_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|167006_167681_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|167786_169160_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|169156_169855_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 14
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	181429	185932	4635862		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|181429_182275_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|182699_182945_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|183029_183515_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|183607_184534_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|184600_185932_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 15
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	203230	210477	4635862		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|203230_203893_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174077.1|203904_206406_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|206714_207794_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|207808_208129_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|208179_210477_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 16
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	227823	229668	4635862		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591375.1|227823_229668_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 17
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	238260	241313	4635862		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|238260_239211_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|240128_241313_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 18
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	245429	253758	4635862		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|245429_249458_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|249534_253758_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 19
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	262974	264738	4635862		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|262974_263646_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|263688_264279_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|264465_264738_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 20
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	270127	271717	4635862		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|270127_271717_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 21
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	288012	291696	4635862		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|288012_291696_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 22
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	301954	303490	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011597362.1|301954_303490_+	p-hydroxycinnamoyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.7	7.7e-42
>prophage 23
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	315849	316965	4635862		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|315849_316965_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 24
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	326180	326789	4635862		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|326180_326789_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 25
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	333379	335927	4635862		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|333379_334795_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|334847_335927_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 26
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	340114	343727	4635862		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|340114_342937_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|343190_343727_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 27
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	347544	348894	4635862		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|347544_348894_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 28
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	354478	356437	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|354478_356437_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 29
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	366173	368321	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|366173_368321_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 30
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	373566	379935	4635862		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066019.1|373566_375552_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
WP_001171687.1|375824_376754_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|376737_377433_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|377443_378424_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|378402_379935_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.8e-20
>prophage 31
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	386169	387719	4635862		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|386169_386850_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|386960_387719_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 32
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	393331	394120	4635862		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|393331_394120_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 33
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	399456	400959	4635862		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|399456_400959_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 34
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	422154	425366	4635862	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|422154_423672_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|423908_425366_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 35
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	439642	441626	4635862		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|439642_439936_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|439979_441626_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 36
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	446143	446677	4635862		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|446143_446677_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 37
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	451597	452575	4635862		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|451597_452575_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 38
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	460558	461104	4635862		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|460558_461104_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 39
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	465019	478050	4635862	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|465019_466357_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|466366_468214_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|468206_469157_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|469242_469551_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460362.1|469626_470907_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|470992_472252_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|472254_473259_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|473340_473538_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|473641_474940_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|475144_475570_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|475608_478050_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 40
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	481982	483146	4635862		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943959.1|481982_483146_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	6.4e-81
>prophage 41
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	518076	524564	4635862		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|518076_518607_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265913.1|518916_519873_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|520012_521515_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001313531.1|521528_522551_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596014.1|522537_523533_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|523565_524564_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 42
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	528854	531615	4635862		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|528854_529319_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187778.1|529476_531615_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 43
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	536579	541350	4635862		Paramecium_bursaria_Chlorella_virus(100.0%)	4	NA	NA
WP_000471889.1|536579_539276_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|539481_539868_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|539940_540402_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|540414_541350_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 44
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	549936	559018	4635862	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416392.1|549936_552792_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786400.1|552791_553235_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|553394_554906_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|555172_556273_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|556272_557355_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294573.1|557515_559018_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
>prophage 45
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	564144	568454	4635862	transposase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_001309160.1|564144_565164_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_085947917.1|567181_568454_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 46
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	576420	581369	4635862	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_001254932.1|576420_577572_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000177057.1|578830_579088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|579644_580412_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684852.1|580412_581369_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 47
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	605568	606549	4635862		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|605568_606549_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 48
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	609911	611588	4635862		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|609911_610514_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|610991_611588_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 49
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	621855	623316	4635862		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208205.1|621855_623316_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 50
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	629884	630439	4635862		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|629884_630439_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 51
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	660611	665967	4635862		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919536.1|660611_662267_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410113.1|662315_663677_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091570.1|663891_664806_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|664944_665967_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 52
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	669192	670472	4635862		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|669192_669930_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|669932_670472_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 53
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	678368	681244	4635862		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|678368_679958_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|680350_680956_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|681082_681244_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 54
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	687183	688506	4635862		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477807.1|687183_688506_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 55
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	696269	701625	4635862		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093814.1|696269_697502_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
WP_000046749.1|697809_699477_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|699687_701625_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 56
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	704961	707075	4635862		Bacillus_phage(50.0%)	2	NA	NA
WP_001188654.1|704961_705651_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
WP_001219577.1|705650_707075_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
>prophage 57
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	718844	729262	4635862	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130185.1|718844_719798_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|719912_720500_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|720534_721101_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|721249_721963_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843565.1|721988_722393_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|722769_724686_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118476.1|724774_725905_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
WP_001300563.1|726051_727164_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|727357_727567_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681354.1|728095_729262_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.5	3.4e-90
>prophage 58
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	732997	735814	4635862	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|732997_735814_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 59
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	740257	741406	4635862		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|740257_741406_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 60
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	746877	752538	4635862		Hepacivirus(50.0%)	4	NA	NA
WP_001350478.1|746877_748431_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	2.1e-31
WP_000349936.1|748504_749722_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|749850_750993_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|751023_752538_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 61
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	760429	761829	4635862		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|760429_760909_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|760986_761829_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 62
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	770964	780021	4635862		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001117011.1|770964_773871_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035670.1|774035_776387_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_051983899.1|776461_777181_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_001300811.1|777480_778359_+	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_001148390.1|778444_779209_+	DedA family protein	NA	NA	NA	NA	NA
WP_000916281.1|779322_780021_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 63
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	792723	794448	4635862		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|792723_794448_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 64
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	820537	821581	4635862		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|820537_821581_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 65
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	825826	826378	4635862		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|825826_826378_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 66
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	835005	836430	4635862		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|835005_836430_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 67
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	844176	850799	4635862		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|844176_845727_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|845928_848319_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|848524_849061_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|849101_849764_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|849872_850799_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 68
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	854061	854964	4635862		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|854061_854964_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 69
