The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	54177	110157	3592195	protease,transposase	Streptococcus_phage(21.43%)	60	NA	NA
WP_152259993.1|54177_55383_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	45.2	1.6e-95
WP_152259994.1|55835_57419_-	ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	28.6	1.9e-51
WP_152259995.1|57785_59582_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.6	2.7e-70
WP_152259996.1|59544_61227_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_150392788.1|61261_62242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152259997.1|62255_63869_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_150392790.1|63981_64959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027828812.1|65111_65405_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_063516798.1|65437_66025_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	64.3	1.6e-40
WP_027828810.1|66068_66308_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027828809.1|66427_66865_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	53.1	6.4e-34
WP_152259998.1|66932_67556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152259999.1|67912_69145_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.1	1.4e-78
WP_027828808.1|69433_69634_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	2.8e-21
WP_152260000.1|69959_70736_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_152260001.1|70847_71444_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_152261743.1|71466_72213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146995169.1|72197_73223_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_152260002.1|73393_74764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_152260003.1|74900_75356_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146995171.1|75427_76360_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.0	5.1e-41
WP_152260004.1|76352_77066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260005.1|77088_77802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260006.1|77947_78448_+	EXLDI protein	NA	NA	NA	NA	NA
WP_063516802.1|79089_79335_+	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_152260007.1|79335_80040_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_152260008.1|80076_80730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260009.1|80769_81696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260010.1|81698_82376_-	response regulator	NA	NA	NA	NA	NA
WP_152260011.1|82474_83527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260012.1|83791_84274_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	36.6	6.0e-17
WP_152260013.1|84347_84731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260014.1|84936_85602_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_152260015.1|85616_86486_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_152260016.1|86482_86965_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_146995182.1|87124_89137_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_027828796.1|89164_89620_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_027828795.1|89661_91071_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.3	5.3e-130
WP_027828794.1|91246_92551_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.2	2.2e-61
WP_152260017.1|92842_93613_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.2	3.8e-05
WP_152260018.1|93609_94362_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027828792.1|94496_94865_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152260019.1|94836_95670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260020.1|95809_96508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260021.1|96504_100419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063516101.1|100640_101177_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152260022.1|101176_102235_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_027828787.1|102249_102933_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.1e-31
WP_152260023.1|103067_103571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260024.1|103501_103858_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_152260025.1|103908_104532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260026.1|104528_104858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260027.1|104934_105120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260028.1|105303_106674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152260029.1|106745_107162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260030.1|107139_107880_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	1.3e-15
WP_152260031.1|107869_108331_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027828781.1|108526_108739_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152260032.1|108735_109242_+	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_152260033.1|109395_110157_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	129051	175273	3592195	protease,transposase	Paenibacillus_phage(50.0%)	48	NA	NA
WP_152260039.1|129051_130137_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.3	3.1e-37
WP_027829192.1|130545_131541_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_150392837.1|131578_132394_+	mannose/fructose/sorbose family PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_027829190.1|132411_133332_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_027829189.1|133444_133828_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_152260040.1|133908_134367_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_150392840.1|134397_135624_-	MFS transporter	NA	NA	NA	NA	NA
WP_081674910.1|135676_136285_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_150392841.1|136317_137145_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_150392842.1|137141_137960_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_152260041.1|137949_138522_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152260042.1|138574_139087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260043.1|139248_139539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260044.1|139520_140087_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_035440922.1|140160_141135_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_152260045.1|141182_142115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260046.1|142189_143572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260047.1|143571_146346_+	glycosyl transferase family 51	NA	NA	NA	NA	NA
WP_152260048.1|146444_147551_+	cation transporter	NA	NA	NA	NA	NA
WP_152260049.1|147554_148832_-	iron reductase	NA	NA	NA	NA	NA
WP_152260050.1|148815_149601_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_027829177.1|149597_150071_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_152260051.1|150211_150559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260052.1|150858_151743_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260053.1|152005_152908_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260054.1|153137_153728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261744.1|153824_154454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260055.1|154652_156005_-	gluconate permease	NA	NA	NA	NA	NA
WP_152260056.1|156040_157606_-	gluconokinase	NA	NA	NA	NA	NA
WP_063516606.1|157627_158524_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4QFD6	Synechococcus_phage	35.8	1.5e-45
WP_152261745.1|158667_159519_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_152260057.1|160017_161517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027829284.1|161549_161873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063516603.1|161949_163188_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_152260058.1|163184_165146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027829280.1|165386_166094_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_152260059.1|166177_167119_+	oxidoreductase	NA	NA	NA	NA	NA
WP_027827946.1|167356_167569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260060.1|167786_167966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056990078.1|167962_168268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260061.1|168301_169198_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.6	3.6e-31
WP_056990076.1|169173_169929_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	39.5	9.3e-33
WP_152260062.1|169959_170634_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_152260028.1|170813_172184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152260063.1|172262_172493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260064.1|172698_173394_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_152260065.1|173409_174291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260066.1|174508_175273_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	580682	683004	3592195	integrase,head,tail,portal,protease,holin,capsid,terminase,transposase	Lactobacillus_phage(50.98%)	105	614970:614986	640426:640442
WP_152260179.1|580682_581897_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	48.3	1.3e-105
WP_152260180.1|581977_582613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146994678.1|583002_583776_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_063516357.1|583799_584270_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_146994676.1|584564_585686_-	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.3	4.2e-21
WP_146994686.1|585818_586583_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_051225429.1|586695_588123_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_027829269.1|588146_588440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146994674.1|588552_589212_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_063516361.1|589238_590444_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_152260181.1|590478_591186_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_146994684.1|591578_592937_+	MFS transporter	NA	NA	NA	NA	NA
WP_152260182.1|592946_593828_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_152260183.1|593824_594538_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	37.5	3.6e-18
WP_146994668.1|594506_596897_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_146994665.1|597020_599318_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_152260184.1|599372_601268_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	23.9	8.1e-25
WP_152260185.1|601086_602022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994659.1|602169_602406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994657.1|602436_603420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146994655.1|603497_603839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994653.1|603900_604083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035440339.1|604489_605794_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_146994651.1|605860_606796_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152260186.1|606923_608525_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	22.6	6.6e-20
