The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043766	Enterobacter hormaechei strain EB_P9_L5_03.19 chromosome, complete genome	4951899	119757	126035	4951899		Enterobacteria_phage(50.0%)	6	NA	NA
WP_033487312.1|119757_120294_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.6	1.8e-51
WP_033487313.1|120297_121176_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	1.3e-107
WP_058686680.1|121228_122128_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.0	2.8e-28
WP_033487315.1|122127_123213_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.5	6.3e-99
WP_017383282.1|123572_124469_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
WP_032619346.1|124643_126035_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.8e-19
>prophage 2
NZ_CP043766	Enterobacter hormaechei strain EB_P9_L5_03.19 chromosome, complete genome	4951899	3183520	3226880	4951899	terminase,holin,integrase	Salmonella_phage(26.53%)	64	3183461:3183507	3228840:3228886
3183461:3183507	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
WP_023303221.1|3183520_3184357_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.6	6.9e-162
WP_071882737.1|3184560_3184896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039025583.1|3185176_3185416_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	4.9e-12
WP_063160438.1|3185611_3185833_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	65.3	4.2e-18
WP_023303576.1|3186099_3186447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126499305.1|3186443_3186662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033486618.1|3186658_3187210_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	5.7e-56
WP_033486617.1|3187370_3187799_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	96.5	5.2e-73
WP_033486616.1|3187795_3188419_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.0	2.1e-46
WP_033486615.1|3188415_3188919_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	2.7e-12
WP_151574194.1|3188930_3189215_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	4.2e-47
WP_006809788.1|3189286_3189496_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_053004009.1|3189647_3189905_-	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	44.2	1.7e-07
WP_023330696.1|3190049_3190280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151574196.1|3190387_3190840_-	hypothetical protein	NA	E5KJN9	Acinetobacter_phage	42.7	4.0e-23
WP_151574198.1|3191291_3191981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058673009.1|3191995_3192700_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	63.7	2.6e-85
WP_016042179.1|3192810_3193038_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_151574200.1|3193067_3193634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721649.1|3193722_3193917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443146.1|3195006_3195879_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	68.7	1.5e-106
WP_151574202.1|3195875_3196166_+	protein ren	NA	M1FPD5	Enterobacteria_phage	48.4	5.2e-16
WP_033486605.1|3196170_3196419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151574204.1|3196415_3196721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059585489.1|3196830_3197031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048702392.1|3197459_3197696_+	hypothetical protein	NA	A0A2H4PHJ9	Dickeya_phage	53.9	4.8e-12
WP_151574402.1|3197803_3198331_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.0	1.2e-23
WP_032647529.1|3198327_3198624_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	70.7	1.8e-32
WP_033486601.1|3198623_3198917_+	DUF4752 family protein	NA	K7PHN1	Enterobacterial_phage	48.3	1.9e-21
WP_023277185.1|3199136_3199592_+	phage protein	NA	K7P7B8	Enterobacteria_phage	72.2	4.9e-61
WP_033486599.1|3199591_3199762_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	91.1	5.3e-21
WP_033486597.1|3199754_3200366_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	69.8	8.9e-42
WP_033486595.1|3200362_3200746_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	7.8e-20
WP_094058356.1|3200742_3200859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033486594.1|3200855_3201545_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.9	1.7e-57
WP_001514183.1|3202033_3202435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|3202431_3202707_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_032671044.1|3202709_3203252_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.9	5.4e-75
WP_033486591.1|3203248_3203527_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	95.5	5.1e-05
WP_044489031.1|3203477_3203672_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.2	2.8e-18
WP_151574206.1|3203958_3204390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151574208.1|3204541_3204748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151574210.1|3204751_3205390_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.9	1.3e-115
WP_023306055.1|3205420_3205876_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	81.3	4.0e-63
WP_151574212.1|3205872_3207120_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	97.0	1.5e-213
WP_151574214.1|3207135_3208485_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.8	1.6e-232
WP_048984520.1|3210180_3211446_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	87.6	3.8e-212
WP_048984518.1|3211458_3211908_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	86.6	1.4e-65
WP_151574216.1|3211925_3213002_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	88.0	9.4e-180
WP_151574218.1|3213011_3213305_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	2.9e-43
WP_058671447.1|3213769_3213943_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.1	9.6e-10
WP_151574220.1|3213942_3214293_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	6.9e-39