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	864822	871628	4635862	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|864822_866241_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|866279_867206_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|867242_867698_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|867875_868580_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|868594_869125_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001350480.1|869198_871628_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 70
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	876871	877669	4635862		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|876871_877669_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 71
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	883703	884048	4635862		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|883703_884048_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 72
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	887977	889402	4635862	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|887977_889402_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 73
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	901999	902758	4635862		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|901999_902758_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 74
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	911586	915702	4635862		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|911586_912183_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|912219_915702_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 75
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	928707	929739	4635862		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|928707_929739_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 76
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	936260	943892	4635862		Indivirus(25.0%)	9	NA	NA
WP_000997010.1|936260_937064_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|937060_937975_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|938215_939016_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|939019_939643_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|939690_941049_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|941120_941876_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|941909_942632_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|942628_943096_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|943160_943892_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 77
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	950636	1007252	4635862	transposase,integrase	Streptococcus_phage(15.38%)	58	969216:969275	1003524:1003583
WP_000284050.1|950636_951215_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|951420_952188_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|952158_952899_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|953054_953333_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|953335_953596_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|953805_954555_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|954730_955228_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|955451_957191_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|957150_957921_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|957991_959047_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|959098_959392_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|959394_959793_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|959802_960255_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|960560_960827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|960759_961296_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|961352_962810_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|963070_963529_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|963620_964865_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|964922_965324_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|965362_966418_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|966705_967809_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|967820_969074_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
969216:969275	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|969645_969987_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|970007_970325_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|970343_970565_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|970573_971050_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|971065_971524_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|971621_971861_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|971937_972405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|972427_972871_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|972870_973098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|973501_974323_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|974414_975278_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|975606_976500_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|976920_978072_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|980418_981435_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|981642_983046_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|983032_983965_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|984073_985120_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|986341_986680_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|986702_987053_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|987146_988301_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|988595_989504_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|989518_991486_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|991712_993095_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|993106_994717_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|994721_995480_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|995618_996623_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|997817_998549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|998639_999266_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_151576321.1|999537_1000236_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1000262_1001117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1001235_1001460_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1001456_1001897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1002013_1003414_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|1003698_1004109_-	hypothetical protein	NA	NA	NA	NA	NA
1003524:1003583	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000121359.1|1004087_1005044_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|1005053_1007252_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 78
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1021608	1026319	4635862	transposase	Acinetobacter_phage(50.0%)	4	NA	NA
WP_085947771.1|1021608_1022770_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|1024043_1024637_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|1024648_1024885_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|1024993_1026319_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 79
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1031894	1037814	4635862	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|1031894_1033565_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|1033578_1035051_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|1035064_1035652_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|1035780_1037814_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 80
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1049201	1050251	4635862		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|1049201_1050251_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 81
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1059023	1060910	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010288.1|1059023_1060910_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 82
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1064108	1065008	4635862		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|1064108_1065008_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 83
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1071267	1072350	4635862		Enterobacteria_phage(100.0%)	1	NA	NA
WP_071843335.1|1071267_1072350_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.7	2.2e-192
>prophage 84
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1076661	1080944	4635862	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_001254932.1|1076661_1077813_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000160710.1|1078177_1078987_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000044314.1|1078983_1079934_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|1079930_1080944_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 85
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1084524	1088641	4635862	transposase	Prochlorococcus_phage(50.0%)	5	NA	NA
WP_000842106.1|1084524_1085634_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_001141271.1|1085668_1085944_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000596084.1|1086131_1086905_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000012218.1|1086906_1087350_-	transferase	NA	NA	NA	NA	NA
WP_085947917.1|1087368_1088641_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 86
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1092269	1093037	4635862		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|1092269_1093037_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 87
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1097801	1102350	4635862	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_085947771.1|1097801_1098964_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001295335.1|1100568_1101192_+	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_000830741.1|1101192_1102350_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 88
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1109765	1110881	4635862		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1109765_1110881_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 89
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1115170	1125247	4635862		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|1115170_1116082_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|1116206_1117115_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|1117359_1118544_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698951.1|1118669_1121816_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|1121812_1123015_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|1123204_1123894_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|1123951_1125247_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 90
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1132199	1141180	4635862	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1132199_1133327_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1133349_1133682_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1133709_1135557_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1135567_1136539_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1136667_1137015_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1137191_1138076_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|1138374_1138914_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1139064_1139514_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|1139517_1140621_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|1140709_1141180_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 91
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1162739	1167786	4635862	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1162739_1163363_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1163488_1164763_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1164950_1167305_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1167513_1167786_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 92
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1170914	1171610	4635862		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|1170914_1171610_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 93
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1174933	1178480	4635862		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|1174933_1176706_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|1176698_1178480_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 94
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1187316	1190466	4635862		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1187316_1190466_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 95
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1197474	1206036	4635862		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1197474_1198026_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|1198154_1200086_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1200138_1200468_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1200467_1201073_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1201182_1203057_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1203237_1203882_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|1204117_1205080_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801813.1|1205076_1206036_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 96
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1214280	1217442	4635862		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|1214280_1214622_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|1214937_1217442_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 97
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1221981	1288160	4635862	integrase,protease,transposase,lysis,terminase,tRNA	Enterobacteria_phage(48.28%)	69	1270818:1270864	1295611:1295657
WP_001157540.1|1221981_1222659_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
WP_001295323.1|1222645_1223425_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001300573.1|1223487_1224342_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|1224402_1225212_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1225201_1225825_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1225795_1226482_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1226478_1228893_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1229323_1233604_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1233643_1234012_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1234702_1234963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1236194_1237289_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1237357_1238284_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1238513_1238996_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1239073_1239889_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1239978_1241760_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1241772_1242549_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1242648_1243527_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1243695_1245150_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1245209_1246571_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1246627_1247929_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1247950_1249096_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1249323_1250109_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1250119_1251355_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1251376_1252426_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1252742_1254410_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1254419_1255679_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1255689_1256505_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1256501_1257395_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1257589_1258657_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1258653_1259163_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1259280_1260003_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1260005_1260500_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1260673_1262059_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1262094_1262616_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1262723_1262936_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1262937_1263804_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1264274_1264817_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1265036_1265729_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1265759_1268363_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1268341_1269382_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1269392_1269908_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1269910_1270543_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1270818:1270864	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1270877_1272041_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1272160_1272424_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1272746_1272842_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|1272904_1274066_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|1274377_1274710_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1274757_1274907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1274964_1276491_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1276955_1277507_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1277516_1278314_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1278430_1278532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1278528_1278984_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1278983_1279154_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1279146_1279437_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1279433_1279796_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1279792_1279933_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1280018_1280402_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1280799_1281816_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1281820_1282888_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1283460_1283676_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1283675_1284173_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1284389_1284572_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1284662_1284956_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1285246_1285657_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1285942_1286149_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1286313_1286508_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1286896_1287442_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1287416_1288160_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1295611:1295657	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 98