WP_146994647.1|608583_608937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994645.1|609004_609430_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152260187.1|609454_610327_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027828528.1|612513_613365_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_027828527.1|613364_613733_+	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_146995094.1|613719_614259_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146995095.1|614549_615542_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	1.0e-119
614970:614986	attL	GATCAGCTTGATGATCT	NA	NA	NA	NA
WP_027828523.1|617836_618067_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	36.0	3.5e-07
WP_152260188.1|618424_618700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260189.1|618718_619024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035440334.1|619086_619725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027828520.1|619941_621252_+	amino acid permease	NA	NA	NA	NA	NA
WP_027828519.1|621248_622145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146995096.1|622279_623494_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	29.4	8.2e-23
WP_063515944.1|623562_624255_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_152261753.1|624430_625729_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_027828515.1|625797_626142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261754.1|626223_628743_-	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	29.6	3.0e-128
WP_051225286.1|628760_629444_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_152260028.1|629842_631213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146995098.1|631322_631511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027828512.1|631626_632736_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_152260190.1|632740_633328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260191.1|633352_633973_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_152261755.1|634268_634613_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	47.6	8.3e-21
WP_152260192.1|634566_635403_-|integrase	tyrosine-type recombinase/integrase	integrase	Q8W767	Lactobacillus_phage	32.4	2.1e-38
WP_152260193.1|635604_635949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260194.1|635950_637114_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_152260039.1|637393_638479_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.3	3.1e-37
WP_152260195.1|638553_639210_-	hypothetical protein	NA	A0A1B0XVT8	Campylobacter_phage	35.2	4.5e-15
WP_152260196.1|639327_640560_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.1	1.4e-78
640426:640442	attR	GATCAGCTTGATGATCT	NA	NA	NA	NA
WP_152260197.1|640784_641477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260198.1|641832_643065_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	43.8	1.8e-78
WP_152260199.1|643259_643925_-	helix-turn-helix domain-containing protein	NA	O64370	Lactobacillus_phage	56.1	8.4e-62
WP_035439868.1|644093_644363_+	helix-turn-helix transcriptional regulator	NA	B8R673	Lactobacillus_phage	55.9	3.8e-13
WP_152260200.1|644359_645166_+	hypothetical protein	NA	Q9T1J2	Lactobacillus_phage	58.8	3.3e-44
WP_152260201.1|645295_645433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260202.1|645660_646011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260203.1|646155_646392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260204.1|646394_646886_+	hypothetical protein	NA	A0A1B0Y2S7	Lactobacillus_phage	42.7	8.5e-27
WP_152260205.1|646897_647674_+	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	71.0	3.0e-95
WP_152260206.1|647582_648965_+	AAA family ATPase	NA	A0A0P0ID30	Lactobacillus_phage	63.1	2.9e-165
WP_152260207.1|648965_649538_+	hypothetical protein	NA	Q7Y5K0	Xanthomonas_virus	44.1	4.3e-06
WP_152260208.1|649537_650089_+	DUF669 domain-containing protein	NA	A0A0P0IQI1	Lactobacillus_phage	58.7	8.2e-55
WP_152260209.1|650103_652407_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	70.9	0.0e+00
WP_152260210.1|652661_653720_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	7.9e-38
WP_152261756.1|653953_654238_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	68.1	6.6e-32
WP_152261757.1|654549_655008_+	dUTP diphosphatase	NA	R9QNB7	Lactococcus_phage	57.1	1.9e-33
WP_152260211.1|655035_655446_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	51.7	6.4e-28
WP_152260212.1|655438_655747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260213.1|655682_656186_+	hypothetical protein	NA	O64272	Lactococcus_phage	33.3	2.9e-06
WP_152260214.1|656998_657934_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_152260215.1|657966_658518_+	hypothetical protein	NA	A0A090DC14	Clostridium_phage	26.5	2.4e-06
WP_152260216.1|658591_658849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261758.1|659028_659535_+	HNH endonuclease	NA	Q9T1G1	Lactobacillus_phage	46.4	3.8e-38
WP_152260217.1|659651_660125_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	50.7	4.6e-38
WP_152260218.1|660121_662014_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	67.8	9.2e-255
WP_152260219.1|661976_662210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260220.1|662209_663397_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	51.7	8.7e-94
WP_152260221.1|663374_664091_+|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	48.1	1.4e-51
WP_152260222.1|664090_665335_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	52.9	7.7e-109
WP_152260223.1|665407_665716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260224.1|665705_666050_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	79.8	1.5e-46
WP_152260225.1|666052_666472_+	HK97 gp10 family phage protein	NA	Q6J1X9	Lactobacillus_phage	79.7	7.4e-56
WP_152260226.1|666468_666852_+	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	76.9	2.3e-48
WP_152260227.1|666851_667505_+|tail	phage tail protein	tail	Q6J1X7	Lactobacillus_phage	71.6	1.7e-78
WP_152260228.1|667691_668048_+|tail	phage tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	73.3	2.8e-40
WP_152260229.1|667986_668268_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	65.9	5.7e-12
WP_152260230.1|672270_673782_+	hypothetical protein	NA	Q7Y4B1	Lactobacillus_phage	31.9	1.4e-08
WP_152260231.1|673798_676009_+	hypothetical protein	NA	Q9AZR8	Lactococcus_phage	25.6	1.8e-15
WP_152260232.1|676030_676318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260233.1|676310_676439_+	XkdX family protein	NA	NA	NA	NA	NA
WP_152260234.1|676453_676750_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	50.5	2.1e-17
WP_152260235.1|676739_677132_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	80.0	8.0e-28
WP_152260236.1|676995_678006_+	hypothetical protein	NA	E7DNC3	Pneumococcus_phage	52.6	3.1e-39
WP_152260237.1|678471_679551_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_152260238.1|679661_680246_+	helix-turn-helix domain-containing protein	NA	A0A1V0E035	Clostridioides_phage	34.5	8.2e-21
WP_152260239.1|680269_681439_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.6	1.2e-07
WP_152260240.1|682054_682498_-	hypothetical protein	NA	E7DNC3	Pneumococcus_phage	47.6	3.5e-32
WP_051225262.1|682533_683004_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	47.0	3.6e-27
>prophage 4
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	716757	764029	3592195	tRNA,transposase	Bacillus_phage(20.0%)	46	NA	NA
WP_152260266.1|716757_717513_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.8	9.3e-33
WP_152260267.1|718437_719142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152260268.1|719349_719784_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	56.9	5.3e-41
WP_152260269.1|719758_720943_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	51.7	5.8e-106
WP_150393176.1|721125_721686_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_150393177.1|721743_722253_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_035440225.1|722363_723332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150393178.1|723577_724270_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_152260270.1|724285_724597_+	chorismate mutase	NA	NA	NA	NA	NA
WP_152260271.1|724617_725469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260272.1|725465_725927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260028.1|726177_727548_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152260273.1|727662_728493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260274.1|728455_729376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260275.1|729672_731064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260276.1|731271_732129_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_152260277.1|732270_734274_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_152260278.1|734288_735752_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_063516026.1|735847_736984_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.9	2.5e-21
WP_152260279.1|737334_737853_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_152260280.1|737853_738690_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_152260281.1|738746_739031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260282.1|739023_741060_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.7	3.1e-91
WP_150393200.1|741081_741867_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_051225299.1|741863_742442_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_150393201.1|742434_743304_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_027828613.1|743406_743673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035440424.1|743978_744863_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_150393203.1|744862_745243_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_152260283.1|745299_746844_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_027828617.1|746998_747859_+	pur operon repressor	NA	NA	NA	NA	NA
WP_150393206.1|748259_749648_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	35.9	3.5e-33
WP_150393207.1|749666_750650_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.0	1.5e-43
WP_027828620.1|750762_751140_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_152260284.1|751161_752220_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_152261759.1|752726_753257_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_152260285.1|752944_755500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027828624.1|755506_755962_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_027828625.1|755968_756787_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_027828626.1|756773_758147_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.0	7.4e-28
WP_027828627.1|758292_758736_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_027828628.1|758780_759467_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_146994197.1|759614_761261_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.3	1.1e-139
WP_146994198.1|761409_762690_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027828631.1|762789_763074_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_152260286.1|763135_764029_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.8e-36
>prophage 5
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	1129936	1189354	3592195	tRNA,integrase,tail,portal,coat,capsid,terminase,transposase	Lactobacillus_phage(47.5%)	79	1134042:1134057	1168284:1168299
WP_063516466.1|1129936_1131448_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_152260430.1|1131570_1132980_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	29.7	6.2e-46
