The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	750641	776642	4693292	integrase,transposase	Pseudomonas_phage(50.0%)	18	770709:770723	786278:786292
WP_047749356.1|750641_751820_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	31.9	2.6e-21
WP_060615428.1|751904_753818_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	26.8	1.8e-16
WP_029403623.1|753867_754224_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_023892874.1|754278_755463_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_077877020.1|758161_759130_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
WP_000755102.1|759538_760279_+	porin family protein	NA	NA	NA	NA	NA
WP_152071810.1|760438_761938_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_116315299.1|763302_764531_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
WP_000523766.1|765787_766045_+	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_152071811.1|766089_766602_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000498858.1|766688_767276_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000739800.1|767396_769907_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_001171049.1|769975_770707_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
770709:770723	attL	AAAGCAGGAAAAAGA	NA	NA	NA	NA
WP_001077947.1|770743_771307_+	nuclease PIN	NA	NA	NA	NA	NA
WP_001223371.1|771390_771909_+	fimbrial protein	NA	NA	NA	NA	NA
WP_152071812.1|771931_772924_+	nuclease PIN	NA	NA	NA	NA	NA
WP_152071813.1|774031_774364_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032171996.1|775376_776642_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
786278:786292	attR	AAAGCAGGAAAAAGA	NA	NA	NA	NA
>prophage 2
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	993168	1001049	4693292		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_001295182.1|993168_993930_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|993923_994550_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|994689_995829_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|995891_996884_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_021547117.1|996977_998342_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|998430_999207_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|999211_999850_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_152071816.1|999846_1001049_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	59.6	5.7e-125
>prophage 3
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	1602942	1612383	4693292		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569316.1|1602942_1603869_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|1603873_1604605_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1604585_1604693_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1604752_1605484_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1605705_1607391_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1607387_1608107_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1608153_1608624_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1608663_1609125_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1609249_1611250_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1611246_1612383_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	1628653	1692544	4693292	portal,tRNA,capsid,integrase,terminase,lysis,plate,head,holin,tail	Escherichia_phage(58.82%)	75	1655896:1655922	1688220:1688246
WP_001338997.1|1628653_1630687_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
WP_001005448.1|1630818_1631928_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1632190_1632472_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830456.1|1632764_1633307_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|1633386_1634061_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945454.1|1634076_1636557_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405694.1|1636572_1637607_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1637688_1638027_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134591.1|1638245_1639070_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1639190_1639463_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195638.1|1639685_1640474_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1640470_1641271_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001373513.1|1641335_1642154_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.9e-24
WP_000434038.1|1642205_1642952_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063073687.1|1642925_1643891_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1643887_1644892_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1644888_1646166_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1646422_1647475_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_152071913.1|1647783_1648638_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_063073688.1|1648666_1649929_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|1649938_1650391_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_152071823.1|1650421_1650706_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1650709_1652065_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_152071824.1|1652112_1653153_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1653252_1654032_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807361.1|1654113_1655013_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|1655418_1655736_+	hypothetical protein	NA	NA	NA	NA	NA
1655896:1655922	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1656001_1657015_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1657130_1657430_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1657544_1657820_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1657830_1658001_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1657997_1658498_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|1658561_1658786_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|1658785_1659088_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001534949.1|1659087_1659312_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	8.5e-35
WP_113394460.1|1659308_1659584_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	97.8	1.9e-44
WP_113394459.1|1659573_1661850_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.3	0.0e+00
WP_001605760.1|1662337_1663882_-	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	100.0	4.5e-292
WP_050516365.1|1664396_1665623_+	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	100.0	6.6e-222
WP_000993280.1|1665619_1666327_+	hypothetical protein	NA	A0A0F7LBP9	Escherichia_phage	100.0	2.5e-128
WP_000038189.1|1666369_1667389_-|portal	phage portal protein	portal	A0A0F7L9Y5	Escherichia_phage	100.0	1.2e-197
WP_021538485.1|1667388_1669161_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085972.1|1669334_1670189_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248595.1|1670247_1671321_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	5.7e-201
WP_016236401.1|1671324_1672068_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.5e-123
WP_000988633.1|1672167_1672677_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_097727117.1|1672676_1672880_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.0e-30
WP_000123123.1|1672883_1673165_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1673164_1673662_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021563761.1|1673676_1674102_+	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_001490254.1|1674089_1674515_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	2.1e-66
WP_113394458.1|1674486_1674660_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	7.5e-23
WP_113394457.1|1674622_1675090_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	3.3e-81
WP_113394456.1|1675082_1675535_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	2.4e-76
WP_113394455.1|1675601_1676237_+|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	97.2	2.1e-110
WP_000127167.1|1676233_1676581_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_063267207.1|1676585_1677494_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	9.8e-162
WP_001285340.1|1677486_1678098_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_049595725.1|1678094_1679432_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.7	1.3e-186
WP_042974230.1|1679431_1680034_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.5	4.0e-95
WP_000782982.1|1680005_1680425_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	65.8	6.5e-36
WP_049595724.1|1680421_1680832_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	40.4	3.9e-09