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1302881	1304997	4635862		Hokovirus(50.0%)	2	NA	NA
WP_000253839.1|1302881_1304324_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|1304313_1304997_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 99
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1308267	1311411	4635862		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|1308267_1311411_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 100
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1323710	1329753	4635862		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|1323710_1327592_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|1327807_1328941_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|1328937_1329753_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 101
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1344300	1346123	4635862		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|1344300_1344930_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029814.1|1344902_1346123_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 102
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1349306	1351421	4635862		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1349306_1350872_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|1350992_1351421_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 103
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1366845	1367492	4635862		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1366845_1367055_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|1367108_1367492_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 104
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1372305	1374744	4635862		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1372305_1373517_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|1373655_1374744_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 105
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1381754	1384337	4635862	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|1381754_1384337_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 106
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1391276	1398567	4635862	transposase	Bathycoccus_sp._RCC1105_virus(33.33%)	7	NA	NA
WP_000367875.1|1391276_1392947_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|1393030_1393966_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1394083_1394809_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_000272824.1|1394808_1395483_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000020941.1|1395482_1396223_-	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_001177086.1|1396392_1397301_-	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_010723085.1|1397550_1398567_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 107
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1401891	1402971	4635862		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1401891_1402971_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 108
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1407066	1408731	4635862		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1407066_1408731_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 109
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1413497	1417311	4635862	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_038432907.1|1413497_1415444_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|1415646_1417311_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 110
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1430609	1443330	4635862		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|1430609_1431287_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|1431283_1433968_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|1433960_1434533_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|1434541_1436590_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741129.1|1436612_1438286_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|1438285_1438375_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|1438687_1438894_+	YbfA family protein	NA	NA	NA	NA	NA
WP_000015200.1|1439136_1443330_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
>prophage 111
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1449060	1452110	4635862		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|1449060_1450479_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|1450628_1452110_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 112
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1455488	1456280	4635862		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|1455488_1456280_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 113
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1492719	1496239	4635862		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1492719_1493439_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|1493435_1494377_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|1494490_1494871_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|1495186_1496239_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 114
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1500592	1507166	4635862		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|1500592_1501609_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|1501869_1503342_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|1503409_1504198_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1504326_1504476_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|1504642_1505416_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1505415_1506105_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|1506107_1507166_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 115
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1517521	1518811	4635862		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|1517521_1518811_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 116
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1525292	1526201	4635862		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1525292_1526201_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 117
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1536798	1551610	4635862		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|1536798_1538535_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001393495.1|1538527_1539523_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1539525_1540197_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|1540425_1541790_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|1542021_1542504_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|1542623_1544774_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|1544801_1545764_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|1545904_1546990_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|1547218_1547479_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|1547743_1548010_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|1548083_1548761_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430057.1|1548802_1551085_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1551349_1551610_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 118
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1555294	1560519	4635862		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|1555294_1556017_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|1556013_1556673_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1556811_1557558_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1557961_1558465_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1558763_1559651_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1559885_1559951_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1560003_1560519_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 119
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1565516	1573858	4635862		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|1565516_1567109_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|1567349_1568615_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|1568766_1569582_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209309.1|1569727_1572160_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|1572165_1573065_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|1573195_1573858_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 120
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1577073	1578945	4635862		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|1577073_1578945_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 121
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1590280	1591483	4635862		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|1590280_1591483_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 122
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1600049	1609199	4635862		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|1600049_1600307_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1600466_1600754_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1600737_1601460_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1601520_1602423_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1602510_1602987_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1603337_1604450_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1604544_1605678_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|1605687_1606641_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1606637_1607483_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1607542_1608031_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1608071_1609199_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
>prophage 123
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1612559	1615297	4635862		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|1612559_1613288_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1613505_1614021_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1614146_1614470_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1614466_1615297_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 124
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1618884	1620603	4635862		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815337.1|1618884_1620603_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 125
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1629900	1653585	4635862	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188144.1|1629900_1631847_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1631919_1632144_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1632466_1632787_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1632817_1635094_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1635778_1635997_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1636281_1636986_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202177.1|1637027_1638749_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043598.1|1638749_1640516_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|1640638_1641604_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1642148_1642643_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000076967.1|1642777_1646767_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1646925_1647537_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1647547_1648891_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1648981_1650274_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|1650512_1652957_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1652967_1653585_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 126
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1659893	1660634	4635862		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000111043.1|1659893_1660634_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 127
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1669647	1670736	4635862		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|1669647_1670736_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 128
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1675822	1680364	4635862		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1675822_1676107_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|1676314_1678579_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1678615_1680364_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 129
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1695069	1706039	4635862	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1695069_1695618_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|1695644_1696292_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1696513_1697704_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|1697888_1698977_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1699579_1700980_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|1701148_1702351_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|1702616_1705229_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|1705271_1706039_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 130
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1721958	1723866	4635862		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|1721958_1723866_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 131
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1736465	1738520	4635862		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|1736465_1738520_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 132
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1742753	1743413	4635862	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1742753_1743413_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 133
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1757035	1769350	4635862		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1757035_1757248_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1757258_1757447_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|1757421_1757652_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1757641_1757815_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|1757863_1758937_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|1759008_1761753_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|1761835_1762864_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|1762836_1763529_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1763658_1764831_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|1764830_1767377_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209894.1|1767373_1767973_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1768124_1768430_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|1768429_1769350_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 134
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1773655	1775929	4635862		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1773655_1773829_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|1774085_1775414_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|1775434_1775929_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 135
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1790566	1791631	4635862		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|1790566_1791631_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 136
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1798450	1801012	4635862	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409873.1|1798450_1799809_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_085947771.1|1799849_1801012_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 137
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1806425	1807259	4635862		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1806425_1807259_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 138