WP_063516465.1|1132976_1133378_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_063516464.1|1133370_1134141_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
1134042:1134057	attL	AACGATTCCCATGGCG	NA	NA	NA	NA
WP_063516463.1|1134140_1134689_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_152260431.1|1134806_1135406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081674942.1|1135471_1135621_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_027829443.1|1135640_1135814_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_027829442.1|1135947_1136496_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	28.4	9.8e-08
WP_152260432.1|1136498_1137143_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_152261770.1|1136842_1137352_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027829439.1|1137748_1138174_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_027829438.1|1138257_1138947_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_152260433.1|1138996_1139299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260434.1|1139297_1140272_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063516835.1|1140247_1141021_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_152260435.1|1141036_1141939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260436.1|1142015_1143677_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	23.1	1.7e-15
WP_152260437.1|1143627_1144542_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_152260438.1|1144881_1146318_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.8	1.2e-97
WP_152260439.1|1146341_1146902_-	isochorismatase family protein	NA	G3MA16	Bacillus_virus	41.2	7.9e-29
WP_027828845.1|1147193_1147703_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_027828844.1|1147741_1148113_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_152260440.1|1148275_1149451_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0Q7	Streptococcus_phage	30.2	3.2e-40
WP_152260441.1|1149563_1150070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260442.1|1150053_1150524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260443.1|1150660_1151305_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	30.3	6.3e-14
WP_152260444.1|1151596_1152718_-	endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	50.1	4.2e-90
WP_152260445.1|1152792_1153218_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	37.6	3.6e-18
WP_152260446.1|1153210_1153537_-	helix-turn-helix domain-containing protein	NA	A0A1B0Y2R0	Lactobacillus_phage	48.1	1.9e-19
WP_152261771.1|1153754_1153946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260447.1|1153942_1154674_+	hypothetical protein	NA	A0A1B0YEA7	Lactobacillus_phage	47.7	2.4e-38
WP_152260448.1|1154696_1155251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260449.1|1155251_1155530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260450.1|1155674_1155896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260451.1|1155951_1156437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260452.1|1156439_1157285_+	recombinase RecT	NA	J7KDK3	Streptococcus_phage	43.4	6.5e-51
WP_150393219.1|1157262_1158156_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	53.1	4.9e-81
WP_152260453.1|1158168_1158990_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	52.5	6.5e-64
WP_152260454.1|1158970_1159801_+	AAA family ATPase	NA	O03914	Lactobacillus_phage	46.9	1.9e-55
WP_150391541.1|1159942_1160128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150391542.1|1160084_1160639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260455.1|1160635_1161055_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	52.2	1.8e-30
WP_152260456.1|1161059_1161320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260457.1|1161343_1161625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150391546.1|1161621_1161885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150391547.1|1161881_1162301_+	hypothetical protein	NA	A0A140HLR7	Bacillus_phage	54.8	1.9e-27
WP_150391548.1|1162293_1162632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150393220.1|1162651_1163110_+	SAM-dependent methyltransferase	NA	Q8LTB0	Lactobacillus_phage	64.6	1.3e-53
WP_152260119.1|1163274_1164516_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	1.1e-43
WP_150391550.1|1165101_1165329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260458.1|1165342_1165738_+	hypothetical protein	NA	R4ICD6	Listeria_phage	32.1	4.7e-12
WP_150391552.1|1165848_1166088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150391553.1|1166278_1166695_+	ArpU family transcriptional regulator	NA	A0A2H4JEJ9	uncultured_Caudovirales_phage	45.7	7.9e-18
WP_152261772.1|1167291_1167843_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_152260120.1|1168064_1168958_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	3.7e-36
1168284:1168299	attR	AACGATTCCCATGGCG	NA	NA	NA	NA
WP_152260121.1|1168909_1169446_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260459.1|1169702_1170284_+|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	55.5	2.6e-35
WP_152260460.1|1170237_1171551_+|terminase	PBSX family phage terminase large subunit	terminase	V5UTH5	Oenococcus_phage	60.6	1.2e-152
WP_152260461.1|1171540_1173022_+|portal	phage portal protein	portal	Q708N3	Streptococcus_phage	41.3	6.0e-100
WP_152260462.1|1173002_1174706_+	hypothetical protein	NA	A9D9S7	Lactobacillus_prophage	39.3	8.5e-66
WP_152260463.1|1174877_1175084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260464.1|1175177_1175765_+|capsid	phage capsid protein	capsid	Q20DD5	Lactobacillus_phage	42.2	3.0e-31
WP_152260465.1|1175764_1176751_+|coat	coat protein	coat	Q708M6	Streptococcus_phage	60.1	4.1e-113
WP_152260466.1|1176833_1177304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260467.1|1177316_1177718_+	hypothetical protein	NA	X2CXX4	Lactobacillus_phage	39.4	2.5e-16
WP_152261773.1|1177717_1178110_+	hypothetical protein	NA	X2CXE4	Lactobacillus_phage	53.3	1.8e-27
WP_152260468.1|1178087_1178534_+	hypothetical protein	NA	A9D9U1	Lactobacillus_prophage	34.6	1.7e-18
WP_152260469.1|1178553_1178949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260470.1|1179108_1180548_+|tail	phage tail protein	tail	X2CXX5	Lactobacillus_phage	43.5	5.4e-98
WP_152261774.1|1180570_1181047_+|tail	phage tail protein	tail	X2CXE5	Lactobacillus_phage	58.3	3.5e-46
WP_152260471.1|1181051_1181486_+	hypothetical protein	NA	A9D9V7	Lactobacillus_prophage	44.4	1.1e-25
WP_152260472.1|1181697_1185129_+	hypothetical protein	NA	L0P6G7	Lactobacillus_phage	57.0	2.8e-84
WP_152260473.1|1185141_1185843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260474.1|1185846_1186881_+	late control protein D	NA	X2CXX6	Lactobacillus_phage	34.1	2.5e-44
WP_152260475.1|1186880_1187219_+	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	45.0	9.0e-20
WP_152260476.1|1187218_1187599_+	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	54.9	5.3e-29
WP_152260477.1|1187595_1188738_+	hypothetical protein	NA	L0P7C2	Lactobacillus_phage	48.3	6.6e-99
WP_152260478.1|1188730_1189354_+	DUF2313 domain-containing protein	NA	X2CY68	Lactobacillus_phage	36.2	3.8e-16
>prophage 6
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	1229605	1330666	3592195	tRNA,integrase,head,tail,portal,protease,holin,capsid,terminase,transposase	Lactobacillus_phage(46.34%)	110	1249855:1249914	1293255:1293383
WP_152260493.1|1229605_1231171_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_146995656.1|1231269_1231629_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_027827606.1|1231603_1231798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260494.1|1232127_1232454_+	DUF2568 domain-containing protein	NA	NA	NA	NA	NA
WP_152260495.1|1232539_1233352_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	66.2	3.5e-70
WP_152260496.1|1233427_1233958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082230949.1|1234092_1234686_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_063516432.1|1234737_1235523_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_152260497.1|1235601_1236357_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_027829393.1|1236532_1236742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260498.1|1236912_1237158_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_063516435.1|1237282_1238470_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_152260499.1|1238466_1239513_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_051225448.1|1239509_1240562_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_027829389.1|1240641_1240875_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_081674934.1|1241264_1243490_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.5	5.2e-140
WP_152260500.1|1243501_1243957_+	transcriptional repressor	NA	NA	NA	NA	NA
1249855:1249914	attL	CTCGCTCTCCGTAATTGACTCGAACTGAGTTTACTTGAACCCCTGAAATGCCTTTATACC	NA	NA	NA	NA
WP_152260501.1|1250023_1251154_-|integrase	tyrosine-type recombinase/integrase	integrase	B4XYR4	Lactobacillus_phage	74.7	2.0e-164
WP_152260502.1|1251261_1251843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260503.1|1251937_1252705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260504.1|1252704_1253193_-	helix-turn-helix domain-containing protein	NA	A0A097QQ00	Enterococcus_phage	43.2	4.0e-13
WP_152260505.1|1253338_1253557_+	XRE family transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	52.5	2.7e-09
WP_152260506.1|1254190_1254583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261776.1|1254624_1254837_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_152260507.1|1254833_1255034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260508.1|1255026_1255299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260509.1|1255379_1255799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260510.1|1255799_1256990_+	DUF2800 domain-containing protein	NA	D2J037	Enterococcus_phage	42.6	3.0e-78
WP_152260511.1|1256992_1257580_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	53.4	1.2e-40
WP_152260512.1|1257593_1258262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260513.1|1258265_1258793_+	HNH endonuclease	NA	A0A0E3T8A7	Gordonia_phage	41.1	3.8e-17
WP_152260514.1|1258789_1260751_+	DNA polymerase	NA	D2J043	Enterococcus_phage	57.9	1.6e-217
WP_152261777.1|1260960_1261341_+	dUTP diphosphatase	NA	Q9AZU3	Lactococcus_phage	58.9	1.5e-34
WP_152260515.1|1261342_1261852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260516.1|1261851_1262409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260517.1|1262395_1262614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260518.1|1262603_1262801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260519.1|1262797_1263181_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	37.1	3.9e-11
WP_152260520.1|1263177_1263372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260521.1|1263368_1263719_+	hypothetical protein	NA	Q4ZC86	Staphylococcus_virus	51.4	6.7e-10
WP_152260522.1|1263718_1264069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260523.1|1264199_1264625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260524.1|1264608_1264836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260525.1|1265080_1265383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261778.1|1265494_1267828_+	DNA primase	NA	A7J282	Streptococcus_phage	46.3	2.1e-123