WP_000905100.1|1680862_1681456_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_021520300.1|1681515_1682706_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_001251408.1|1682718_1683237_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1683293_1683569_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1683601_1683721_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_152071825.1|1683713_1686161_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.2	0.0e+00
WP_021520298.1|1686175_1686655_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	1.9e-84
WP_152071826.1|1686654_1687818_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|1687899_1688118_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1688390_1689752_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1688220:1688246	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|1689898_1690231_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1690421_1691144_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|1691140_1692544_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	1739764	1747807	4693292		Enterobacteria_phage(33.33%)	8	NA	NA
WP_061350270.1|1739764_1741159_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_032265993.1|1741316_1742312_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	4.2e-09
WP_032318855.1|1742554_1743448_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.7e-46
WP_032318854.1|1743819_1744896_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.0e-101
WP_032318852.1|1744892_1745765_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	6.4e-110
WP_050437014.1|1745757_1746165_+	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032318851.1|1746157_1746691_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059277568.1|1746703_1747807_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.4	3.9e-40
>prophage 6
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	1795549	1831736	4693292	transposase	Shigella_phage(28.57%)	27	NA	NA
WP_032255490.1|1795549_1796701_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000747078.1|1796620_1796971_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.4e-39
WP_001405986.1|1797548_1798571_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.5e-200
WP_001323403.1|1798570_1799350_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000349537.1|1799388_1799541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1800278_1800881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313064.1|1800974_1801253_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000221530.1|1802707_1803277_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270974.1|1803536_1803938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|1803925_1804333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656344.1|1806647_1807682_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739825.1|1807684_1808650_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066367.1|1808706_1809465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116315299.1|1813430_1814658_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
WP_087451024.1|1815025_1816145_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000973159.1|1816921_1817467_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001422426.1|1817463_1818207_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|1818218_1819298_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986331.1|1819359_1820295_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001422422.1|1820751_1821669_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011002.1|1821770_1822721_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001215961.1|1822934_1824575_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1825110_1825827_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060216.1|1826168_1827623_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_001422420.1|1827724_1829041_-	shikimate transporter	NA	NA	NA	NA	NA
WP_040234788.1|1829355_1830408_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_087451024.1|1830615_1831736_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 7
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	2223739	2376742	4693292	portal,capsid,integrase,tail,terminase,lysis,head,holin,protease,transposase	Escherichia_phage(29.85%)	148	2339113:2339129	2371358:2371374
WP_001260865.1|2223739_2224561_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2224660_2224744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2224836_2225172_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2225568_2226822_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2226928_2227822_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2227956_2229177_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2229301_2229997_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2229949_2231242_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2231401_2232016_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2232058_2232913_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2232914_2233532_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2233542_2235966_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_001752532.1|2236026_2238453_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2238651_2238957_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072104773.1|2239064_2239775_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2239777_2240338_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2240372_2240714_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2240848_2241175_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2241380_2242595_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836059.1|2242606_2243626_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2243683_2243794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152071851.1|2243813_2245094_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	2.5e-155
WP_000005552.1|2245128_2245380_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048364.1|2245452_2247930_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|2248023_2248215_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2248211_2248400_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_172966240.1|2248886_2249471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2249463_2249619_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000379970.1|2249785_2250193_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2250276_2250507_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705360.1|2250490_2251012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054494.1|2250992_2251958_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.9e-56
WP_000868823.1|2252581_2253052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152071852.1|2253156_2254575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546200.1|2254888_2254996_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000884073.1|2255040_2255253_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000980999.1|2255469_2255721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140913.1|2255787_2256066_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_063073470.1|2256067_2257117_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.2e-112
WP_001047131.1|2257130_2257883_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_000066484.1|2258558_2258774_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2259527_2259743_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001092971.1|2260054_2260588_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2260584_2261082_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2261444_2261657_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2261667_2261856_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122985912.1|2261858_2261924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2262003_2262159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2262330_2262504_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2262655_2263066_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2263123_2263357_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453603.1|2263745_2264291_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_032292250.1|2264265_2266191_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|2266187_2266394_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|2266390_2267992_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123333.1|2267972_2269292_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|2269301_2269634_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063224.1|2269689_2270715_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158880.1|2270756_2271152_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000752994.1|2271163_2271517_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000985116.1|2271528_2272107_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683143.1|2272103_2272499_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001439072.1|2272506_2273247_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000479139.1|2273262_2273685_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|2273666_2274101_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_032292244.1|2274093_2276673_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.1	0.0e+00
