The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044399	Moritella marina ATCC 15381 strain MP-1 chromosome, complete genome	4734363	360529	369251	4734363	tRNA	Mycobacterium_phage(16.67%)	8	NA	NA
WP_019628835.1|360529_363151_+	DUF87 domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	47.7	4.8e-84
WP_019440950.1|363154_363775_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_019440951.1|363774_365112_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.7	1.5e-78
WP_019440952.1|365185_365569_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.8	2.1e-09
WP_019440953.1|365713_367000_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.6	6.8e-92
WP_019440954.1|367198_367528_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_019440955.1|367613_368276_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.8	1.9e-50
WP_019440956.1|368639_369251_-	glutaredoxin	NA	K4F987	Cronobacter_phage	35.0	1.7e-05
>prophage 2
NZ_CP044399	Moritella marina ATCC 15381 strain MP-1 chromosome, complete genome	4734363	1524700	1560905	4734363	head,terminase,portal,capsid,integrase,tail	Vibrio_phage(28.57%)	42	1524586:1524606	1561344:1561364
1524586:1524606	attL	AAAGCCCCAATAAATGGGGCT	NA	NA	NA	NA
WP_019440202.1|1524700_1525669_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	51.9	2.4e-89
WP_019440201.1|1526015_1527698_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_019440200.1|1527690_1530033_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_019440199.1|1530022_1531171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440198.1|1531160_1531913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440197.1|1531994_1532696_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.8	1.1e-16
WP_019440196.1|1532795_1533017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440195.1|1533213_1533732_+	hypothetical protein	NA	A0A1D9C9Z1	Salinivibrio_phage	41.3	7.1e-32
WP_019440194.1|1533750_1534041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440193.1|1534037_1534265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440192.1|1534261_1534417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440191.1|1534413_1534629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440190.1|1534609_1536559_+	replication endonuclease	NA	A0A2P1CKY6	Pseudoalteromonas_phage	35.9	1.8e-59
WP_019440189.1|1536559_1536823_+	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	46.1	4.4e-14
WP_019440188.1|1536910_1538941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440187.1|1539294_1539534_+	hypothetical protein	NA	A0A2I7RQ60	Vibrio_phage	60.3	9.8e-21
WP_019440186.1|1539680_1540373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440185.1|1540451_1540901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019440184.1|1540897_1541221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019440183.1|1541220_1542261_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	42.7	3.1e-63
WP_019440182.1|1542260_1544066_-|terminase	terminase	terminase	R4JDJ3	Burkholderia_phage	39.7	1.0e-117
WP_019440181.1|1544256_1545207_+|capsid	phage capsid scaffolding protein	capsid	A0A2H4JGC7	uncultured_Caudovirales_phage	29.8	1.0e-20
WP_019440180.1|1545224_1546310_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	45.1	5.8e-68
WP_019440179.1|1546391_1547141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440178.1|1547212_1547716_+|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_019440177.1|1547712_1548198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440176.1|1548204_1548849_+	virion morphogenesis protein	NA	A0A1D9C9S1	Salinivibrio_phage	41.8	8.5e-27
WP_019440175.1|1548861_1549962_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	38.5	2.9e-67
WP_019440174.1|1549972_1550425_+	DUF2597 family protein	NA	A0A1L5C2D0	Pseudoalteromonas_phage	40.0	2.0e-27
WP_019440173.1|1550424_1551039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440172.1|1551041_1551308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440170.1|1551517_1553983_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	38.5	1.3e-88
WP_019440169.1|1553982_1554306_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	39.0	2.5e-11
WP_019440168.1|1554318_1555491_+	hypothetical protein	NA	A0A0U4JJ14	Pseudomonas_phage	38.0	4.8e-68
WP_019440167.1|1555483_1556212_+	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	39.3	7.4e-27
WP_019440166.1|1556218_1556971_+|tail	tail fiber protein	tail	A0A0U4K5K2	Pseudomonas_phage	38.0	4.0e-20
WP_019440165.1|1556990_1557728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440164.1|1557743_1558031_+	hypothetical protein	NA	Q8H9M8	Vibrio_phage	71.1	1.5e-12
WP_019440163.1|1558030_1558672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440162.1|1558668_1559151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019440161.1|1559851_1560706_+	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	31.1	1.1e-21
WP_019440160.1|1560707_1560905_+	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	68.8	1.6e-13
1561344:1561364	attR	AAAGCCCCAATAAATGGGGCT	NA	NA	NA	NA