WP_152261779.1|1268422_1269697_+	ATP-dependent helicase	NA	D2J050	Enterococcus_phage	62.1	5.2e-153
WP_152260526.1|1269699_1270020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260527.1|1270032_1270440_+	transcriptional regulator	NA	A0A1B0YC57	Lactobacillus_phage	43.0	2.5e-24
WP_152261780.1|1270664_1271495_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	67.8	7.4e-108
WP_152260528.1|1271688_1272141_+|terminase	terminase	terminase	U5U3Z1	Lactobacillus_phage	68.9	7.5e-54
WP_152260529.1|1272161_1273874_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	86.5	7.4e-296
WP_152260530.1|1273885_1274089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260531.1|1274095_1275364_+|portal	phage portal protein	portal	U5U764	Lactobacillus_phage	79.3	8.5e-188
WP_152260532.1|1275308_1275944_+|head,protease	HK97 family phage prohead protease	head,protease	Q8LTC1	Lactobacillus_phage	80.6	7.4e-92
WP_152260533.1|1275965_1277168_+|capsid	phage major capsid protein	capsid	U5U3Z5	Lactobacillus_phage	72.4	2.5e-157
WP_152260534.1|1277336_1277717_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	71.9	2.2e-38
WP_152260535.1|1277670_1278030_+|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	71.8	4.0e-42
WP_152260536.1|1278007_1278394_+	hypothetical protein	NA	U5U769	Lactobacillus_phage	47.2	4.5e-23
WP_152260537.1|1278395_1278821_+|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	47.5	4.4e-32
WP_152260538.1|1278845_1279436_+|tail	phage tail protein	tail	E9LUI9	Lactobacillus_phage	54.1	1.3e-53
WP_057820042.1|1279441_1279687_+	Ig domain-containing protein	NA	U5PW26	Acinetobacter_phage	61.0	4.1e-14
WP_152261781.1|1279752_1280181_+	hypothetical protein	NA	U5U747	Lactobacillus_phage	50.5	2.5e-19
WP_152260539.1|1280338_1284871_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	50.3	9.6e-242
WP_152260540.1|1285004_1285532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260541.1|1285528_1287211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260542.1|1287222_1287453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260543.1|1287418_1287625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260544.1|1287572_1289030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260545.1|1289026_1289467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260546.1|1289549_1289999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260547.1|1290011_1290422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260548.1|1290930_1291332_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	41.1	1.2e-18
WP_152260549.1|1291328_1291580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260550.1|1291579_1291864_+|holin	holin	holin	Q9MCC7	Lactobacillus_phage	71.3	1.4e-29
WP_152260551.1|1291856_1292837_+	hypothetical protein	NA	A0A1W6JN27	Lactococcus_phage	71.3	1.4e-73
WP_152260552.1|1292906_1293095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027828982.1|1293612_1293897_-	hypothetical protein	NA	NA	NA	NA	NA
1293255:1293383	attR	CTCGCTCTCCGTAATTGACTCGAACTGAGTTTACTTGAACCCCTGAAATGCCTTTATACCGGCGTTTTGGGGGTTTTGTTTTTGTCTGGATTTGATCGAATTTACGATGACTGTGCACAAATCTTGCAC	NA	NA	NA	NA
WP_152260553.1|1294211_1294484_+	Na+-transporting malonate decarboxylase, carboxybiotin decarboxylase subunit, madB	NA	NA	NA	NA	NA
WP_152260554.1|1294717_1297933_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_152260555.1|1297925_1299020_-	carbamoyl phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	25.9	7.5e-07
WP_152260556.1|1299024_1300317_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_152260557.1|1300319_1301264_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	33.3	1.2e-29
WP_063516207.1|1301643_1302549_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	E3SM63	Prochlorococcus_phage	32.1	3.5e-10
WP_152260558.1|1302927_1303161_+	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_152261782.1|1303150_1304623_+	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_152260559.1|1304619_1305315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260560.1|1305484_1306678_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.4	3.0e-142
WP_152260561.1|1307020_1308544_+	MFS transporter	NA	NA	NA	NA	NA
WP_051225365.1|1308494_1309163_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_152260562.1|1309267_1310308_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	38.7	3.5e-14
WP_027828970.1|1310612_1313024_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	64.2	0.0e+00
WP_152261784.1|1313148_1314804_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_152261783.1|1314803_1315520_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_121499963.1|1315597_1315936_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_152260563.1|1315944_1316133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063516195.1|1316398_1317211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260564.1|1317278_1318127_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_152260565.1|1318549_1319446_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	8.5e-25
WP_152260566.1|1319442_1320720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027828961.1|1320749_1321145_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152261785.1|1321131_1322004_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	6.1e-12
WP_152260567.1|1321996_1322671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260568.1|1322695_1323370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260569.1|1323444_1324422_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_152260570.1|1324596_1325319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994012.1|1325540_1326251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260571.1|1326511_1326751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260572.1|1326747_1327062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260573.1|1327067_1327271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260179.1|1329451_1330666_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	48.3	1.3e-105
>prophage 7
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	1352369	1404331	3592195	tRNA,integrase,tail,portal,protease,capsid,terminase,transposase	Lactobacillus_phage(56.25%)	61	1346493:1346507	1402385:1402399
1346493:1346507	attL	GCCTTTGGCATTGGC	NA	NA	NA	NA
WP_027829244.1|1352369_1353017_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027829243.1|1353001_1353334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035441009.1|1353479_1353803_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_152260586.1|1353846_1354479_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_152260587.1|1354588_1356826_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	48.6	3.7e-85
WP_152260588.1|1356822_1358142_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_063516346.1|1360926_1361769_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	35.7	3.9e-32
WP_027829236.1|1361771_1362395_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_027829235.1|1362397_1362910_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_152260589.1|1362906_1364292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260590.1|1364288_1365227_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.6	6.0e-21
WP_152260591.1|1365357_1366416_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_027829232.1|1366767_1368759_+|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SKZ9	Klosneuvirus	34.6	1.2e-68
WP_027829231.1|1368925_1369459_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	4.4e-13
WP_027829230.1|1369527_1369728_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_027829229.1|1369773_1370130_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152260592.1|1370212_1371166_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_152260593.1|1371730_1372897_-|integrase	tyrosine-type recombinase/integrase	integrase	B4XYR4	Lactobacillus_phage	54.1	1.5e-117
WP_152260594.1|1373008_1373683_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	42.1	4.0e-27
WP_152261786.1|1373784_1374522_-	helix-turn-helix domain-containing protein	NA	Q6R857	Staphylococcus_virus	46.6	2.8e-50
WP_152261787.1|1374736_1374985_+	DUF739 family protein	NA	Q6R856	Staphylococcus_virus	62.7	5.6e-19
WP_152260595.1|1374997_1375771_+	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	81.7	1.2e-115
WP_152260596.1|1375782_1376133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260597.1|1376225_1376708_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_152260598.1|1376826_1377057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260599.1|1377056_1377650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260600.1|1377646_1378339_+	hypothetical protein	NA	C9E2M9	Enterococcus_phage	42.1	6.3e-20
WP_152261788.1|1378322_1379018_+	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	43.6	5.9e-50
WP_152260601.1|1379010_1379865_+	hypothetical protein	NA	Q6V7R6	Burkholderia_virus	37.2	7.8e-28
WP_152260602.1|1379851_1381132_+	DNA helicase	NA	A8YQM1	Lactobacillus_phage	40.8	5.6e-70
WP_152260603.1|1381128_1381539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260604.1|1381525_1382044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260605.1|1382040_1382466_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	54.3	9.5e-35
WP_152260606.1|1382462_1382909_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	54.0	2.4e-36
WP_152260607.1|1383083_1383455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260608.1|1383691_1383997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260609.1|1384172_1384577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260610.1|1384728_1384974_+	hypothetical protein	NA	A0A2K9VC25	Lactobacillus_phage	58.1	3.6e-18
WP_152260611.1|1384970_1385336_+	hypothetical protein	NA	A0A1B1SDX7	Weissella_phage	48.0	7.9e-22
WP_152260612.1|1385328_1385637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260613.1|1385572_1386076_+	hypothetical protein	NA	O64272	Lactococcus_phage	31.1	1.9e-05
WP_152261789.1|1387315_1388242_+	hypothetical protein	NA	A0A2P0ZL36	Lactobacillus_phage	57.5	5.7e-101
WP_152260614.1|1388234_1388426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260615.1|1388430_1388763_+	ribonucleoside-diphosphate reductase	NA	B4XYU2	Lactobacillus_phage	36.9	5.5e-14
WP_152260616.1|1388755_1389259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260617.1|1389251_1389431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260618.1|1389718_1390219_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	47.6	1.0e-32
WP_152261790.1|1390430_1390814_+|terminase	phage terminase small subunit P27 family	terminase	Q9AZT2	Lactococcus_phage	47.2	2.4e-29
WP_152261791.1|1390809_1392711_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	67.0	9.6e-252
WP_152260619.1|1392697_1392919_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_152260620.1|1392921_1394130_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	48.6	1.8e-94
WP_152260621.1|1394110_1394839_+|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	41.9	1.3e-39
WP_152260622.1|1394825_1396079_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	49.3	5.2e-97
WP_152260623.1|1396152_1396548_+	DNA packaging protein	NA	Q9T1F5	Lactobacillus_phage	44.3	1.4e-16