WP_000847345.1|2276669_2276999_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152580.1|2276998_2277697_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000140764.1|2277702_2278446_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_000090905.1|2278382_2278985_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
WP_089541214.1|2279045_2282525_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
WP_032292241.1|2282592_2283192_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_074147718.1|2283256_2286607_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_063073433.1|2286606_2287182_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.1e-102
WP_000086522.1|2287279_2287870_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|2288186_2288420_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2288488_2288602_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001752530.1|2290667_2292128_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	3.3e-42
WP_000214712.1|2292163_2292367_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2292544_2293231_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|2293319_2294066_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_152071853.1|2294202_2296248_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024808.1|2296292_2296811_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_063073449.1|2297086_2297479_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_152071854.1|2297733_2298624_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000901367.1|2298842_2298938_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054196.1|2299064_2300252_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087211.1|2300446_2301346_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803653.1|2301376_2301595_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2301626_2302010_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|2302030_2302465_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000273128.1|2302684_2303005_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000268704.1|2302994_2303279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000885033.1|2303399_2304065_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|2304089_2305280_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000258600.1|2305429_2306545_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366501.1|2306622_2307504_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001338596.1|2307604_2308993_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|2309056_2309983_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191019.1|2309982_2310342_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000854633.1|2311627_2313079_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001313828.1|2313285_2314200_+	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_001286597.1|2314203_2314962_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|2315018_2315309_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774189.1|2315332_2316208_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172466.1|2316234_2317257_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001752525.1|2317268_2318261_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911192.1|2318260_2319289_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194875.1|2319282_2320818_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	9.4e-16
WP_000154339.1|2321066_2322020_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113145.1|2322098_2323691_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001067855.1|2327038_2327743_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|2327748_2327889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|2328374_2329112_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|2329108_2329333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|2329543_2331037_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|2331067_2331319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152071855.1|2331212_2331515_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|2331601_2332417_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000954592.1|2332746_2332923_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067855.1|2333912_2334617_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|2334818_2335607_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|2335737_2336211_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000845048.1|2336368_2337382_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|2337584_2337935_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|2338110_2338671_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|2338674_2341641_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
2339113:2339129	attL	GAGAGCCTACGGCAGAA	NA	NA	NA	NA
WP_001301023.1|2345009_2345276_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125439.1|2345275_2346598_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_087451024.1|2346808_2347929_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000331940.1|2348061_2349585_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058671349.1|2349547_2351218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058671350.1|2351214_2353752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140767.1|2353744_2354248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071598204.1|2354421_2354754_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050010340.1|2354851_2355409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032149706.1|2355716_2356013_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074173854.1|2356101_2356701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016237032.1|2357385_2358162_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_044864441.1|2358148_2361649_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	24.9	5.3e-14
WP_058671351.1|2361987_2365227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077482927.1|2366240_2366663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157903522.1|2366945_2367125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072202726.1|2367166_2369932_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_040017492.1|2369900_2370446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058671353.1|2370438_2372826_-	restriction endonuclease	NA	NA	NA	NA	NA
2371358:2371374	attR	TTCTGCCGTAGGCTCTC	NA	NA	NA	NA
WP_000625667.1|2373403_2374681_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005032116.1|2374744_2376742_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
>prophage 8
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	3121331	3153452	4693292	integrase,terminase,lysis,protease	Enterobacteria_phage(37.78%)	52	3117832:3117846	3153526:3153540
3117832:3117846	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001328756.1|3121331_3122294_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_152071880.1|3122320_3122713_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_001029815.1|3122709_3123090_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_001547052.1|3123090_3123474_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	38.6	1.1e-13
WP_057950804.1|3123473_3123869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|3123872_3124049_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918487.1|3124091_3125231_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770037.1|3125329_3126094_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
WP_001469192.1|3126198_3127311_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.8	2.7e-113
WP_021546823.1|3127294_3128701_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.1e-187
WP_021546822.1|3128703_3130005_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	60.3	9.4e-150
WP_001547055.1|3129985_3131080_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.8	3.1e-114
