The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027986	Enterobacter sichuanensis strain SGAir0282 chromosome, complete genome	4711389	3527119	3595735	4711389	tail,plate,head,portal,capsid,lysis,integrase,tRNA	Salmonella_phage(76.47%)	69	3571903:3571917	3601452:3601466
WP_025757629.1|3527119_3528205_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_025757627.1|3528409_3528829_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.2	3.5e-13
WP_045284614.1|3528898_3529597_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_059386025.1|3529632_3532296_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_025757622.1|3532406_3533762_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155031573.1|3533806_3534130_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_047959264.1|3534126_3535422_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_025759246.1|3541028_3543602_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	2.6e-127
WP_025759247.1|3543731_3544463_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_025759248.1|3544459_3545440_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_023308867.1|3545571_3546309_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_008502470.1|3546577_3546919_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100249759.1|3547030_3547078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155031574.1|3547185_3548346_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_025759251.1|3548342_3549215_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_025759253.1|3549275_3550397_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_025759254.1|3550407_3551478_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	9.0e-90
WP_025759255.1|3551692_3552067_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_032672617.1|3552220_3552757_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_045286631.1|3552749_3553970_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	38.7	5.4e-06
WP_025759259.1|3553982_3554468_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155031575.1|3554470_3555841_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_094918824.1|3555879_3556284_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3556416_3556764_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_008502493.1|3556807_3557575_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_032672618.1|3557606_3558146_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3558161_3558410_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_008502496.1|3558526_3559888_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032623031.1|3560054_3560846_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_025759264.1|3560864_3562151_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_008502499.1|3562206_3562800_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_155031576.1|3562922_3563801_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_155031577.1|3563886_3565548_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_008502502.1|3565686_3566025_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_025759268.1|3566133_3566421_-	RnfH family protein	NA	NA	NA	NA	NA
WP_025759269.1|3566410_3566887_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_024908331.1|3567004_3567487_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_155031578.1|3568099_3568918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155031579.1|3569115_3569331_-	late control protein B	NA	Q53ZE7	Salmonella_virus	72.6	7.4e-20
WP_155031580.1|3570974_3571580_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	92.5	1.3e-109
WP_155031581.1|3571572_3572481_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.1	1.2e-140
3571903:3571917	attL	AAGCGCCTGTTCAAC	NA	NA	NA	NA
WP_155031582.1|3572467_3572827_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	3.1e-55
WP_155031940.1|3572823_3573402_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	95.8	1.8e-105
WP_155031583.1|3573502_3574198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075287537.1|3574199_3574631_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	92.9	8.1e-66
WP_155031584.1|3574641_3575073_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.3e-68
WP_155031586.1|3575168_3575597_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.9	4.4e-56
WP_155031587.1|3575593_3576109_-	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	75.9	2.0e-71
WP_050870765.1|3576089_3576305_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	4.4e-20
WP_000868184.1|3576308_3576512_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_155031588.1|3576511_3576976_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	90.9	2.6e-78
WP_155031589.1|3577069_3577720_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	95.4	3.6e-110
WP_155031590.1|3577723_3578785_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	4.2e-188
WP_155031591.1|3579777_3581544_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.6	0.0e+00
WP_155031592.1|3581543_3582578_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.8	2.0e-179
WP_155031593.1|3582626_3583517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155031594.1|3583522_3584509_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_155031596.1|3585280_3587635_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.3	0.0e+00
WP_155031597.1|3587631_3588462_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	78.7	4.2e-127
WP_155031598.1|3589309_3589537_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	88.0	3.6e-33
WP_162138795.1|3589536_3589743_-	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	68.7	1.6e-16