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1811394	1811928	4635862		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1811394_1811928_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 139
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1821236	1822157	4635862		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1821236_1822157_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 140
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1826816	1827062	4635862		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1826816_1827062_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 141
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1842945	1843887	4635862		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1842945_1843887_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 142
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1856244	1857426	4635862		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1856244_1856979_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1857189_1857426_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 143
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1860698	1862341	4635862		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1860698_1861340_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|1861336_1862341_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 144
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1874647	1874905	4635862		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1874647_1874905_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 145
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1882193	1885934	4635862		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|1882193_1882895_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|1882894_1884139_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1884167_1885079_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|1885094_1885934_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 146
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1889191	1891169	4635862		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1889191_1890049_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1890032_1891169_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 147
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1896190	1919634	4635862	integrase,portal,tail,plate,tRNA	Shigella_phage(23.81%)	34	1890236:1890250	1926337:1926351
1890236:1890250	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_000423742.1|1896190_1897561_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1897564_1898206_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1898241_1899348_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1899401_1899863_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1899872_1900526_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1900697_1901948_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1902441_1903107_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1903107_1903812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1904269_1905163_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1905253_1906381_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1906361_1906607_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1906643_1906955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1907071_1907413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1907350_1907659_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1907833_1908508_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1908598_1908799_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1908842_1909400_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1909575_1909755_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1909744_1911112_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1911123_1911306_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1911305_1911779_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1911705_1912497_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1912487_1913072_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1913075_1913705_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1913706_1914120_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1914091_1914694_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1914693_1915188_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1915259_1915814_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1915920_1916754_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1916987_1917152_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1917254_1917578_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1918114_1918225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1918277_1918682_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1918902_1919634_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1926337:1926351	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 148
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1926708	1927797	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|1926708_1927797_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 149
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1936341	1938029	4635862		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1936341_1936761_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1936760_1938029_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 150
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1964698	1967450	4635862		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1964698_1966378_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1966502_1967450_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 151
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1970586	1974594	4635862		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1970586_1971669_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|1971668_1972502_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|1972498_1972891_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1972894_1973704_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1973739_1974594_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 152
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1977693	1977924	4635862		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|1977693_1977924_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 153
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	1989178	1999719	4635862		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|1989178_1990717_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571681.1|1990713_1991424_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160108.1|1991423_1992101_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|1993356_1994199_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1994248_1994707_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|1994819_1995725_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1995816_1996830_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1997031_1997940_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1998083_1998497_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|1999101_1999719_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 154
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2009129	2011144	4635862		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110948.1|2009129_2010143_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	5.8e-14
WP_000994906.1|2010139_2011144_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 155
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2022802	2025760	4635862		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001340286.1|2022802_2024161_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|2024164_2025760_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 156
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2032729	2038021	4635862	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|2032729_2033488_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|2033707_2034757_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|2034792_2035044_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|2035423_2038021_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 157
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2042945	2043536	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2042945_2043536_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 158
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2051353	2057010	4635862		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|2051353_2053288_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|2053355_2054483_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2054626_2055415_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|2055782_2056136_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|2056203_2057010_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 159
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2069925	2071191	4635862		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|2069925_2071191_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 160
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2100451	2141269	4635862	integrase,transposase,tail,lysis,tRNA	Escherichia_phage(45.16%)	43	2101598:2101616	2131973:2131991
WP_010723085.1|2100451_2101468_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2101598:2101616	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2101740_2101998_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2102047_2102998_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2103149_2103902_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|2104096_2104612_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2104622_2106149_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2106185_2107631_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|2107630_2108941_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|2109116_2110025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2110354_2110918_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2110938_2112171_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2112425_2113409_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2113886_2115260_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2115388_2116324_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2116375_2117611_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2117612_2117828_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2117906_2118116_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2118108_2118303_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2118359_2119169_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2119161_2121762_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2121863_2122139_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2122213_2122384_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2122383_2122605_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2123046_2123535_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2123531_2123687_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2124140_2124617_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2124740_2125037_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2125059_2125482_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2125494_2126352_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2126358_2127105_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2127127_2127688_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2127775_2127961_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2128157_2129615_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2129752_2130016_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2129996_2130356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2132121_2133102_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2131973:2131991	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|2133424_2136787_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|2136786_2137362_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2137459_2138050_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2138366_2138600_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2138668_2138782_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2139560_2139995_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2140135_2141269_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 161
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2146229	2147219	4635862		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|2146229_2147219_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 162
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2172296	2174885	4635862	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085947917.1|2172296_2173570_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|2173733_2174885_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 163
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2187436	2191339	4635862		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|2187436_2191339_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 164
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2195277	2196226	4635862		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|2195277_2195808_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|2196052_2196226_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 165
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2208032	2218206	4635862	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_000826416.1|2208032_2209241_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001326689.1|2209280_2210495_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|2210547_2211084_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001303492.1|2211156_2213118_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|2213209_2213440_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|2213661_2213838_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|2213883_2214300_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760626.1|2214378_2215785_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|2216029_2217175_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|2217192_2218206_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 166
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2225338	2227441	4635862		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|2225338_2227441_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 167
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2241684	2243229	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|2241684_2243229_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 168
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2250113	2250404	4635862		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|2250113_2250404_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 169
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2256773	2258214	4635862		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|2256773_2257058_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|2257203_2258214_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 170
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2261487	2263393	4635862		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|2261487_2262414_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193547.1|2262406_2263393_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 171
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2267709	2271516	4635862		Klosneuvirus(50.0%)	2	NA	NA
WP_001360132.1|2267709_2270109_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|2270133_2271516_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 172
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2276782	2283718	4635862		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_010723101.1|2276782_2279578_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
WP_000832437.1|2279622_2281995_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628576.1|2282032_2283718_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 173
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2297040	2298441	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_001083595.1|2297040_2298441_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 174
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2305865	2307401	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|2305865_2307401_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
>prophage 175
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2315282	2316230	4635862		Bacillus_virus(100.0%)	1	NA	NA
WP_000878968.1|2315282_2316230_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
>prophage 176
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2323949	2324333	4635862		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|2323949_2324333_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 177
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2327335	2328226	4635862		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|2327335_2328226_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 178
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2333590	2353039	4635862	tail,lysis	Enterobacteria_phage(39.13%)	36	NA	NA