WP_001307172.1|3131083_3131335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752316.1|3132194_3132983_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	9.7e-49
WP_001393986.1|3133120_3134578_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001228696.1|3134774_3134960_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135261.1|3135176_3135674_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000839596.1|3135673_3135889_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000592543.1|3136912_3137872_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_021546818.1|3138064_3138589_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3138744_3139122_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|3139207_3139348_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3139344_3139707_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000386643.1|3139913_3140255_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|3140257_3140434_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_001752315.1|3140430_3140958_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_063077928.1|3140954_3141374_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	2.2e-76
WP_000145931.1|3141467_3141758_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|3141754_3142456_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_001540839.1|3142452_3143352_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.7	6.5e-174
WP_001177650.1|3143386_3143665_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|3143773_3143959_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|3144039_3144690_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001358311.1|3145002_3145275_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001066169.1|3145291_3145873_-	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065374.1|3146133_3146502_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3146574_3146739_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3146707_3146851_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995467.1|3146925_3147222_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3147227_3148013_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3148009_3148690_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682305.1|3148686_3148869_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548514.1|3148841_3149033_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|3149043_3149325_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|3149423_3149645_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|3149641_3149893_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748282.1|3150191_3150806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129736.1|3151099_3151438_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000762731.1|3151466_3151895_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|3151978_3152146_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3152185_3152404_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3152381_3153452_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3153526:3153540	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
NZ_AP019675	Escherichia coli strain GSH8M-2	4693292	3601680	3691445	4693292	portal,integrase,capsid,protease,terminase,lysis,plate,head,holin,tail,transposase	Shigella_phage(40.58%)	100	3650025:3650084	3687530:3687589
WP_000131044.1|3601680_3603714_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3603842_3604430_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3604443_3605916_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3605929_3607600_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3607812_3608481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3608723_3609419_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3609411_3610839_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3610849_3611569_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3612095_3612950_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046306.1|3613175_3614501_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474084.1|3614609_3614846_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3614857_3615451_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3616041_3616893_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3622030_3622132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752157.1|3622495_3622759_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3622758_3622899_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3622933_3623161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752155.1|3623984_3624527_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3624601_3625189_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3625246_3625915_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3625940_3628466_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_021546761.1|3628455_3630099_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3630067_3630778_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3631090_3631420_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_152071886.1|3631667_3632282_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070700.1|3632699_3633389_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3633385_3634342_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_152071887.1|3634338_3636537_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_001752149.1|3636546_3637503_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3637481_3637892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080773257.1|3638308_3638485_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	75.9	2.0e-18
WP_152071888.1|3638548_3639658_-	acyltransferase family protein	NA	G9L6E5	Escherichia_phage	82.3	1.6e-166
WP_116315299.1|3640256_3641484_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
WP_087451024.1|3643285_3644405_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_152071915.1|3644398_3644656_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	6.8e-36
WP_152071916.1|3645438_3645717_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	50.6	7.6e-17
WP_001008126.1|3645716_3645851_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	90.9	1.9e-13
WP_001243355.1|3645835_3645988_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|3646072_3646381_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_000065846.1|3646377_3647280_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.4	5.2e-147
WP_000041328.1|3647263_3647746_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.2	1.3e-77
WP_000753555.1|3647757_3648072_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_001214452.1|3648088_3648253_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_112021857.1|3648249_3648483_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	98.2	2.1e-23
WP_152071889.1|3648863_3650024_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P7R5	Enterobacteria_phage	99.2	1.7e-227
3650025:3650084	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001742131.1|3650524_3651469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000355479.1|3651885_3652659_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_152071890.1|3652850_3653453_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	74.5	6.8e-79
WP_152071891.1|3653452_3654262_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	6.2e-51
WP_152071892.1|3654265_3654850_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_152071893.1|3654840_3655899_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	9.5e-201
WP_000424732.1|3655885_3656311_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259079.1|3656310_3656859_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_053270605.1|3656858_3657938_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	7.7e-206
WP_053270604.1|3657934_3659263_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.3	1.1e-243
WP_000734912.1|3659373_3659820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021534248.1|3659852_3661685_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.5e-302
WP_000661054.1|3661826_3662096_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_021534249.1|3662095_3662452_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_063101482.1|3662451_3663948_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.4	1.5e-271
WP_074613451.1|3663931_3664102_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.4	7.9e-25
WP_000779283.1|3664110_3664671_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_074613450.1|3664667_3665174_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	94.6	3.7e-86