WP_152260624.1|1396635_1396851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260625.1|1396843_1397317_+|tail	phage tail protein	tail	Q9T1F3	Lactobacillus_phage	61.0	6.4e-48
WP_152260626.1|1397313_1397697_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_152260627.1|1397697_1398318_+|tail	phage tail protein	tail	Q9T1F1	Lactobacillus_phage	36.4	1.3e-27
WP_152260628.1|1399285_1399687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260629.1|1399691_1399904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260630.1|1399903_1404331_+	tape measure protein	NA	B8R657	Lactobacillus_phage	43.2	2.6e-119
1402385:1402399	attR	GCCAATGCCAAAGGC	NA	NA	NA	NA
>prophage 8
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	1792389	1851401	3592195	tRNA,transposase	Paenibacillus_phage(21.43%)	57	NA	NA
WP_152260806.1|1792389_1794462_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_146995113.1|1794463_1795375_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_027828035.1|1795660_1795945_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_152260807.1|1795934_1796759_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027828037.1|1796762_1797677_-	GTPase Era	NA	NA	NA	NA	NA
WP_027828038.1|1797666_1798074_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_027828039.1|1798086_1798479_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_152260808.1|1798462_1798939_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_027828041.1|1798935_1799937_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.8	3.0e-47
WP_152260809.1|1800237_1801194_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	40.5	4.0e-49
WP_027828043.1|1801483_1801927_-	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_022528361.1|1801944_1802121_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_027828044.1|1802347_1803187_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_152261803.1|1803237_1804110_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.7	1.4e-19
WP_027828046.1|1804163_1805042_-	YitT family protein	NA	NA	NA	NA	NA
WP_051225187.1|1805148_1805673_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_152260810.1|1805678_1806119_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_152260811.1|1806195_1807965_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.7	5.6e-12
WP_027828050.1|1807966_1809262_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035439983.1|1809660_1810992_+	SH3 domain-containing protein	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	37.8	1.9e-20
WP_081674688.1|1811329_1812001_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027828052.1|1812000_1812453_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_027828053.1|1812473_1814711_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.3	2.5e-09
WP_150391817.1|1814866_1815208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146993802.1|1815288_1816263_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_063515464.1|1816259_1816643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146993801.1|1816882_1817323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146993800.1|1817852_1818041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035439997.1|1818147_1818630_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_081674695.1|1818717_1819026_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_063515462.1|1819119_1819350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260812.1|1819581_1820649_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_027828060.1|1820674_1821526_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063515460.1|1821665_1822067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027828062.1|1822141_1822321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260591.1|1823034_1824093_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_152260061.1|1824183_1825080_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.6	3.6e-31
WP_056990078.1|1825113_1825419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260813.1|1826019_1826139_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_152261804.1|1826137_1826173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260814.1|1826412_1828215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260815.1|1828250_1829198_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_152260816.1|1829115_1830114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260817.1|1830280_1830601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260818.1|1830609_1833615_-	DEAD/DEAH box helicase	NA	M1PGQ0	Moumouvirus	30.0	1.3e-29
WP_152260819.1|1833595_1834906_-	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	29.0	1.4e-20
WP_152260820.1|1835220_1836732_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_146995692.1|1836955_1837150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260821.1|1837124_1837394_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_152260822.1|1837583_1839140_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.0	3.1e-38
WP_152260823.1|1840307_1840814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260824.1|1841123_1841915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260825.1|1841927_1845059_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.0	1.6e-65
WP_152260826.1|1845055_1845589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063516275.1|1848435_1849329_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	23.3	1.1e-08
WP_063516274.1|1849325_1850000_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.1	7.8e-31
WP_152260827.1|1850144_1851401_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	1880056	1977543	3592195	tRNA,integrase,head,tail,portal,protease,holin,capsid,terminase,transposase	Lactobacillus_phage(62.5%)	108	1922546:1922561	1952889:1952904
WP_056989697.1|1880056_1881115_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_152260856.1|1881226_1881568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081674592.1|1882485_1883013_-	hypothetical protein	NA	O64272	Lactococcus_phage	29.1	8.0e-07
WP_152260857.1|1882957_1883242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081674590.1|1883291_1883411_-	DUF3310 domain-containing protein	NA	NA	NA	NA	NA
WP_152260858.1|1883464_1883992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260859.1|1883991_1884501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260860.1|1884502_1884925_-	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	39.5	4.4e-16
WP_152260861.1|1885097_1885415_-	VRR-NUC domain-containing protein	NA	A0A0M7RDN7	Lactobacillus_phage	65.7	8.1e-31
WP_152261805.1|1885734_1887042_-	helicase	NA	A0A1B0Y896	Lactobacillus_phage	72.5	1.3e-170
WP_152260862.1|1887013_1887850_-	DNA primase	NA	A0A1B0Y4T1	Lactobacillus_phage	57.6	3.3e-79
WP_152260863.1|1888511_1889231_-	AAA family ATPase	NA	A0A1B0YEB5	Lactobacillus_phage	67.3	2.5e-83
WP_152260864.1|1890664_1891147_-	hypothetical protein	NA	A0A1B0Y2S7	Lactobacillus_phage	41.1	5.0e-24
WP_152260865.1|1891171_1891396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260866.1|1891538_1891757_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_152260867.1|1892096_1892282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260868.1|1892282_1892507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027828925.1|1893536_1893752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260869.1|1894017_1894341_+	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	39.8	5.2e-17
WP_152260870.1|1894350_1894773_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.7	4.9e-15
WP_152260871.1|1894775_1895168_+	hypothetical protein	NA	A0A0A7RWA3	Clostridium_phage	34.3	4.3e-05
WP_152260872.1|1895933_1896911_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_152260873.1|1896981_1897272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260874.1|1897516_1900411_-	DUF3427 domain-containing protein	NA	A0A097BY72	Enterococcus_phage	27.8	5.0e-26
WP_152260875.1|1900407_1900809_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_152260876.1|1901257_1902562_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_152260877.1|1902698_1903346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260878.1|1904817_1906320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260879.1|1906306_1907173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260880.1|1907272_1908289_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	2.4e-36
WP_152261806.1|1908719_1908968_+	Rep protein	NA	A0A1B0Y3N1	Lactobacillus_phage	45.2	6.2e-10
WP_152260881.1|1908977_1909403_+	hypothetical protein	NA	A0A0P0IJN5	Lactobacillus_phage	42.3	5.2e-25
WP_152260882.1|1909531_1909894_+	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	85.8	8.6e-53
WP_152260883.1|1910049_1910811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260884.1|1911054_1912191_+|integrase	tyrosine-type recombinase/integrase	integrase	B4XYR4	Lactobacillus_phage	56.3	2.6e-119
WP_152260885.1|1912469_1913438_-	hypothetical protein	NA	Q9AF60	Streptococcus_phage	51.6	2.2e-39
WP_152260886.1|1913343_1913736_-|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	74.4	8.8e-27
WP_152260887.1|1913725_1914022_-	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	53.8	1.0e-19
WP_152260888.1|1914036_1914174_-	XkdX family protein	NA	NA	NA	NA	NA
WP_152260889.1|1914186_1914609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260890.1|1914629_1915601_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_152260891.1|1915600_1917007_-	DUF2479 domain-containing protein	NA	B8R660	Lactobacillus_phage	43.6	5.1e-24
WP_152260892.1|1917175_1920106_-	hypothetical protein	NA	Q9T1E4	Lactobacillus_phage	30.0	1.1e-60
WP_152260893.1|1920087_1920834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260894.1|1920830_1924778_-	tape measure protein	NA	Q6J1X5	Lactobacillus_phage	54.7	3.3e-206
1922546:1922561	attL	TGATTGCTTTCCAAGC	NA	NA	NA	NA
WP_152260895.1|1924784_1925054_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	69.0	1.8e-23
WP_152260896.1|1924992_1925349_-|tail	phage tail protein	tail	Q6J1X6	Lactobacillus_phage	78.4	1.6e-43
WP_152260897.1|1925506_1926160_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	88.1	3.0e-96
WP_152260898.1|1926172_1926544_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	83.7	3.6e-54
WP_152260899.1|1926540_1926960_-	HK97 gp10 family phage protein	NA	A8YQJ5	Lactobacillus_phage	87.8	3.3e-64
WP_152261807.1|1926962_1927307_-|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	93.0	3.3e-54
WP_152260900.1|1927296_1927641_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	91.2	4.1e-52
WP_152260901.1|1927713_1928901_-|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	86.2	5.2e-179
WP_152260902.1|1928900_1929587_-|protease	Clp protease ClpP	protease	A8YQJ1	Lactobacillus_phage	83.8	8.6e-102
WP_152260903.1|1929583_1930735_-|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	96.1	6.7e-208
WP_152260904.1|1930914_1932804_-|terminase	terminase large subunit	terminase	Q6J1Y6	Lactobacillus_phage	96.0	0.0e+00
WP_152260905.1|1932790_1933258_-|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	96.8	3.9e-82
WP_152260906.1|1933397_1933892_-	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	93.3	4.9e-91
WP_152260907.1|1933895_1934219_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	48.6	1.2e-18