WP_000214712.1|2333590_2333794_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527743.1|2333828_2335289_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2335377_2336661_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2337265_2337379_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2337447_2337681_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|2337997_2338588_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2338685_2339261_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2339260_2340223_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2340173_2340743_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2341131_2341365_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2341422_2341833_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2341984_2342158_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2342329_2342485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2342563_2342629_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2342631_2342820_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2342830_2343043_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2343405_2343903_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2343899_2344433_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2344429_2344741_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2344745_2344961_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2345714_2345930_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2346230_2346443_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2346497_2346587_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2346864_2347617_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|2347630_2348680_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|2348681_2348960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2349026_2349278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2349494_2349650_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2349721_2350009_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2350008_2350248_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2350272_2350578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2350780_2351113_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2351549_2351699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2351995_2352226_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2352309_2352717_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2352883_2353039_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 179
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2357271	2369496	4635862		Escherichia_phage(57.14%)	12	NA	NA
WP_000836066.1|2357271_2358291_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2358302_2359517_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2359722_2360049_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2360183_2360525_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2360559_2361120_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2361122_2361833_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2361940_2362246_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|2362444_2364871_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|2364931_2367355_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|2367365_2367983_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|2367984_2368839_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2368881_2369496_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 180
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2387257	2388559	4635862		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|2387257_2388559_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 181
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2398635	2400447	4635862		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2398635_2400447_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 182
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2420323	2421598	4635862	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2420323_2421598_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 183
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2428509	2430008	4635862		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|2428509_2429031_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|2429111_2430008_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 184
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2438810	2447618	4635862		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|2438810_2439626_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2439753_2440335_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|2440496_2441666_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2441831_2441921_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2442219_2443245_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|2443241_2444174_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182347.1|2444286_2445498_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|2445788_2446937_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|2446976_2447618_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 185
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2453122	2455389	4635862		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|2453122_2453935_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|2453938_2454724_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|2454720_2455389_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 186
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2463678	2468762	4635862		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|2463678_2464899_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|2464895_2466167_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|2466141_2466888_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000089364.1|2466897_2468385_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2468393_2468762_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 187
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2487352	2506946	4635862	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553704.1|2487352_2489053_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.0e-31
WP_000069375.1|2489109_2491488_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2491820_2492654_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|2492810_2493857_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2493988_2494180_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|2494183_2495620_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|2495682_2496396_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|2496642_2497107_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029474.1|2497184_2497934_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|2497933_2498485_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|2498547_2499528_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2499628_2499928_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|2499932_2502320_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2502334_2503318_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2503601_2503646_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2503768_2504125_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2504177_2504375_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2504471_2505014_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2505017_2506946_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 188
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2518242	2520504	4635862		Tupanvirus(100.0%)	1	NA	NA
WP_000077872.1|2518242_2520504_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 189
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2526833	2527661	4635862		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|2526833_2527661_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 190
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2535137	2536358	4635862		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|2535137_2536358_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 191
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2543122	2543776	4635862		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|2543122_2543776_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 192
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2549374	2551336	4635862		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|2549374_2551336_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 193
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2556262	2560347	4635862		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|2556262_2556904_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438807.1|2556996_2558355_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|2558471_2559230_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|2559366_2560347_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 194
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2569157	2570012	4635862		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|2569157_2570012_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 195
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2573330	2577907	4635862		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|2573330_2574614_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|2574760_2576236_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|2576416_2577907_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 196
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2592436	2600542	4635862	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2592436_2594122_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2594326_2594908_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|2594947_2595643_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128841.1|2595700_2597611_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	6.5e-91
WP_001295493.1|2597742_2598087_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2598448_2598808_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2598927_2599107_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854958.1|2599180_2600542_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 197
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2604404	2605961	4635862		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2604404_2605961_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 198
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2611601	2611811	4635862		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2611601_2611811_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 199
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2617143	2619192	4635862		Moraxella_phage(100.0%)	1	NA	NA
WP_001055791.1|2617143_2619192_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 200
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2626688	2631158	4635862		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|2626688_2627345_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976476.1|2627740_2628082_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879289.1|2628094_2628967_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2628970_2629345_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2629483_2629714_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2629815_2630472_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2630495_2631158_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 201
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2639214	2640690	4635862		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2639214_2640690_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 202
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2644688	2651752	4635862		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2644688_2646011_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2646026_2646959_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2647037_2647793_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571480.1|2647789_2648575_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2648721_2649732_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2649740_2650352_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|2650490_2650556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|2650626_2651229_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2651230_2651752_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 203
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2655770	2657821	4635862		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|2655770_2656589_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2656641_2657037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019590.1|2657077_2657821_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 204
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2664437	2666171	4635862	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|2664437_2666171_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 205
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2671423	2677067	4635862		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2671423_2671813_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|2671827_2672877_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000204337.1|2672879_2673740_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|2673758_2675360_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_001297437.1|2675405_2677067_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 206
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2687154	2688669	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|2687154_2688669_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 207
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2700661	2701414	4635862		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|2700661_2701414_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 208
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2713420	2714089	4635862		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334583.1|2713420_2714089_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 209
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2729922	2736679	4635862		Burkholderia_phage(50.0%)	7	NA	NA
WP_001350521.1|2729922_2731617_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2731787_2731970_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922686.1|2732048_2732966_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2733138_2734059_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786005.1|2734047_2734518_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157239.1|2734498_2735917_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365562.1|2735983_2736679_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
>prophage 210
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2741751	2742423	4635862		Bacillus_phage(100.0%)	1	NA	NA
WP_001395354.1|2741751_2742423_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	2.4e-32
>prophage 211
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2745967	2746498	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|2745967_2746498_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 212
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2769904	2773825	4635862	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001310555.1|2769904_2770921_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_085947917.1|2772551_2773825_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 213
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2780416	2780638	4635862		Klebsiella_phage(100.0%)	1	NA	NA
WP_000692323.1|2780416_2780638_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 214
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2784980	2786147	4635862		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830156.1|2784980_2786147_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 215
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2793791	2794691	4635862		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2793791_2794691_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 216
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2802046	2819496	4635862	transposase	Escherichia_phage(27.27%)	15	NA	NA
WP_000704857.1|2802046_2803213_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
WP_000043484.1|2803461_2804868_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_010723085.1|2805494_2806511_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000520320.1|2806990_2808109_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000601187.1|2808093_2808684_-	LPS biosynthesis protein	NA	A0A1V0SJ47	Klosneuvirus	32.6	2.6e-06
WP_001407542.1|2808664_2809657_-	beta-1,6-galactofuranosyltransferase	NA	NA	NA	NA	NA
WP_000639866.1|2809659_2810826_-	O16 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000272486.1|2810825_2811929_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2811936_2813184_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2813180_2813738_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2813737_2814619_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2814676_2815576_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2815575_2816661_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2817033_2817927_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2818101_2819496_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 217