WP_155031599.1|3589831_3590173_-	DUF5347 family protein	NA	E5G6L5	Salmonella_phage	83.2	3.0e-47
WP_155031600.1|3590136_3590337_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	80.0	1.3e-23
WP_155031601.1|3590344_3590854_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	87.6	7.6e-79
WP_000102106.1|3590886_3591129_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_155031602.1|3591248_3591881_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	60.0	1.1e-66
WP_155031603.1|3591883_3592903_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	92.0	1.3e-186
WP_155031604.1|3592904_3594191_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	36.7	3.3e-70
WP_155031606.1|3594532_3595735_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	3.2e-104
3601452:3601466	attR	AAGCGCCTGTTCAAC	NA	NA	NA	NA
>prophage 2
NZ_CP027986	Enterobacter sichuanensis strain SGAir0282 chromosome, complete genome	4711389	4007900	4045659	4711389	tail,plate,head,portal,capsid,lysis,integrase,terminase,tRNA	Erwinia_phage(34.88%)	47	4014003:4014048	4046673:4046718
WP_025758545.1|4007900_4008914_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	1.8e-108
WP_001144069.1|4009150_4009366_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025758547.1|4009480_4011226_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_025758549.1|4011391_4013239_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	6.4e-35
WP_025758550.1|4013340_4013847_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4014003:4014048	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
WP_095450178.1|4014205_4014424_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.7	7.8e-33
WP_155031731.1|4014492_4015659_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	82.2	4.1e-181
WP_095450176.1|4015655_4016120_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	69.5	1.3e-58
WP_155031732.1|4016131_4018579_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	74.2	8.7e-306
WP_032658721.1|4018568_4018691_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	2.2e-13
WP_155031733.1|4018723_4019032_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	75.9	1.4e-27
WP_023209060.1|4019092_4019611_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	1.0e-78
WP_155031734.1|4019623_4020817_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	80.4	3.1e-184
WP_155031735.1|4020941_4021364_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	61.2	3.6e-10
WP_155031736.1|4021364_4023353_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	80.5	1.4e-91
WP_047352498.1|4023364_4023895_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.6	1.6e-92
WP_155031737.1|4023887_4024796_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	82.5	1.4e-136
WP_155031738.1|4024801_4025152_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	72.4	1.8e-39
WP_155031739.1|4025148_4025784_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	79.2	9.1e-90
WP_155031740.1|4025867_4026938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155031741.1|4026972_4027425_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.0	1.2e-48
WP_155031742.1|4027417_4027885_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	2.2e-61
WP_039266933.1|4027847_4028006_-	hypothetical protein	NA	Q6K1H9	Salmonella_virus	76.9	1.5e-14
WP_155031743.1|4027980_4028406_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.9	1.3e-44
WP_155031744.1|4028402_4028912_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	85.7	2.3e-80
WP_017382980.1|4028895_4029117_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_006175797.1|4029107_4029311_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	79.1	1.9e-25
WP_047352507.1|4029310_4029817_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	2.6e-63
WP_155031745.1|4029916_4030672_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	65.7	2.3e-76
WP_155031746.1|4030675_4031743_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.1	4.3e-169
WP_155031747.1|4031798_4032641_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	71.5	2.8e-110
WP_155031748.1|4032806_4034576_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	84.9	3.0e-300
WP_155031749.1|4034577_4035603_+|portal	phage portal protein	portal	Q37851	Escherichia_phage	83.3	1.0e-167
WP_155031750.1|4036029_4036929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155031751.1|4037008_4037740_-	hypothetical protein	NA	Q37850	Escherichia_phage	94.2	6.7e-129
WP_155031752.1|4037822_4038263_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	98.5	8.0e-69
WP_155031753.1|4038381_4040601_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.3	0.0e+00
WP_155031754.1|4040597_4041842_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	37.3	2.3e-44
WP_155031755.1|4041838_4042111_-	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	71.3	4.1e-31
WP_155031756.1|4042111_4042333_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	97.3	1.6e-33
WP_155031757.1|4042332_4042560_-	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000963463.1|4042627_4042966_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_155031758.1|4042929_4043130_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	97.0	3.9e-31
WP_155031759.1|4043137_4043647_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.2	2.8e-89
WP_001630878.1|4043677_4043941_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_155031760.1|4044070_4044649_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	64.1	1.3e-63
WP_155031761.1|4044648_4045659_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	5.9e-192
4046673:4046718	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