WP_152260908.1|1934223_1934415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261808.1|1934407_1935334_-	hypothetical protein	NA	A0A2P0ZL36	Lactobacillus_phage	57.5	4.4e-101
WP_152260613.1|1936073_1936577_-	hypothetical protein	NA	O64272	Lactococcus_phage	31.1	1.9e-05
WP_152260612.1|1936512_1936821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260611.1|1936813_1937179_-	hypothetical protein	NA	A0A1B1SDX7	Weissella_phage	48.0	7.9e-22
WP_152260909.1|1937196_1937448_-	hypothetical protein	NA	Q6J1U6	Lactobacillus_phage	91.6	2.4e-38
WP_152260910.1|1937500_1937710_-	hypothetical protein	NA	A8YQM9	Lactobacillus_phage	91.3	3.8e-29
WP_152260911.1|1937706_1937988_-	hypothetical protein	NA	A0A0A1EL18	Lactobacillus_phage	48.3	5.5e-15
WP_152260609.1|1938139_1938544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260608.1|1938719_1939025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260912.1|1939042_1939618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260913.1|1939610_1940051_-	dUTP diphosphatase	NA	A0A1B1IMW3	Lactococcus_phage	57.6	1.9e-33
WP_152261809.1|1940380_1940665_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	72.5	1.8e-34
WP_152260914.1|1940700_1940988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260915.1|1941251_1943555_-	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	70.9	0.0e+00
WP_152260916.1|1943566_1944118_-	DUF669 domain-containing protein	NA	A0A0P0IQI1	Lactobacillus_phage	58.2	4.8e-55
WP_152260917.1|1944131_1945505_-	AAA family ATPase	NA	Q9T0Y3	Lactobacillus_phage	62.8	9.0e-159
WP_152261810.1|1945413_1946187_-	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	67.1	6.7e-87
WP_152260918.1|1946204_1946696_-	hypothetical protein	NA	B4XYS3	Lactobacillus_phage	37.0	1.4e-18
WP_152260919.1|1947073_1947439_-	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	44.3	3.0e-13
WP_152260920.1|1947664_1948042_+	DUF2513 domain-containing protein	NA	A0A1P8L6H1	Staphylococcus_phage	31.5	1.0e-08
WP_152261811.1|1948191_1948704_-	hypothetical protein	NA	A0A0P0IDD0	Lactobacillus_phage	61.1	3.1e-48
WP_152260921.1|1948971_1949160_-	helix-turn-helix domain-containing protein	NA	A0A2H4JBA4	uncultured_Caudovirales_phage	45.9	1.4e-06
WP_152260922.1|1949288_1949936_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	51.5	1.4e-56
WP_152260923.1|1950038_1950650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260924.1|1950835_1951963_+|integrase	tyrosine-type recombinase/integrase	integrase	B4XYR4	Lactobacillus_phage	61.1	3.4e-132
WP_027827743.1|1952218_1952737_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	37.8	2.9e-25
WP_152260925.1|1952755_1955086_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.2	3.5e-70
1952889:1952904	attR	GCTTGGAAAGCAATCA	NA	NA	NA	NA
WP_152260926.1|1955140_1955809_-	sortase	NA	NA	NA	NA	NA
WP_152260927.1|1956072_1957239_+	galactokinase	NA	NA	NA	NA	NA
WP_063515456.1|1957297_1958293_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.6	3.1e-52
WP_152260928.1|1958323_1959820_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_152260929.1|1959835_1960828_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	8.0e-08
WP_152260930.1|1960964_1961465_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_152260931.1|1961563_1962223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027827734.1|1962313_1963045_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	34.1	2.9e-31
WP_152260932.1|1963107_1963326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027827732.1|1963342_1965181_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.2e-22
WP_152260933.1|1965328_1966642_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_063515450.1|1966757_1967408_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_152261812.1|1967412_1968750_-	MFS transporter	NA	NA	NA	NA	NA
WP_146993789.1|1968808_1969249_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146993788.1|1969435_1970602_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.3	2.8e-20
WP_063515446.1|1970724_1972602_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	50.4	3.7e-139
WP_150393237.1|1972661_1973261_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_146993785.1|1973342_1974407_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_152260934.1|1974527_1975673_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_152260935.1|1975672_1976623_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_152261813.1|1976625_1977543_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	1993525	2033368	3592195	protease,tRNA,transposase	Flavobacterium_phage(12.5%)	42	NA	NA
WP_027827710.1|1993525_1995250_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_152260940.1|1995287_1996565_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_027827708.1|1996578_1997394_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_152260941.1|1997410_1998145_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.5	2.5e-22
WP_152260942.1|1998212_1998773_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027827705.1|1998775_1999525_-	UMP kinase	NA	NA	NA	NA	NA
WP_027827704.1|1999654_2000530_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_150391840.1|2000626_2001463_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_152260943.1|2001608_2001884_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_152260944.1|2001864_2002608_-	methyltransferase	NA	NA	NA	NA	NA
WP_146993772.1|2002712_2003366_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_063515426.1|2003636_2004386_-	amino acid ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.2	7.6e-19
WP_152260945.1|2004385_2005843_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152260946.1|2005991_2007797_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	25.3	1.5e-20
WP_152260947.1|2007796_2009548_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.2	4.8e-48
WP_027827694.1|2009980_2010232_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_152259999.1|2010586_2011819_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.1	1.4e-78
WP_027827693.1|2012101_2012719_+	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	33.9	3.8e-08
WP_027827692.1|2012766_2012958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027827691.1|2013050_2013401_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_152260948.1|2013476_2013761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260949.1|2013885_2014329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150391849.1|2014449_2014992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260950.1|2015017_2015404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260951.1|2015545_2015740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260952.1|2015745_2016168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260953.1|2016278_2017025_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_150391854.1|2017026_2017545_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_152260954.1|2017711_2019004_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	45.7	1.0e-95
WP_027827684.1|2019154_2019403_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_027827683.1|2019408_2019684_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_146995670.1|2019790_2021302_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_152260955.1|2021425_2022868_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_063515417.1|2022888_2023251_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_152260956.1|2023247_2024531_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_152260957.1|2024548_2028085_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_027827678.1|2028102_2028816_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	30.8	2.0e-21
WP_150391859.1|2028945_2030598_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_152260958.1|2030653_2031031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027827606.1|2031184_2031379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146995656.1|2031353_2031713_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_152260959.1|2031811_2033368_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2042734	2102185	3592195	protease,tRNA,transposase	uncultured_virus(13.33%)	59	NA	NA
WP_152260963.1|2042734_2044291_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.0	5.2e-38
WP_152260096.1|2044592_2046203_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	31.9	4.9e-15
WP_152261817.1|2046298_2046613_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_027829610.1|2046625_2046823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260964.1|2047009_2048785_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152260965.1|2049888_2050848_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152260966.1|2050814_2051813_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.7	5.4e-20
WP_152260967.1|2051818_2052865_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.2	6.2e-19
WP_027828675.1|2053041_2053284_-	acyl carrier protein	NA	K4FB26	Cronobacter_phage	59.0	5.3e-06
WP_152260968.1|2053283_2054324_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_152260969.1|2054344_2056384_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_152260970.1|2056463_2058134_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_152260971.1|2058162_2058534_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_152260972.1|2058722_2058911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260973.1|2059045_2059231_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_152260974.1|2059314_2059971_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_152260975.1|2059967_2060624_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_152260976.1|2060649_2061561_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_152260977.1|2061550_2063584_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	S4VR00	Pandoravirus	30.2	1.4e-22
WP_027828664.1|2063570_2064323_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_152261818.1|2064341_2065616_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_152260978.1|2065655_2066624_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.4	1.3e-10
WP_152260979.1|2066657_2069063_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_146994394.1|2070377_2070629_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_146994395.1|2070628_2071246_-	guanylate kinase	NA	S4W1R9	Pandoravirus	42.9	2.2e-11
WP_027828657.1|2072863_2073100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146994397.1|2073223_2073556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994398.1|2073702_2075424_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_146994399.1|2075494_2075965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146994400.1|2075951_2076797_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_152260980.1|2076801_2077725_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027828653.1|2077690_2077969_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_146994402.1|2077949_2079320_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	36.4	7.6e-33
WP_027828651.1|2079312_2080167_-	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.9	6.6e-35
WP_152260981.1|2080265_2080811_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_152260982.1|2080689_2081160_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_027828648.1|2081196_2081760_-	elongation factor P	NA	NA	NA	NA	NA