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2825208	2831914	4635862		Bacillus_phage(25.0%)	6	NA	NA
WP_001350528.1|2825208_2826579_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079274.1|2826683_2828120_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
WP_000699693.1|2828122_2829346_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001393539.1|2829342_2829822_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043654.1|2829824_2830790_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_000048190.1|2830792_2831914_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 218
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2836157	2846548	4635862		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000794699.1|2836157_2836997_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137196.1|2837089_2839252_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2839254_2839698_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2839703_2840843_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|2841501_2843085_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|2843358_2845212_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234768.1|2845233_2845815_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.0e-31
WP_001295424.1|2845906_2846548_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 219
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2851273	2852626	4635862		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469708.1|2851273_2852626_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	2.7e-06
>prophage 220
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2866475	2874997	4635862	tRNA,transposase	Bacillus_phage(33.33%)	9	NA	NA
WP_000675150.1|2866475_2867879_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2867875_2868598_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001350529.1|2868788_2869121_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476011.1|2869267_2870629_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000468310.1|2870901_2871120_-	prophage transcriptional regulator OgrK	NA	Q6DW12	Phage_TP	100.0	4.7e-38
WP_001318299.1|2871588_2871906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807348.1|2872311_2873211_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	2.8e-12
WP_000903596.1|2873292_2873739_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_085947771.1|2873835_2874997_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 221
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2883692	2887249	4635862		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|2883692_2884697_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000012001.1|2884693_2885659_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2885632_2886379_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2886430_2887249_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 222
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2897897	2899931	4635862	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|2897897_2899931_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 223
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2911564	2921005	4635862		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001333512.1|2911564_2912701_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001295429.1|2914822_2915284_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2915323_2915794_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2915840_2916560_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2916556_2918242_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2918463_2919195_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2919254_2919362_+	protein YohO	NA	NA	NA	NA	NA
WP_000783123.1|2919342_2920074_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2920078_2921005_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 224
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2941366	2942887	4635862		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2941366_2942887_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 225
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2946581	2950367	4635862		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2946581_2947250_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2947507_2948344_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|2948375_2950367_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 226
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2954437	2955295	4635862		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|2954437_2955295_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 227
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2969842	2974143	4635862		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091940.1|2969842_2971309_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_000198828.1|2971426_2972413_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|2972451_2973165_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2973576_2974143_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 228
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2979897	2987545	4635862		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|2979897_2981487_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|2981490_2981835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|2982167_2983358_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2983385_2984081_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|2984229_2985990_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|2986114_2986399_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|2986537_2987545_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 229
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	2992662	2993679	4635862	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_010723085.1|2992662_2993679_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 230
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3000618	3001236	4635862		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|3000618_3001236_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 231
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3010569	3016347	4635862		Bacillus_phage(25.0%)	5	NA	NA
WP_000422182.1|3010569_3012213_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884971.1|3012288_3012939_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000710375.1|3012938_3014003_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406064.1|3014076_3015132_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865568.1|3015243_3016347_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
>prophage 232
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3020624	3025467	4635862		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|3020624_3023474_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|3023640_3025467_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 233
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3040390	3043018	4635862		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|3040390_3043018_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 234
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3048462	3054609	4635862		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|3048462_3050748_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|3050981_3052112_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|3052111_3052366_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|3052419_3053070_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|3053532_3054609_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 235
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3060501	3065012	4635862	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140592.1|3060501_3061401_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	2.4e-67
WP_000150333.1|3061413_3061599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|3061639_3062443_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000100890.1|3062460_3063750_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|3063806_3065012_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 236
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3068615	3073619	4635862		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|3068615_3069218_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|3069525_3070665_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|3070668_3071637_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|3071636_3073619_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 237
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3112459	3115687	4635862		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|3112459_3113059_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|3113117_3114950_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|3115036_3115687_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 238
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3126246	3128107	4635862		Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|3126246_3127137_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|3127333_3128107_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 239
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3132318	3133836	4635862		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3132318_3133836_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 240
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3140312	3141449	4635862		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699148.1|3140312_3141449_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	6.5e-22
>prophage 241
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3149985	3151071	4635862		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|3149985_3151071_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 242
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3168898	3180108	4635862	tail,integrase	Enterobacteria_phage(50.0%)	17	3166873:3166889	3183783:3183799
3166873:3166889	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3168898_3169831_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3170142_3171300_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3171452_3171815_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3171811_3172732_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3172728_3174060_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3174094_3174376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3174674_3175115_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3175141_3175660_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3175709_3175985_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3175984_3176479_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3176475_3176844_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3177201_3177564_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3177629_3178454_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3178581_3179118_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3179108_3179471_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3179470_3179776_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3179907_3180108_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3183783:3183799	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 243
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3187971	3195548	4635862		Bacillus_phage(50.0%)	4	NA	NA
WP_001326970.1|3187971_3191565_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_001296867.1|3191620_3192766_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3192839_3193784_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283490.1|3193853_3195548_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 244
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3199242	3200163	4635862		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3199242_3200163_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 245
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3203980	3204715	4635862		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3203980_3204715_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 246
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3231638	3244292	4635862		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|3231638_3233654_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|3233724_3234711_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3234940_3235702_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3235886_3236858_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3237241_3237499_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|3237543_3239271_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|3239311_3239821_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|3239863_3240715_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|3240819_3241194_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|3241226_3241961_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|3242149_3243061_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|3243194_3244292_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 247
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3247309	3248101	4635862		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|3247309_3248101_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 248
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3251579	3256699	4635862		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|3251579_3252884_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_001350538.1|3253123_3254023_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.1	1.6e-26
WP_000838944.1|3254118_3254694_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001350539.1|3254754_3255204_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|3255190_3255616_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|3255829_3256699_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 249
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3262335	3263544	4635862	integrase	Enterobacteria_phage(100.0%)	1	3256464:3256477	3266243:3266256
3256464:3256477	attL	TTAAGCCGGTGCAT	NA	NA	NA	NA
WP_000047773.1|3262335_3263544_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	1.9e-75
WP_000047773.1|3262335_3263544_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	1.9e-75
3266243:3266256	attR	TTAAGCCGGTGCAT	NA	NA	NA	NA
>prophage 250
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3282143	3283094	4635862		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3282143_3283094_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 251
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3300382	3301096	4635862		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3300382_3301096_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 252
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3322348	3326350	4635862		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3322348_3323638_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3323723_3324350_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|3324674_3325712_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|3325711_3326350_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 253
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3332785	3339080	4635862		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|3332785_3332959_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|3333272_3333788_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|3333803_3334343_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|3334435_3336013_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3336081_3337548_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|3337709_3339080_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 254
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3347910	3348342	4635862		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3347910_3348342_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 255
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3358552	3365009	4635862		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|3358552_3359836_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|3360013_3360214_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|3360225_3360561_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3360562_3362413_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3362429_3362945_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3363040_3363364_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3363380_3363767_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3363794_3365009_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 256
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3380327	3381839	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493470.1|3380327_3381839_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 257
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3387731	3399021	4635862		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3387731_3388985_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|3389312_3390503_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3390547_3390886_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|3390946_3392281_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3392270_3392984_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001311037.1|3393148_3394576_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970102.1|3395133_3399021_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 258
