The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	1184854	1261616	4773032	terminase,transposase,tail,portal,holin,integrase,capsid,head,protease,lysis,tRNA	Salmonella_phage(44.83%)	91	1176935:1176951	1267463:1267479
1176935:1176951	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1184854_1185892_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1186007_1186697_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1187015_1187399_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1187460_1188048_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1188150_1189050_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1189067_1190402_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1190532_1191270_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1191254_1192877_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1192961_1193141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1193140_1193305_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1193301_1193877_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1193908_1194559_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1194558_1195515_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1195511_1195991_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007935.1|1196488_1197718_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_014344516.1|1197695_1197980_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001237032.1|1198020_1198260_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_000017130.1|1199421_1202349_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	95.7	0.0e+00
WP_014344515.1|1202475_1202826_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	2.7e-59
WP_000917561.1|1202847_1203006_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_000106861.1|1203486_1204596_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_014344514.1|1204738_1205152_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	1.5e-45
WP_001274939.1|1205224_1205467_+	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_010835408.1|1205426_1205801_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001527034.1|1205885_1206974_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	88.5	1.4e-154
WP_000800012.1|1206976_1207726_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000113618.1|1207736_1208084_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.5	2.7e-56
WP_000065102.1|1208080_1208599_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	89.8	1.4e-40
WP_000704096.1|1208625_1209618_-	peptidase M85	NA	NA	NA	NA	NA
WP_001217669.1|1209887_1210121_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1210237_1210486_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1210520_1211123_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241017.1|1211122_1211329_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096550.1|1211331_1211943_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1211939_1212080_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1212076_1212754_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1212750_1212936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1213026_1213590_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1214096_1214285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1214499_1215186_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1215461_1215791_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1215774_1216227_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1216244_1216697_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1216932_1217334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1217620_1218166_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1218137_1220069_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1220052_1220256_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1220252_1221833_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1221822_1223319_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1223331_1223679_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1223733_1224762_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1224819_1225179_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1225189_1225573_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1225600_1226179_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1226227_1227358_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1227466_1227868_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1227875_1228622_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1228672_1229068_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1229064_1229403_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1229374_1232470_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1232472_1232802_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1232811_1233510_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1233516_1234254_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1234151_1234799_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_001526393.1|1234860_1238223_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
WP_000178853.1|1238261_1238504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1238557_1240930_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1240926_1241751_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1241740_1242319_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1242415_1242643_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1242749_1242962_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1243024_1243090_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1243669_1243834_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1244546_1244684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1245138_1246632_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1247036_1248836_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1248852_1249827_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1250100_1250781_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1250777_1251683_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1251694_1252423_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1252434_1253166_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1253165_1253546_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1253657_1253918_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1253955_1254882_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1254997_1256194_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1256215_1257133_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1257171_1258020_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1258135_1259029_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1259039_1260401_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1260404_1261040_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1261064_1261616_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1267463:1267479	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	1615065	1644656	4773032	protease,holin,tail	Salmonella_phage(38.46%)	29	NA	NA
WP_000781589.1|1615065_1615560_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1615973_1616465_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1616454_1616718_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778094.1|1616714_1619201_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1619207_1619903_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1619889_1620759_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1620874_1621324_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1621333_1621936_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_151884570.1|1621956_1622574_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.2e-08
WP_000990028.1|1622570_1623230_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000074110.1|1624013_1624226_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_050963582.1|1626641_1627184_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1627180_1628224_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1628267_1628915_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1629644_1630208_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1630399_1630603_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1630905_1631697_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1631993_1632197_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1632365_1634732_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_014344510.1|1635060_1636050_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_010989045.1|1636064_1636433_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001526364.1|1636461_1637793_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1638089_1638419_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1639011_1640253_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1640255_1640783_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1641160_1641604_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1641657_1643487_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_020843597.1|1643834_1644125_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1644152_1644656_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	1878857	1929607	4773032	terminase,tail,portal,plate,holin,integrase,capsid,head,protease,lysis	Salmonella_phage(89.06%)	71	1873435:1873449	1889911:1889925