WP_097415017.1|3665148_3665559_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	3.3e-69
WP_000927711.1|3665555_3665879_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_097415018.1|3665881_3666082_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	2.9e-26
WP_130563974.1|3666132_3667338_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	3.5e-223
WP_001193632.1|3667352_3668003_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_152071894.1|3667980_3669222_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	3.8e-241
WP_000605604.1|3669221_3669404_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|3669415_3670912_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929175.1|3671145_3671640_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_063118238.1|3671765_3672116_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	8.9e-63
WP_152071895.1|3672192_3673056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778468.1|3673128_3673590_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	87.6	1.9e-68
WP_016239924.1|3673573_3674050_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	7.0e-87
WP_001120497.1|3674053_3674380_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_063118234.1|3674676_3676008_+	NTPase	NA	R9TRQ8	Vibrio_phage	29.7	6.5e-21
WP_077943988.1|3676036_3676405_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	86.7	2.7e-54
WP_063118233.1|3676419_3677409_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	6.8e-193
WP_020219063.1|3677416_3678214_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	1.4e-148
WP_000767111.1|3678233_3678623_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_052895298.1|3678619_3678946_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.7e-52
WP_001573323.1|3678945_3679440_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104957.1|3679436_3680378_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|3680367_3680547_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515870.1|3680722_3681274_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_000205494.1|3681311_3681512_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3681609_3682236_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000549623.1|3682483_3682690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3682661_3683096_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|3683564_3683927_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3683992_3684817_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3684944_3685481_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3685471_3685834_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3685833_3686139_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|3686365_3687529_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893279.1|3687733_3688987_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
3687530:3687589	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3688998_3690102_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3690389_3691445_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
NZ_AP019676	Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence	145389	1341	78704	145389	integrase,bacteriocin,protease,transposase	Enterobacteria_phage(25.0%)	58	22235:22252	64446:64463
WP_001066954.1|1341_2082_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_065203495.1|2202_2391_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_001312822.1|2764_3667_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3735_4845_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|5277_6231_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_032145261.1|6334_6724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312823.1|7504_7663_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000928804.1|10499_11687_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|11683_13624_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|13627_14998_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|15794_16736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|18996_20190_-	GTP-binding protein	NA	NA	NA	NA	NA
22235:22252	attL	CAACTGCGCACGCGACAC	NA	NA	NA	NA
WP_000738422.1|23275_23569_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|26714_27830_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111199.1|27969_31629_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_000933675.1|31732_32962_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_064055648.1|33046_34003_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|34047_36225_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001259759.1|37167_37371_-|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014640552.1|37348_37585_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|38048_38330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|38687_39215_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|39458_40274_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|40323_40677_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|40854_41646_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|41642_42332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|42375_42726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064055658.1|43257_47079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000251882.1|47322_47484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142450.1|47501_47849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|48150_48633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023154360.1|48749_49598_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	5.0e-27
WP_000969990.1|49643_49925_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001214976.1|51771_52179_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|52316_53201_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001493765.1|53232_54432_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|54537_55188_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|55219_55462_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001143760.1|56269_59275_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|59438_59996_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_015058868.1|60178_61039_+	class A broad-spectrum beta-lactamase TEM-135	NA	Q1MVP3	Enterobacteria_phage	99.7	3.0e-160
WP_004201280.1|61780_62254_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_086525284.1|63467_64172_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_001516695.1|65249_65906_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
64446:64463	attR	CAACTGCGCACGCGACAC	NA	NA	NA	NA
WP_001493761.1|66685_68077_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|68113_68686_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|68822_69413_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000844627.1|69530_69773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159186494.1|69804_70455_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|70560_71760_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|72026_72332_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|72359_73574_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|73790_74675_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|74705_76199_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|76409_76634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|76630_77368_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|77853_77994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|77999_78704_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_AP019678	Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence	49365	18603	28436	49365	transposase	Escherichia_phage(37.5%)	12	NA	NA
WP_001067855.1|18603_19308_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|19317_19788_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|19807_20596_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|20595_21114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|21118_21535_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|21920_22625_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013023839.1|23676_24153_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_015387340.1|24199_25075_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|25496_26201_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_073503519.1|26247_26577_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_073503518.1|26668_27544_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.6	5.0e-06
WP_000018321.1|27620_28436_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