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3403140	3403401	4635862		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3403140_3403401_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 259
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3406860	3410602	4635862		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3406860_3407541_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|3407812_3408787_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3408802_3410602_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 260
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3416373	3422632	4635862	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219203.1|3416373_3417708_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|3417916_3418798_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3418900_3419488_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3419543_3419927_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3420231_3420921_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3420968_3422006_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3422212_3422632_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 261
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3427925	3429224	4635862		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3427925_3429224_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 262
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3435077	3437651	4635862		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3435077_3437651_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 263
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3443557	3444628	4635862		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|3443557_3444628_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 264
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3458373	3460878	4635862	integrase	Staphylococcus_phage(50.0%)	2	3454107:3454119	3461592:3461604
3454107:3454119	attL	GCCTCAATCTCTT	NA	NA	NA	NA
WP_000162574.1|3458373_3458856_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000101723.1|3459636_3460878_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.0	4.8e-103
3461592:3461604	attR	AAGAGATTGAGGC	NA	NA	NA	NA
>prophage 265
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3472142	3475632	4635862		Yersinia_phage(50.0%)	6	NA	NA
WP_000197391.1|3472142_3472964_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.4e-45
WP_000189409.1|3473180_3473882_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001144029.1|3473922_3474159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824222.1|3474158_3474602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000702495.1|3474625_3475093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065803.1|3475317_3475632_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.7	3.8e-12
>prophage 266
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3479396	3479855	4635862		Bordetella_phage(100.0%)	1	NA	NA
WP_000211841.1|3479396_3479855_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.1	5.0e-13
>prophage 267
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3486542	3486761	4635862		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|3486542_3486761_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 268
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3496212	3500264	4635862		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|3496212_3497493_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001295173.1|3497730_3499131_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3499151_3499814_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3499814_3500264_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 269
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3504200	3509495	4635862		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3504200_3504446_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3504442_3504853_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246534.1|3504825_3506970_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|3506979_3507939_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|3508292_3509495_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 270
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3522438	3527824	4635862	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3522438_3522624_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|3522858_3525489_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|3525616_3526117_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3526185_3527247_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3527326_3527824_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 271
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3533290	3534256	4635862		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|3533290_3534256_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 272
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3541731	3542745	4635862		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|3541731_3542745_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 273
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3560570	3573752	4635862		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|3560570_3563132_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3563237_3563894_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|3563944_3564712_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|3564907_3565816_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3565812_3566979_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3567070_3567709_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3567713_3568490_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3568578_3569943_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081588.1|3570036_3571029_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3571091_3572231_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3572370_3572997_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3572990_3573752_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 274
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3576864	3578897	4635862		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|3576864_3577470_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|3577469_3578897_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 275
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3602965	3603751	4635862		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021334.1|3602965_3603751_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.2e-20
>prophage 276
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3608224	3613144	4635862		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|3608224_3608896_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|3609034_3609175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|3609188_3610061_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3610120_3611419_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3611506_3613144_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 277
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3617176	3621291	4635862		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|3617176_3618478_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|3618534_3621291_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 278
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3628825	3629674	4635862		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|3628825_3629674_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 279
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3634532	3635288	4635862		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3634532_3635288_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 280
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3646814	3662362	4635862	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|3646814_3648020_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|3648019_3648463_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|3648513_3649320_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|3649558_3650656_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3651234_3652488_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3652719_3654051_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|3654112_3655939_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001285993.1|3655938_3659481_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138201.1|3659473_3662362_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 281
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3667838	3674611	4635862		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3667838_3668633_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3668639_3669515_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|3669665_3671912_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3671924_3672455_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|3673139_3673829_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3673897_3674611_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 282
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3684241	3686736	4635862		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3684241_3685660_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603502.1|3685974_3686736_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 283
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3699849	3703369	4635862	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085947917.1|3699849_3701123_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001301085.1|3702613_3703369_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 284
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3727828	3743221	4635862	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3727828_3729229_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001336279.1|3729246_3730563_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3730598_3731966_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|3732001_3732490_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001350545.1|3732489_3734409_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3734844_3736293_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|3736294_3736420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3736416_3736488_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192820.1|3736542_3737091_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3737134_3738652_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_010723217.1|3738661_3739760_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813200.1|3739850_3741584_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715214.1|3741589_3742300_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3742324_3743221_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 285
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3747145	3752519	4635862		Pandoravirus(50.0%)	3	NA	NA
WP_001336277.1|3747145_3748579_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951964.1|3748635_3749379_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195062.1|3749645_3752519_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 286
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3760655	3761888	4635862		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3760655_3761888_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 287
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3790183	3791338	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3790183_3791338_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 288
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3833655	3834672	4635862	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_010723085.1|3833655_3834672_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 289
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3853139	3854024	4635862		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3853139_3854024_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 290
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3860100	3869451	4635862		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|3860100_3860928_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|3861127_3862054_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3862104_3862362_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3862404_3864624_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|3864734_3866147_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|3866221_3866959_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3867192_3869451_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 291
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3872761	3873154	4635862		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3872761_3873154_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 292
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3876981	3890892	4635862	transposase	Bacillus_virus(16.67%)	15	NA	NA
WP_000195296.1|3876981_3878874_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3878902_3879484_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3879483_3880311_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3880335_3880758_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3880758_3881388_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3881592_3883074_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3883221_3883893_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3883898_3885059_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|3885096_3885912_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3886027_3886801_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3886858_3887029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3887290_3887944_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_001295626.1|3888317_3888608_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001272145.1|3888891_3889443_+	fimbrial-like protein	NA	NA	NA	NA	NA
WP_085947917.1|3889619_3890892_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 293
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3898797	3900231	4635862		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3898797_3900231_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 294
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3905368	3906607	4635862	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3905368_3906607_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 295
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3913007	3929203	4635862	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|3913007_3914021_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3914258_3914474_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3914584_3916330_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437376.1|3916524_3918366_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	1.1e-34
WP_000228937.1|3918444_3918951_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|3919204_3919969_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3920256_3920880_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094721.1|3921033_3922554_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000627220.1|3922860_3924351_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450594.1|3924392_3924725_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|3924943_3925927_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|3926110_3929203_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 296
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3942057	3943023	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3942057_3943023_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 297
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3963601	3965896	4635862		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3963601_3965896_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 298
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3974102	3975248	4635862		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3974102_3975248_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 299
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	3995952	4003746	4635862		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|3995952_3996813_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249104.1|3996877_3998914_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246830.1|3998871_3999267_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3999286_3999877_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3999886_4000462_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|4000575_4001616_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|4001688_4002324_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|4002451_4002970_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|4002949_4003393_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|4003443_4003746_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 300
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4009448	4011338	4635862		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4009448_4011338_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 301