WP_151574222.1|3214295_3214664_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	73.8	8.8e-45
WP_151574224.1|3214660_3215044_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	6.3e-38
WP_151574226.1|3215102_3215858_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	52.6	1.4e-57
WP_151574228.1|3215908_3216652_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.1	3.2e-62
WP_062937870.1|3216724_3217099_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	52.4	5.1e-24
WP_151574230.1|3217156_3219457_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	43.5	1.5e-110
WP_151574232.1|3219467_3219695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032669794.1|3219736_3220234_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	4.8e-86
WP_015571561.1|3220233_3220704_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032649984.1|3220717_3221083_+	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
WP_151574234.1|3221069_3223550_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.1	0.0e+00
WP_074144980.1|3225611_3226880_-	hypothetical protein	NA	O22006	Shigella_phage	40.7	6.7e-84
3228840:3228886	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP043766	Enterobacter hormaechei strain EB_P9_L5_03.19 chromosome, complete genome	4951899	3884876	3933643	4951899	portal,tail,terminase,head,tRNA,holin,capsid,integrase	Enterobacterial_phage(32.73%)	63	3882763:3882777	3932675:3932689
3882763:3882777	attL	CAGCTTCAGGGCGCT	NA	NA	NA	NA
WP_032670101.1|3884876_3885377_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_006809195.1|3885596_3886739_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_022650818.1|3886713_3886977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058687783.1|3887012_3887282_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	86.7	6.5e-13
WP_058687784.1|3887292_3887556_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	85.1	4.3e-38
WP_096928926.1|3887558_3888080_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	84.7	1.7e-49
WP_063619167.1|3888066_3889092_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	90.4	2.7e-168
WP_058687786.1|3889088_3889502_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	81.6	1.1e-51
WP_058687787.1|3889775_3889967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634713.1|3890307_3890964_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	98.6	7.9e-121
WP_032634882.1|3891063_3891261_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	96.9	1.4e-28
WP_032634711.1|3891286_3891757_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_072203184.1|3891997_3892204_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	3.8e-13
WP_058687708.1|3892166_3893093_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	83.4	4.9e-68
WP_058687709.1|3893089_3893584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687710.1|3893583_3894336_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	90.0	2.0e-136
WP_058687711.1|3894340_3895006_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.8	5.6e-98
WP_023293907.1|3895002_3895230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305906.1|3895226_3895547_+	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	77.4	1.9e-43
WP_058687712.1|3895543_3895933_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.0	1.9e-66
WP_045332650.1|3895948_3896674_+	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	2.2e-55
WP_058687713.1|3896670_3897660_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.1	1.2e-178
WP_053504493.1|3897672_3898251_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	7.3e-46
WP_015570939.1|3898472_3898898_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
WP_017384388.1|3898894_3899050_+	DUF3927 domain-containing protein	NA	S4TRP5	Salmonella_phage	68.8	5.0e-10
WP_023296244.1|3899160_3899547_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.2e-52
WP_063419965.1|3899533_3899815_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	2.6e-20
WP_058687714.1|3899814_3900444_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	3.5e-102
WP_058685277.1|3900451_3900721_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.5	3.2e-28
WP_045324772.1|3900677_3900857_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.2	2.7e-15
WP_058687715.1|3901709_3902576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087654025.1|3902769_3903594_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	77.4	2.9e-19
WP_032667396.1|3903606_3903834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059443714.1|3903850_3905308_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	4.6e-270
WP_063159276.1|3905319_3905655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687853.1|3905608_3905866_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
WP_059443713.1|3906031_3906625_+	hypothetical protein	NA	S4TR53	Salmonella_phage	79.7	5.1e-95
WP_072203232.1|3906617_3906986_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	87.7	5.9e-57
WP_000954404.1|3907091_3907586_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_088566981.1|3907582_3909244_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
WP_058687880.1|3909302_3911237_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.5	0.0e+00
WP_048243836.1|3911439_3912798_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	97.8	4.6e-256
WP_048243841.1|3912794_3913838_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	77.8	9.7e-89
WP_048243843.1|3913834_3914161_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	86.1	1.9e-46
WP_048243845.1|3914169_3914520_+|head	phage head closure protein	head	S4TND9	Salmonella_phage	93.1	6.8e-55
WP_058687881.1|3914516_3914966_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	97.3	3.8e-74