1873435:1873449	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1878857_1879331_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1879978_1880269_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1880640_1881438_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1881729_1882719_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1882720_1882963_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1882987_1883557_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1883560_1884394_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1884390_1885008_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1885004_1885520_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1885516_1885747_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1885817_1886357_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1886493_1887321_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1887378_1887750_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1888564_1889260_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_071529734.1|1889233_1889419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1889357_1889582_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1889610_1890165_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1889911:1889925	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1890161_1891319_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1891315_1891540_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1891536_1892355_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1892356_1892839_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1892838_1893732_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1893728_1894118_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|1894134_1894995_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202278.1|1895002_1895992_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_000188927.1|1896002_1896626_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1896758_1897016_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1896945_1897380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1897541_1897886_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1897888_1898503_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1898499_1898985_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1899197_1899617_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1899836_1900139_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1900199_1900550_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1900675_1901170_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1901166_1902900_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1902911_1903094_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1903093_1904335_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1904312_1904963_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1904977_1906183_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1906233_1906434_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1906436_1906760_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1906756_1907161_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1907132_1907645_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1907641_1908202_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1908205_1908370_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1908359_1909856_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1909855_1910212_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1910208_1910535_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1910619_1912548_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1912581_1913922_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066635.1|1913918_1914977_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	99.7	6.6e-202
WP_001273649.1|1914976_1915510_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1915514_1915928_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|1915899_1916445_+	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|1916479_1917001_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1917003_1917591_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|1917577_1919140_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_000760554.1|1919139_1919709_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1919993_1921001_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1921213_1921435_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_099112411.1|1921548_1921764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000500831.1|1922065_1922227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1922353_1922773_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1922775_1924044_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1924498_1924711_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1924721_1924910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1925170_1926367_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1927016_1927316_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1927407_1928103_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1928176_1929607_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	2033651	2040460	4773032	tail,integrase	Salmonella_phage(33.33%)	11	2035861:2035883	2045576:2045598
WP_000856224.1|2033651_2033882_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2034019_2034394_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2034394_2035270_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2035286_2035640_+	YebY family protein	NA	NA	NA	NA	NA
2035861:2035883	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2036013_2036868_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2036927_2037422_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2037611_2037842_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2037895_2038429_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2038685_2038853_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2038917_2039106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2039578_2040460_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2045576:2045598	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	2829671	2928260	4773032	terminase,tail,portal,integrase,protease,lysis,tRNA	Salmonella_phage(43.4%)	99	2853765:2853784	2925333:2925352
WP_000938191.1|2829671_2830352_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2830972_2831632_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2831718_2832048_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2832044_2832326_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2832374_2833154_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2833179_2833728_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2833942_2835154_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2835211_2835529_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2835573_2835990_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2836160_2836823_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2836917_2837376_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2837411_2839466_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2839589_2840036_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2840054_2842208_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2842194_2842800_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2843016_2843526_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2843882_2844935_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2845006_2845459_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2845644_2847405_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2847473_2847992_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2848091_2848259_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2848514_2849078_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2849074_2850715_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2850719_2851973_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2851987_2853895_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2853765:2853784	