WP_027828647.1|2082096_2082390_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_027828646.1|2082415_2082778_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_152260983.1|2082809_2083118_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_150391876.1|2083257_2083527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027828643.1|2083610_2083880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260984.1|2083962_2084754_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_152260985.1|2084877_2086110_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.1	6.3e-79
WP_152260986.1|2086699_2089120_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_152260987.1|2089173_2089953_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_027829569.1|2090032_2090992_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_051225473.1|2090988_2092137_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_152260988.1|2092126_2093677_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.6	1.1e-24
WP_121499972.1|2093767_2094808_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	41.4	8.8e-66
WP_152260989.1|2095051_2096392_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027828449.1|2096415_2096760_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027828450.1|2096886_2097783_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_152260990.1|2097775_2098447_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027828452.1|2098595_2098778_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_146995692.1|2098919_2099114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057824131.1|2099088_2099448_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_152260963.1|2099548_2101105_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.0	5.2e-38
WP_152260991.1|2101168_2102185_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	2.3e-34
>prophage 12
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2237456	2246469	3592195	portal,transposase,integrase	Phaeocystis_globosa_virus(33.33%)	8	2226736:2226748	2248172:2248184
2226736:2226748	attL	TTTCCCACTCATT	NA	NA	NA	NA
WP_152261041.1|2237456_2238776_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.6	4.6e-51
WP_152261042.1|2238891_2240235_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.2	7.1e-76
WP_146994117.1|2240367_2242428_+|portal	portal protein	portal	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.2	3.3e-64
WP_056990076.1|2242530_2243286_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	39.5	9.3e-33
WP_121499979.1|2243261_2244158_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.6	3.6e-31
WP_152261043.1|2244191_2244497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146994434.1|2244666_2244852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261044.1|2245023_2246469_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.0	1.8e-08
2248172:2248184	attR	AATGAGTGGGAAA	NA	NA	NA	NA
>prophage 13
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2289973	2355469	3592195	tRNA,tail,holin,transposase	Only_Syngen_Nebraska_virus(15.38%)	54	NA	NA
WP_152261059.1|2289973_2291266_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	45.5	7.0e-97
WP_146994589.1|2291349_2292273_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_152261060.1|2292269_2293280_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_146994593.1|2293599_2294034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261061.1|2294051_2296736_-	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.1	2.3e-70
WP_152261062.1|2296940_2297765_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.4	1.8e-69
WP_152261823.1|2297771_2299247_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.1	2.1e-97
WP_051225392.1|2299261_2299687_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.8	1.4e-17
WP_027829102.1|2299779_2299998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027829101.1|2300123_2300828_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152261063.1|2300845_2301994_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_152261064.1|2302083_2302884_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.7	1.7e-24
WP_051225396.1|2302903_2303962_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_152261065.1|2304959_2305421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056990078.1|2305682_2305988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261066.1|2308030_2308864_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_027829095.1|2308885_2309545_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_063516259.1|2309560_2310208_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_152261824.1|2310204_2312991_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.2	2.2e-79
WP_146995618.1|2319124_2320423_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.9	6.2e-101
WP_063515526.1|2321022_2321301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146995617.1|2321219_2322386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261067.1|2322905_2323829_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_152261068.1|2323868_2325425_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_146995656.1|2325523_2325883_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_027827606.1|2325857_2326052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261069.1|2326121_2326775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146995374.1|2328080_2328632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146995375.1|2328720_2329308_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152261070.1|2329349_2330066_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_152261071.1|2330023_2331613_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_146995378.1|2331678_2333565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261072.1|2333561_2335517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261073.1|2335589_2336396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261074.1|2336392_2337346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261075.1|2337368_2337572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146995382.1|2337662_2338457_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	46.9	4.1e-31
WP_152261076.1|2338942_2339854_-	hypothetical protein	NA	A0A249Y0X5	Enterococcus_phage	44.9	6.6e-25
WP_152261077.1|2339866_2340412_-|holin	phage holin	holin	NA	NA	NA	NA
WP_152261078.1|2340389_2340719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261079.1|2340708_2340999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261080.1|2341013_2341469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261081.1|2341465_2341891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261082.1|2341905_2342337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261083.1|2342336_2343548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261084.1|2343621_2343783_-	XkdX family protein	NA	NA	NA	NA	NA
WP_152261085.1|2343785_2344148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261086.1|2344159_2345320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261087.1|2345331_2346225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261088.1|2346224_2346674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261089.1|2346759_2347260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261090.1|2347243_2348929_-	hypothetical protein	NA	A0A0B5CYL4	Listeria_phage	34.1	5.3e-28
WP_152261091.1|2348942_2349761_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	35.5	2.2e-40
WP_152261092.1|2349757_2355469_-|tail	phage tail tape measure protein	tail	B4XYQ3	Lactobacillus_phage	55.8	1.8e-112
>prophage 14
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2359832	2385932	3592195	integrase,portal,capsid,terminase,transposase	Lactobacillus_phage(21.43%)	36	2352561:2352575	2382126:2382140
2352561:2352575	attL	CGATAACCAGCGTTG	NA	NA	NA	NA
WP_152261825.1|2359832_2360792_-|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.9	1.1e-86
WP_152261101.1|2360835_2361483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261102.1|2361565_2361826_-	nitrogenase subunit molybdenum-iron protein alpha	NA	NA	NA	NA	NA
WP_152261103.1|2361828_2363460_-	hypothetical protein	NA	A0A059T7W2	Listeria_phage	32.5	5.3e-41
WP_152261104.1|2363440_2365039_-|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.7	8.4e-84
WP_152261105.1|2365001_2366345_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.9	1.5e-137
WP_152261106.1|2366325_2367189_-|terminase	terminase	terminase	V5URT8	Oenococcus_phage	40.9	3.7e-33
WP_152261107.1|2367262_2367487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261108.1|2367483_2367690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261109.1|2367726_2368275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261110.1|2368466_2369021_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_152261111.1|2369029_2369257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261112.1|2369263_2369602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261113.1|2369603_2370002_-	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	44.7	9.0e-19
WP_152261114.1|2369994_2370270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261115.1|2370262_2370604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261116.1|2370600_2371587_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	38.3	2.0e-35
WP_152261117.1|2371591_2372302_-	MBL fold metallo-hydrolase	NA	A0A0A0RVF5	Bacillus_phage	40.6	3.5e-50
WP_152261118.1|2372295_2373411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261119.1|2373413_2375351_-	AAA family ATPase	NA	A0A0A0RNI0	Bacillus_phage	32.5	1.1e-80
WP_152261120.1|2375406_2375601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261121.1|2375742_2376087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261122.1|2376067_2376340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261123.1|2376323_2376506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261124.1|2376561_2377065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261826.1|2377042_2377267_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	55.9	3.9e-11
WP_152261125.1|2377353_2377623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261126.1|2377737_2378088_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152261127.1|2378093_2378546_+	toxin	NA	A0A1W6JQ23	Staphylococcus_phage	40.2	2.1e-19
WP_152261827.1|2378622_2379372_+	hypothetical protein	NA	A0A0A1ERB0	Lactobacillus_phage	64.0	3.4e-11
WP_152261128.1|2379486_2380623_+|integrase	tyrosine-type recombinase/integrase	integrase	B4XYR4	Lactobacillus_phage	39.7	6.7e-67
WP_027827820.1|2380890_2381139_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_152261129.1|2381439_2382156_+	DNA-entry nuclease	NA	NA	NA	NA	NA
2382126:2382140	attR	CAACGCTGGTTATCG	NA	NA	NA	NA
WP_146995354.1|2382169_2383036_+	DNA/RNA endonuclease	NA	NA	NA	NA	NA
WP_152261130.1|2383095_2384520_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_152260119.1|2384690_2385932_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	1.1e-43
>prophage 15
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2448707	2510287	3592195	transposase,integrase	unidentified_phage(16.67%)	50	2494542:2494559	2517912:2517929