WP_048243848.1|3914962_3915310_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	94.8	2.1e-56
WP_048243850.1|3915364_3915835_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	9.7e-81
WP_032622503.1|3915889_3916291_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	95.5	1.3e-65
WP_032622502.1|3916314_3916578_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	93.1	2.7e-40
WP_058687882.1|3916613_3919895_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	93.8	0.0e+00
WP_058687883.1|3919897_3920236_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	98.2	1.5e-62
WP_023305932.1|3920232_3920991_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.6	6.5e-143
WP_045347509.1|3920992_3921703_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.5	6.5e-145
WP_032622495.1|3921735_3922083_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	47.3	1.5e-06
WP_072203234.1|3922089_3922425_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	48.6	5.6e-22
WP_047720006.1|3922480_3923080_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	74.8	3.2e-76
WP_059443711.1|3923133_3926715_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	91.7	0.0e+00
WP_058687885.1|3926716_3927682_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	2.2e-58
WP_063619166.1|3929258_3931238_+	acyltransferase	NA	C6ZR20	Salmonella_phage	31.0	8.9e-67
WP_045329651.1|3931538_3931778_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	70.5	1.1e-24
WP_045329653.1|3931777_3932098_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.6	5.5e-27
WP_023299884.1|3932359_3933643_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
3932675:3932689	attR	CAGCTTCAGGGCGCT	NA	NA	NA	NA
>prophage 4
NZ_CP043766	Enterobacter hormaechei strain EB_P9_L5_03.19 chromosome, complete genome	4951899	4102178	4145070	4951899	head,holin,terminase	Enterobacteria_phage(23.21%)	69	NA	NA
WP_045345348.1|4102178_4103459_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	1.9e-123
WP_022650951.1|4103491_4103740_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_151574291.1|4103846_4104173_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	63.8	4.1e-30
WP_063929328.1|4104182_4104422_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	48.7	1.8e-11
WP_116328773.1|4104384_4104840_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	52.2	4.9e-37
WP_151574293.1|4104839_4105058_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	68.1	7.5e-20
WP_151574295.1|4105060_4105330_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	55.8	1.8e-18
WP_063858996.1|4105418_4105610_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	67.8	8.3e-15
WP_151574297.1|4105606_4105924_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	59.4	5.6e-32
WP_151574299.1|4105920_4106139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151574301.1|4106135_4106795_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	94.5	6.5e-123
WP_151574303.1|4107258_4107945_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	94.4	1.2e-119
WP_151574305.1|4107937_4108387_-	hypothetical protein	NA	A0A2I7QLC5	Vibrio_phage	41.0	2.0e-27
WP_151574307.1|4108554_4109472_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	3.0e-158
WP_063216525.1|4109481_4109766_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	4.2e-47
WP_063216523.1|4109889_4110087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151574309.1|4110087_4110243_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_139154656.1|4110551_4110740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058687947.1|4110956_4111499_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	44.7	4.5e-29
WP_063843731.1|4111833_4112031_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	95.3	4.6e-24
WP_032619410.1|4112070_4112976_-	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	92.9	9.4e-165
WP_023303585.1|4113041_4113752_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.2	3.2e-91
WP_032619413.1|4113855_4114044_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	51.8	1.5e-08
WP_151574311.1|4114129_4114672_+	regulator	NA	M9NZI6	Enterobacteria_phage	92.2	3.3e-88
WP_063255085.1|4115019_4115214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687951.1|4116303_4117176_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	66.2	2.6e-103
WP_058687952.1|4117172_4117472_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	52.6	1.7e-17
WP_033486605.1|4117468_4117717_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151574313.1|4117713_4118061_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	36.3	1.7e-05
WP_047720581.1|4118057_4118279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049004995.1|4118805_4119078_+	hypothetical protein	NA	K7PMC8	Enterobacterial_phage	96.7	1.2e-43
WP_151574315.1|4119875_4120310_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	97.9	3.5e-77
WP_151574317.1|4120306_4120477_+	NinE family protein	NA	G8C7V4	Escherichia_phage	94.3	5.3e-21
WP_151574319.1|4120440_4120941_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	52.0	2.0e-36
WP_151574321.1|4120934_4121546_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	70.0	1.8e-58
WP_151574323.1|4121542_4121926_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	42.0	8.6e-19
WP_151574325.1|4121922_4122039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063617969.1|4122038_4122536_+	antiterminator	NA	G8C7V7	Escherichia_phage	98.8	1.4e-93
WP_151574327.1|4122749_4123241_+	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	51.3	7.4e-39
WP_151574408.1|4123461_4123818_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_151574329.1|4123801_4124434_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	49.3	2.5e-47