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4016819	4023458	4635862		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|4016819_4019492_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|4019516_4021004_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4021031_4021484_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|4022114_4023458_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 302
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4027540	4030413	4635862	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4027540_4028389_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4028478_4030413_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 303
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4037187	4038665	4635862		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|4037187_4038159_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4038386_4038665_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 304
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4042733	4057528	4635862		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|4042733_4043543_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|4043752_4044730_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4044743_4045730_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|4045750_4046317_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|4046313_4046889_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4046857_4047415_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4047421_4048147_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|4048194_4049628_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4049650_4049938_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|4050055_4050547_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4050592_4051447_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4051443_4051716_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|4051929_4052562_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|4052558_4053287_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|4053283_4053937_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|4054166_4056503_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4056598_4057528_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 305
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4069179	4076052	4635862	transposase	Escherichia_phage(33.33%)	7	NA	NA
WP_010723085.1|4069179_4070196_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001067008.1|4070403_4071120_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_000445111.1|4071304_4072432_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|4072491_4072956_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|4072952_4073828_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|4073824_4074514_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108454.1|4074561_4076052_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
>prophage 306
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4079756	4080254	4635862	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|4079756_4080254_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 307
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4084220	4086745	4635862	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|4084220_4085588_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|4085677_4086745_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 308
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4103521	4104565	4635862		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4103521_4104565_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 309
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4115130	4116015	4635862		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|4115130_4116015_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 310
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4125913	4126672	4635862		Bacillus_virus(100.0%)	1	NA	NA
WP_000078349.1|4125913_4126672_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 311
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4137167	4138639	4635862	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4137167_4137677_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|4137691_4138639_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 312
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4159854	4161807	4635862		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|4159854_4161807_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 313
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4170637	4179196	4635862		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|4170637_4173331_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|4173622_4174807_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4174877_4176992_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138045.1|4177019_4177559_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4177655_4178030_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|4178155_4178443_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|4178450_4178810_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|4178809_4179196_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 314
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4184766	4194307	4635862		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4184766_4186680_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|4186679_4187702_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4187695_4187914_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|4187967_4188837_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4188891_4189296_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4189597_4190230_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|4190280_4192371_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|4192437_4193658_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|4193743_4194307_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 315
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4218554	4219391	4635862		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|4218554_4219391_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 316
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4236295	4240062	4635862		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|4236295_4237918_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|4237993_4239346_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|4239342_4240062_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 317
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4246644	4247523	4635862		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|4246644_4247523_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 318
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4253557	4255951	4635862		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|4253557_4255951_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 319
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4260330	4261557	4635862		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|4260330_4261557_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 320
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4267612	4270060	4635862		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4267612_4270060_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 321
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4290848	4292659	4635862		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073623.1|4290848_4291592_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
WP_000907792.1|4291588_4292659_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 322
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4296202	4297685	4635862		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416891.1|4296202_4296916_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|4296917_4297685_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 323
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4303407	4306226	4635862		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4303407_4304262_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4304506_4305565_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4305557_4306226_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 324
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4309229	4313361	4635862		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4309229_4309856_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106551.1|4309929_4312128_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|4312229_4312475_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|4312695_4313361_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 325
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4321254	4326906	4635862		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|4321254_4322061_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|4322066_4322468_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000015298.1|4322670_4326906_+	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
>prophage 326
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4330281	4333017	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|4330281_4333017_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 327
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4346618	4348661	4635862		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|4346618_4348661_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 328
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4352006	4359381	4635862	transposase	uncultured_Caudovirales_phage(60.0%)	8	NA	NA
WP_000008957.1|4352006_4352360_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|4352413_4353703_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|4353715_4354141_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000020601.1|4354769_4355552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010723085.1|4355660_4356677_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001350553.1|4357439_4358006_+	outer membrane lipoprotein Slp	NA	NA	NA	NA	NA
WP_000478619.1|4358161_4358692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001296814.1|4358733_4359381_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 329
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4405342	4407327	4635862		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|4405342_4406347_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|4406343_4407327_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 330
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4417539	4419873	4635862		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|4417539_4419873_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 331
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4423527	4425527	4635862	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|4423527_4423740_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|4423926_4424079_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|4424158_4425527_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 332
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4429365	4430361	4635862		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|4429365_4430361_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 333
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4435679	4437221	4635862		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146473.1|4435679_4437221_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	3.3e-16
>prophage 334
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4461495	4469795	4635862	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000582468.1|4461495_4463340_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|4463336_4464728_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|4464825_4465434_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000015300.1|4465661_4469795_+	RHS element protein RhsA	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.7e-25
>prophage 335
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4487669	4498398	4635862		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|4487669_4487921_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4488062_4488494_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001350558.1|4488738_4490283_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4490292_4491576_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|4491579_4492539_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982115.1|4492525_4493560_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|4493798_4494824_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|4494833_4496030_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_014639028.1|4496304_4497177_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|4497465_4498398_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 336
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4513303	4517866	4635862		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|4513303_4513783_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114543.1|4513821_4514631_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|4514728_4514896_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4514916_4515153_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001350561.1|4515369_4516038_-	RadC family protein	NA	NA	NA	NA	NA
WP_000050139.1|4516209_4517430_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001393518.1|4517410_4517866_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.2e-48
>prophage 337
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4521238	4527987	4635862		Morganella_phage(25.0%)	6	NA	NA
WP_001350563.1|4521238_4522063_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.9	1.0e-96
WP_000924289.1|4522352_4522970_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870036.1|4522966_4524649_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_001295237.1|4524906_4525530_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4525584_4525860_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4525878_4527987_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 338
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4532423	4533815	4635862		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4532423_4533815_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 339
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4545933	4547268	4635862		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|4545933_4547268_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 340
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4554574	4563595	4635862		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|4554574_4556263_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|4556368_4556467_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|4557031_4557121_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4557400_4558585_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4558592_4559090_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4559086_4559449_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4559438_4559786_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|4559893_4560343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|4560389_4561883_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|4561879_4563595_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 341
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4569947	4570901	4635862		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4569947_4570376_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4570487_4570901_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 342
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4575328	4576477	4635862		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4575328_4576477_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 343
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4581183	4588552	4635862		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4581183_4583598_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4583626_4584700_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4584699_4585800_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4585804_4587208_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4587504_4587585_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4587814_4587955_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4587971_4588331_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4588294_4588552_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 344
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4598750	4600088	4635862		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|4598750_4600088_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 345
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4611071	4618679	4635862		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4611071_4611845_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251998.1|4612027_4612918_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4612917_4613877_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4613963_4615004_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|4615317_4617147_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|4617308_4618679_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 346
NZ_CP042845	Escherichia coli strain JME65 chromosome, complete genome	4635862	4630633	4631626	4635862		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|4630633_4631626_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