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2853907_2856016_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2856114_2857224_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2857220_2857763_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2857928_2858939_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2859146_2861759_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2862185_2862377_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2862647_2863334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2863318_2863618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2863686_2864313_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2864960_2865929_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2866404_2866986_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000178849.1|2869477_2869720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2869758_2873109_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2873180_2873885_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2873782_2874520_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2874529_2875225_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2875314_2875848_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2875964_2876462_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2876560_2876893_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2876889_2879877_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2879956_2880286_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2880282_2880681_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2880726_2881476_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2881487_2881889_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2881885_2882452_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2882432_2882732_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2882724_2883048_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_077679777.1|2885130_2886648_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2886674_2886881_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2886877_2889016_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2888972_2889506_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2889713_2890193_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2890210_2890663_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001141973.1|2891252_2891939_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2892299_2892749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2892884_2893010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2893183_2893501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2893567_2894365_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2894354_2894501_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2894497_2895109_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2895111_2895318_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2895317_2895920_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2896002_2896224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2896335_2896569_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2896860_2897151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2897228_2897540_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_079832191.1|2897536_2897884_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	95.7	2.3e-55
WP_000800013.1|2897894_2898644_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000062941.1|2898646_2899630_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2899714_2900089_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2900054_2900294_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2900413_2900824_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2900873_2901134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2901126_2901285_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2901306_2901606_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_001539618.1|2904372_2905530_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2905572_2905812_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2905852_2906101_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2906145_2907438_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2907632_2908835_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2908912_2910349_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2910593_2911808_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2911894_2912128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2912124_2912586_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2912786_2914187_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2914793_2915885_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2916069_2917260_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|2917321_2917969_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2917996_2918545_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2918804_2920646_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2920990_2925457_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2925333:2925352	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|2925456_2926161_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2926141_2927464_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2927456_2928260_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	2978353	2985970	4773032	transposase,protease	Enterobacteria_phage(16.67%)	7	NA	NA
WP_085983316.1|2978353_2979608_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|2979623_2979899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2980071_2980530_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2980721_2982998_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2983028_2983349_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2983672_2983894_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|2984023_2985970_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
>prophage 7
NZ_CP044967	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 chromosome, complete genome	4773032	4354367	4401412	4773032	plate,tail,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4354367_4355366_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4355453_4356764_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4357010_4357526_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4357624_4357834_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4357855_4357969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4357965_4359291_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4359469_4360078_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4360186_4360555_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4360725_4363146_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4363244_4364117_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4364130_4364628_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4364808_4365726_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4365889_4367248_-	maltoporin	NA	NA	NA	NA	NA
WP_151884577.1|4367337_4368447_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	4.7e-17
WP_000695417.1|4368808_4369999_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4370130_4371675_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4371689_4372580_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4372745_4373156_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4373298_4375395_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4375394_4376132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343934.1|4376128_4376797_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4376830_4377073_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4377516_4379166_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4379510_4380860_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4380992_4381340_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4381915_4382203_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270440.1|4382205_4382811_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_000777266.1|4382823_4383138_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4383297_4383753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4383749_4383947_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4383936_4385364_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4385363_4385888_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4385939_4386257_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4386216_4386345_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4386441_4388796_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4388795_4389749_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4389748_4389958_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4389945_4390989_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4390998_4391721_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4392048_4392411_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4392407_4393337_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4393336_4394884_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4395047_4395407_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4395397_4396513_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4396505_4397138_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4397140_4398886_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4398890_4399496_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4399492_4399948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4400196_4400487_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4400683_4401412_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP044969	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence	93724	69208	78504	93724	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_001541564.1|69208_69625_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|69808_70144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|70200_70767_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|70798_71740_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|72154_73360_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|73356_74334_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000457541.1|74415_75690_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|75689_76112_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|76622_77093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|77085_77442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091632.1|77490_77679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|77823_78504_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
>prophage 1
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	0	4193	245071		Salmonella_phage(50.0%)	4	NA	NA