WP_151574331.1|4124421_4124871_+	Rz lytic protein	NA	NA	NA	NA	NA
WP_151574410.1|4124827_4125010_+	rz1 lytic protein	NA	U5P461	Shigella_phage	42.9	3.0e-06
WP_151574332.1|4125160_4125805_+	hypothetical protein	NA	A0A0H4IPL1	Shigella_phage	36.6	4.7e-25
WP_088218929.1|4125958_4126162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151574334.1|4126165_4126804_+	hypothetical protein	NA	I6S676	Salmonella_phage	88.2	3.6e-110
WP_151574336.1|4126835_4127324_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	81.9	5.2e-53
WP_151574338.1|4127320_4128883_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.9	1.7e-302
WP_094058355.1|4128893_4130369_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	62.4	4.5e-156
WP_151574340.1|4130295_4131300_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.6	4.2e-105
WP_064499039.1|4131309_4131981_+	HNH endonuclease	NA	A0A2I7S6L5	Vibrio_phage	36.4	2.3e-22
WP_151574342.1|4132043_4133432_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.8	1.7e-149
WP_151574344.1|4133435_4133867_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	70.6	1.3e-50
WP_063924255.1|4133878_4134964_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	68.4	3.9e-141
WP_063924256.1|4134975_4135341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023306305.1|4135417_4135801_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.6	7.5e-47
WP_023306304.1|4135902_4136451_+	HNH endonuclease	NA	K9L517	Pectobacterium_phage	42.2	9.4e-35
WP_039266643.1|4136504_4136678_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.9	9.2e-13
WP_151574346.1|4136677_4137028_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	4.0e-39
WP_151574222.1|4137030_4137399_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	73.8	8.8e-45
WP_151574224.1|4137395_4137779_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	6.3e-38
WP_151574412.1|4138642_4139386_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.1	9.4e-62
WP_062937870.1|4139458_4139833_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	52.4	5.1e-24
WP_151574348.1|4139890_4142410_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	39.4	5.4e-109
WP_080472246.1|4142430_4142976_-	hypothetical protein	NA	A0A077KC96	Edwardsiella_phage	60.7	1.2e-37
WP_063860985.1|4143285_4143666_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_058686180.1|4143723_4144221_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	88.5	4.0e-85
WP_015571561.1|4144220_4144691_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032649984.1|4144704_4145070_+	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
>prophage 5
NZ_CP043766	Enterobacter hormaechei strain EB_P9_L5_03.19 chromosome, complete genome	4951899	4534048	4596559	4951899	tail,tRNA,holin,terminase,plate,integrase	Enterobacteria_phage(23.53%)	70	4583134:4583149	4597481:4597496
WP_071842890.1|4534048_4534249_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_033487830.1|4534573_4535245_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_151574372.1|4536112_4536649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151574374.1|4536531_4538088_-	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	36.2	9.4e-64
WP_127341566.1|4538468_4539605_-|tail	tail fiber domain-containing protein	tail	K7P6X7	Enterobacteria_phage	79.1	4.8e-73
WP_058686501.1|4539664_4540630_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.6	1.0e-60
WP_058686502.1|4540631_4544219_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	89.4	0.0e+00
WP_033487991.1|4544281_4545223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033487992.1|4545266_4545896_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	58.2	1.2e-54
WP_033487993.1|4545925_4546639_-	peptidase P60	NA	K7PJX1	Enterobacterial_phage	94.9	1.3e-140
WP_033487994.1|4546640_4547396_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	78.4	2.3e-116
WP_033487995.1|4547392_4547740_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	65.2	1.5e-38
WP_151574376.1|4547775_4550688_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	35.9	1.1e-134
WP_033487997.1|4550684_4550999_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	63.3	4.3e-16
WP_033487998.1|4550995_4551307_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	2.4e-35
WP_151574378.1|4551371_4552043_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.3	3.7e-49
WP_033487999.1|4552112_4552523_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	52.9	4.6e-34
WP_033488000.1|4552519_4553104_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	54.7	2.5e-49
WP_032643352.1|4553105_4553456_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	58.6	5.6e-33
WP_033488001.1|4553457_4553940_-	hypothetical protein	NA	A0A2I7RQ74	Vibrio_phage	32.0	1.1e-07
WP_033488002.1|4554257_4555211_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	5.3e-134
WP_033488003.1|4555222_4555993_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.9	1.6e-67
WP_033488004.1|4556079_4557171_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	57.5	3.7e-115
WP_033488005.1|4557172_4558561_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	1.9e-124
WP_033488006.1|4558562_4559870_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	1.1e-142
WP_033488007.1|4559847_4560837_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	40.7	2.0e-35
WP_017693500.1|4561174_4561516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047057756.1|4562891_4563071_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.4	1.3e-14
WP_080296621.1|4563027_4563303_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	76.4	3.6e-27
WP_033488009.1|4563304_4563934_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	8.7e-101
WP_047057764.1|4563933_4564215_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	2.2e-19
WP_015570936.1|4564201_4564588_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_022651287.1|4564681_4564870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023296485.1|4565376_4565568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033488011.1|4565759_4566593_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	1.1e-122
WP_026094310.1|4566589_4566952_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	2.3e-50
WP_071591740.1|4566954_4567161_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	2.5e-25
WP_033488012.1|4567160_4567763_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	82.0	4.4e-94
WP_071819783.1|4567802_4568000_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	68.9	1.8e-20
WP_033488013.1|4568151_4568376_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	68.8	1.8e-24
WP_033488014.1|4568696_4569569_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_047057741.1|4569633_4570101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047365617.1|4571113_4571749_+	response regulator	NA	NA	NA	NA	NA
WP_033488017.1|4571795_4572017_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_033486908.1|4572677_4573124_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_033486906.1|4573404_4574091_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	61.1	7.1e-80
WP_080296606.1|4574087_4574945_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.1	1.7e-99
WP_033486904.1|4575089_4575641_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.4	4.4e-32
WP_033486903.1|4575643_4575871_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	81.1	1.2e-28
WP_033486902.1|4575975_4576359_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.7	6.1e-49
WP_050515879.1|4576573_4577002_+	hypothetical protein	NA	A0A2H4J9S8	uncultured_Caudovirales_phage	71.0	7.6e-48
WP_080296608.1|4577027_4577444_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J1D2	uncultured_Caudovirales_phage	52.2	8.2e-31
WP_050515877.1|4577443_4577935_+	hypothetical protein	NA	A0A2H4J2Z0	uncultured_Caudovirales_phage	43.3	7.4e-31
WP_120791114.1|4578330_4578810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033486899.1|4579366_4582639_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	68.1	0.0e+00
WP_033486898.1|4582649_4583735_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.1	8.2e-123
4583134:4583149	attL	TGCTGGCTCAGGCCCG	NA	NA	NA	NA
WP_020882485.1|4583773_4584016_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_014884030.1|4584080_4584293_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_033486897.1|4584294_4585533_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.5	2.0e-170
WP_033486896.1|4585580_4586516_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	4.9e-140
WP_033486895.1|4586559_4587933_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	6.2e-51
WP_099975421.1|4588282_4588480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017382256.1|4588418_4589402_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_080296605.1|4589492_4590623_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_033486893.1|4590920_4591409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033486892.1|4591437_4592754_-	membrane protein	NA	NA	NA	NA	NA
WP_033486891.1|4592777_4593233_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_033486890.1|4593232_4593778_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033486889.1|4593755_4594841_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_015570425.1|4594804_4596559_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
4597481:4597496	attR	CGGGCCTGAGCCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP043767	Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence	331049	19185	46691	331049	transposase,protease	Escherichia_phage(33.33%)	28	NA	NA
WP_001067855.1|19185_19890_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151085607.1|19880_21296_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|21559_22216_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_004193231.1|22401_23277_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|23280_23646_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|23538_23874_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|23867_24707_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|24636_24816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|24834_25107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|25288_26293_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|26371_29344_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|29346_29904_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_003159548.1|31389_32130_+	subclass B1 metallo-beta-lactamase IMP-1	NA	NA	NA	NA	NA
WP_003159191.1|32269_32824_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000679427.1|32992_33340_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|33333_34173_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_151574429.1|34577_36119_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|36384_36885_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|36884_37454_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_151574433.1|37836_38091_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001082319.1|39229_40033_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|40032_40869_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_004248792.1|41049_41841_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|41855_42197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|42536_43241_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001572372.1|43406_43883_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572373.1|43959_45579_-	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572374.1|45767_46691_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