WP_089617546.1|870_1290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089617545.1|1597_2047_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	7.5e-06
WP_001287388.1|2814_3219_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001114073.1|3839_4193_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
>prophage 2
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	11037	11679	245071		Streptomyces_phage(100.0%)	1	NA	NA
WP_032248957.1|11037_11679_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	1.8e-05
>prophage 3
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	15822	69167	245071	integrase,transposase,protease	Escherichia_phage(31.25%)	44	13645:13660	71776:71791
13645:13660	attL	TCGACCAGTTTTTCAA	NA	NA	NA	NA
WP_004210251.1|15822_16902_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_004181732.1|16903_17677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042014831.1|17669_18812_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.4	1.8e-32
WP_042014827.1|18823_19882_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_042014825.1|20192_20777_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_042014824.1|20773_21925_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|21947_22403_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_073528079.1|22426_23467_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.3	4.1e-71
WP_004026609.1|23505_24084_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_000301240.1|24170_24746_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_001176934.1|24830_26072_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_001100942.1|26408_27056_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001118621.1|27455_28379_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_000019452.1|28530_29511_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
WP_000780222.1|29788_30070_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|30050_30380_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001084041.1|31055_33128_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000085084.1|33124_34516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196200.1|34592_35174_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	5.5e-41
WP_085012003.1|35332_38341_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_010892343.1|38563_39232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090709.1|39846_40689_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001582168.1|40675_42802_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_053265771.1|42798_44244_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001582167.1|44286_45840_+	tniQ family protein	NA	NA	NA	NA	NA
WP_001371351.1|45855_46782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053265772.1|47905_48349_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_053265773.1|50240_50897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077816315.1|51222_51759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053265774.1|51700_53503_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_053265775.1|53499_54645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053265776.1|54650_56156_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_077816316.1|56464_56638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077816317.1|56675_56777_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_105462163.1|56757_57971_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	86.5	8.5e-145
WP_001089792.1|58511_59321_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024168330.1|59735_60077_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053276064.1|60171_63984_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000105680.1|63976_65197_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_000809340.1|65518_66136_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001115167.1|66132_66597_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000098664.1|66963_67626_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	63.3	6.8e-72
WP_001049170.1|67776_68619_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001233873.1|68615_69167_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.9	1.2e-45
71776:71791	attR	TCGACCAGTTTTTCAA	NA	NA	NA	NA
>prophage 4
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	74717	76884	245071		Burkholderia_phage(50.0%)	2	NA	NA
WP_000282148.1|74717_76145_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.0e-101
WP_000173534.1|76368_76884_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
>prophage 5
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	80285	81494	245071	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|80285_81494_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 6
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	99502	101180	245071		Morganella_phage(50.0%)	2	NA	NA
WP_001395519.1|99502_99937_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	41.1	1.2e-21
WP_000281817.1|99920_101180_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	43.1	7.1e-94
>prophage 7
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	105453	108069	245071	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000381395.1|105453_107025_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|107044_107392_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|107391_108069_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 8
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	125942	127854	245071		Escherichia_phage(50.0%)	2	NA	NA
WP_000476770.1|125942_127124_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	28.1	7.5e-05
WP_011011085.1|127140_127854_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.4	5.7e-08
>prophage 9
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	133357	134563	245071		Yersinia_phage(100.0%)	1	NA	NA
WP_000108723.1|133357_134563_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	27.5	2.0e-13
>prophage 10
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	141163	144163	245071		Salmonella_phage(66.67%)	6	NA	NA
WP_011011059.1|141163_141484_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.0	5.3e-06
WP_000055244.1|141560_141914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000478449.1|141929_142538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395478.1|142568_143093_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.8	6.2e-44
WP_001058453.1|143123_143435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011060.1|143431_144163_-	hypothetical protein	NA	Q71T76	Escherichia_phage	57.1	3.3e-67
>prophage 11
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	151649	151946	245071		Escherichia_phage(100.0%)	1	NA	NA
WP_000581856.1|151649_151946_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
>prophage 12
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	155573	156865	245071		Escherichia_phage(50.0%)	3	NA	NA
WP_000902167.1|155573_155933_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.9e-08
WP_012817920.1|155984_156164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178072.1|156160_156865_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	7.1e-11
>prophage 13
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	162033	162915	245071		Salmonella_phage(100.0%)	1	NA	NA
WP_000097746.1|162033_162915_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
>prophage 14
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	167759	176568	245071		Salmonella_phage(60.0%)	9	NA	NA
WP_136571528.1|167759_169514_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	30.7	1.2e-67
WP_001281654.1|169699_170857_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
WP_001225593.1|171216_172041_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
WP_001178650.1|172055_172877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682872.1|173159_173867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357614.1|173863_174064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015069.1|174081_175158_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
WP_072170511.1|175129_175360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282731.1|175692_176568_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
>prophage 15
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	191663	192671	245071		Aeromonas_phage(100.0%)	1	NA	NA
WP_001278833.1|191663_192671_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	32.1	3.9e-10
>prophage 16
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	195917	196952	245071		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000137273.1|195917_196952_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.3	6.7e-42
>prophage 17
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	212087	217744	245071		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000166873.1|212087_214127_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.2	5.4e-27
WP_000880375.1|214129_214384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000792088.1|214905_215778_-	lipoprotein	NA	NA	NA	NA	NA
WP_000517883.1|215959_217744_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	26.4	2.1e-19
>prophage 18
NZ_CP044968	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence	245071	225594	226848	245071		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001113001.1|225594_226848_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