>prophage 2
NZ_CP043767	Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence	331049	60716	95360	331049	transposase	uncultured_Caudovirales_phage(50.0%)	33	NA	NA
WP_000927306.1|60716_62195_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|62213_63041_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|63100_63526_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|63538_64828_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|64873_65194_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|65282_65987_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000125668.1|66019_67423_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_044257539.1|69973_70819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044257537.1|71251_71986_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044257535.1|72349_73282_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032489965.1|73472_74279_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_072193875.1|74316_75084_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.8e-28
WP_044257532.1|75175_76963_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_044257530.1|79742_80240_+	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_071885229.1|80303_80528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|80518_81223_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549940.1|82007_82910_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|83062_83767_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000252081.1|84076_84970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|85141_85372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071366.1|85550_85871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|86387_86699_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001371932.1|86703_87195_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_024143014.1|87274_87568_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
WP_000781547.1|87747_87951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|88005_88230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|88269_88470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|88692_89004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|89379_89661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085603.1|89877_90483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|90815_92184_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|92359_93700_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|94121_95360_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
>prophage 3
NZ_CP043767	Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence	331049	137529	179136	331049	integrase,transposase	Escherichia_phage(58.33%)	36	146200:146251	172119:172170
WP_000179210.1|137529_137805_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
WP_001119291.1|137723_138227_+|transposase	IS1 family transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
WP_122966916.1|138767_138983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|138951_139269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|139319_139727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|140184_140856_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|140900_141206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|141228_141546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|141759_143163_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|143191_143824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044256790.1|144092_145073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072040076.1|145156_146071_-	J domain-containing protein	NA	A0A1E1EVQ1	Acanthamoeba_castellanii_mimivirus	40.3	1.8e-06
146200:146251	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGC	NA	NA	NA	NA
WP_080377936.1|146252_146564_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	100.0	1.1e-43
WP_079367595.1|146573_147278_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001549941.1|147496_148459_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001549942.1|148455_149877_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_049592200.1|149886_151437_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_072193879.1|151532_151976_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_100160450.1|152608_153919_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.2	4.4e-30
WP_001549947.1|154034_155138_-	ring-opening amidohydrolase	NA	NA	NA	NA	NA
WP_001549948.1|155190_156426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425473.1|156867_157791_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_104011511.1|158723_159858_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.1	2.3e-75
WP_000156884.1|161898_162921_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_151085601.1|163291_164176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085599.1|166024_166291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085598.1|166682_166913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085597.1|167042_167396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085596.1|167439_167931_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_151085595.1|167964_168531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085594.1|168527_168788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117109815.1|169193_169898_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001011939.1|170041_170683_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|170832_171333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|171412_172117_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001143760.1|176130_179136_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
172119:172170	attR	GCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCA	NA	NA	NA	NA
>prophage 4
NZ_CP043767	Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence	331049	192458	246888	331049	transposase,protease	Escherichia_phage(27.27%)	60	NA	NA
WP_060415506.1|192458_195386_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.4	0.0e+00
WP_045892401.1|195366_196641_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_004099020.1|196797_197169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191342.1|197486_198755_+|transposase	IS4-like element ISApu1 family transposase	transposase	NA	NA	NA	NA
WP_011191343.1|199364_200375_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004357630.1|200448_200880_+	heme-binding protein	NA	NA	NA	NA	NA
WP_011191344.1|200942_201233_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_011191345.1|201384_201855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004357637.1|201858_202371_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004099044.1|203659_204061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099042.1|204167_204617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099040.1|204704_205277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191347.1|205368_206337_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_004099038.1|206333_207038_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004099036.1|207170_207710_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004099035.1|207711_208155_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_018716209.1|208301_209261_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004357650.1|209405_210638_+	OsmC family protein	NA	NA	NA	NA	NA
WP_025760400.1|210640_211234_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004357654.1|211233_212259_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_026227539.1|212655_213231_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004357657.1|213466_213649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099027.1|213707_214196_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_021140470.1|214802_215231_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_001173919.1|215357_215933_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_001247892.1|216067_216358_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100872.1|216354_216741_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|216977_217334_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|217588_217915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|217911_218412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|218408_218780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|218773_219331_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_001805097.1|220594_221119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|221131_221542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|221642_221849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|223238_223532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151085592.1|223932_225303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627495.1|225361_226384_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_001531258.1|226380_227163_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000340139.1|227286_227784_-	membrane protein	NA	NA	NA	NA	NA
WP_123906519.1|227764_227947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|227986_228643_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012695443.1|229011_229323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|229301_229694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211823.1|230614_231601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|233638_233893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|234878_235220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|235311_235503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000374058.1|235743_236199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053340.1|236289_237531_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301247.1|237959_238535_-	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116680.1|238603_239182_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|239230_240271_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|240293_240749_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054786.1|240771_241929_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254137.1|241928_242510_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_012695441.1|242830_243889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|243898_245041_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_001040058.1|245033_245807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001585166.1|245808_246888_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
>prophage 1
NZ_CP043768	Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid unnamed1, complete sequence	113004	106153	111254	113004	integrase	Escherichia_phage(50.0%)	7	98773:98785	112060:112072
98773:98785	attL	ATCCTGTCCTGAT	NA	NA	NA	NA
WP_032650510.1|106153_106582_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.3	2.1e-29
WP_032650509.1|106581_107853_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	2.9e-156
WP_032650508.1|107856_108246_-	plasmid stability protein	NA	A0A222YWJ6	Escherichia_phage	46.0	7.2e-05
WP_032650507.1|108250_109222_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.6	8.2e-66
WP_032650505.1|109460_110099_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	45.8	1.2e-44
WP_032650503.1|110098_110377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032650502.1|110474_111254_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	1.3e-50
112060:112072	attR	ATCCTGTCCTGAT	NA	NA	NA	NA