WP_152261151.1|2448707_2450264_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_056990043.1|2450362_2450722_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_027827606.1|2450696_2450891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261165.1|2451090_2451963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261166.1|2451952_2453401_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152261167.1|2453400_2454219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261168.1|2454136_2455732_-	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
WP_152261169.1|2455652_2457317_-	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_152261170.1|2457286_2458534_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_152261171.1|2458530_2460888_-	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_152261172.1|2460987_2461176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261173.1|2461191_2462067_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_152261174.1|2462127_2463015_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.6	1.5e-53
WP_152261175.1|2463137_2464664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261176.1|2464678_2466250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261177.1|2466249_2468895_-	YfhO family protein	NA	NA	NA	NA	NA
WP_027827771.1|2469009_2469936_-	ribokinase	NA	NA	NA	NA	NA
WP_152261178.1|2469992_2470478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261179.1|2470336_2471011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261831.1|2471195_2471891_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_027827768.1|2475288_2475903_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152261180.1|2476180_2479201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261181.1|2479360_2480677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261182.1|2480741_2481455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261183.1|2481448_2482006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027829176.1|2482099_2482789_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_152261184.1|2482869_2483952_-	serine hydrolase	NA	NA	NA	NA	NA
WP_035440907.1|2483964_2484408_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152261185.1|2484373_2485462_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_150392053.1|2485588_2486221_-	Fic family protein	NA	NA	NA	NA	NA
WP_152261186.1|2486418_2487996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261187.1|2488041_2489406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261188.1|2489487_2490960_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_150392058.1|2490952_2491309_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152261189.1|2491519_2492887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261190.1|2493251_2493965_+	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	47.4	9.1e-22
WP_152261191.1|2494159_2494441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261192.1|2494504_2495989_-	hypothetical protein	NA	A0A288WFW6	Bacillus_phage	39.6	8.2e-25
2494542:2494559	attL	TCGCCGCCCAGGTTGTAA	NA	NA	NA	NA
WP_152261193.1|2496095_2496617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056989697.1|2496859_2497918_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_152261194.1|2498119_2499172_-	hypothetical protein	NA	Q332B8	Clostridium_botulinum_C_phage	35.5	1.8e-13
WP_152261195.1|2499368_2500667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261196.1|2500863_2501931_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	23.6	1.4e-05
WP_152261197.1|2502553_2503348_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.0	4.0e-42
WP_152261198.1|2503334_2504513_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2L1IVA1	Escherichia_phage	26.2	1.2e-10
WP_152261199.1|2504538_2504901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056989697.1|2505130_2506189_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_152261200.1|2506883_2507657_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	49.8	2.3e-58
WP_152261201.1|2507662_2508877_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	48.5	3.2e-107
WP_152261202.1|2509042_2510287_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	23.8	6.9e-09
2517912:2517929	attR	TCGCCGCCCAGGTTGTAA	NA	NA	NA	NA
>prophage 16
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2520936	2584780	3592195	transposase	Bacillus_phage(15.38%)	54	NA	NA
WP_152260120.1|2520936_2521830_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	3.7e-36
WP_152260121.1|2521781_2522318_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152261209.1|2522404_2524237_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_152261210.1|2524472_2525900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261832.1|2525904_2526774_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152261211.1|2526760_2527939_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_152261212.1|2527922_2528921_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	5.9e-27
WP_152261833.1|2528933_2529776_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152261213.1|2530598_2531576_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	39.2	2.9e-50
WP_063516386.1|2531676_2532693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261214.1|2532937_2533300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261215.1|2533292_2534600_-	DNA polymerase	NA	O64031	Bacillus_phage	40.4	1.4e-84
WP_146995514.1|2534589_2535000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261216.1|2535230_2536304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063516390.1|2536386_2536656_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_152261217.1|2536690_2536897_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_152261218.1|2537037_2537304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261219.1|2537340_2537604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261220.1|2537630_2538500_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_152261221.1|2538672_2539881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261834.1|2540144_2541272_+	peptidoglycan endopeptidase	NA	NA	NA	NA	NA
WP_152261222.1|2541457_2542321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261223.1|2542393_2543572_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152261224.1|2543562_2544297_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_152261225.1|2544420_2544966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261835.1|2545178_2546396_+	hypothetical protein	NA	A0A0A8WIF2	Clostridium_phage	45.0	1.0e-20
WP_152261226.1|2546469_2547657_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_027828542.1|2547679_2548057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261227.1|2548217_2549423_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	45.9	1.5e-93
WP_152261228.1|2549604_2550063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261229.1|2550299_2552237_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.1	1.5e-71
WP_056989697.1|2552406_2553465_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_056989697.1|2554826_2555885_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.4	1.8e-37
WP_152261230.1|2556073_2557312_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.3	5.3e-09
WP_152261231.1|2557369_2559973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261232.1|2560138_2561200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261233.1|2561311_2562388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051225289.1|2562484_2563012_-	universal stress protein	NA	NA	NA	NA	NA
WP_152261234.1|2563176_2564439_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_152261235.1|2564615_2565314_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_152261236.1|2565310_2566486_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_146994533.1|2566478_2567678_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_063515968.1|2568299_2569739_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_152261237.1|2569738_2570911_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_063515970.1|2571332_2572886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150392127.1|2573005_2574217_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	51.1	1.7e-105
WP_063515971.1|2574386_2575361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150392128.1|2575777_2577703_-	asparagine synthase (glutamine-hydrolyzing)	NA	E3T4J5	Cafeteria_roenbergensis_virus	26.9	8.2e-25
WP_152261238.1|2577815_2578976_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_150392130.1|2579069_2580218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150392131.1|2580334_2581633_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	51.1	1.5e-110
WP_152261239.1|2581871_2582327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261240.1|2582328_2583345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260002.1|2583409_2584780_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2714745	2723169	3592195		Synechococcus_phage(50.0%)	9	NA	NA
WP_027829721.1|2714745_2715234_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.8	2.4e-18
WP_152261843.1|2715238_2716366_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_152261310.1|2716358_2717075_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.3	6.8e-33
WP_152261311.1|2717078_2717327_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_152261312.1|2717327_2718014_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_152261313.1|2718000_2720211_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.1	1.7e-143
WP_146995257.1|2720195_2721650_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.0	4.9e-54
WP_152261314.1|2721649_2722609_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	42.7	3.2e-54
WP_146995259.1|2722605_2723169_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.5	1.2e-24
>prophage 18
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	2758305	2823075	3592195	transposase	Bacillus_phage(29.41%)	58	NA	NA
WP_152260061.1|2758305_2759202_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.6	3.6e-31
WP_056990076.1|2759177_2759933_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	39.5	9.3e-33
WP_152261327.1|2760125_2760941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260726.1|2760959_2761496_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152260727.1|2761447_2762341_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.8e-36
WP_152261847.1|2762409_2763105_-	peptidase	NA	NA	NA	NA	NA
WP_063516814.1|2763199_2763754_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027827948.1|2763895_2764621_+	hypothetical protein	NA	A0A1G5SA06	Enterococcus_phage	36.7	3.1e-17
WP_152261328.1|2764595_2765339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260727.1|2765364_2766258_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.8e-36
WP_152260726.1|2766209_2766746_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152261329.1|2766829_2767606_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_152261330.1|2767632_2769108_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_150392225.1|2769432_2771172_+	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.5	5.8e-38
WP_150392226.1|2771311_2771821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261848.1|2771908_2772619_-	response regulator	NA	W8CYM9	Bacillus_phage	27.9	1.3e-20
WP_152261331.1|2772620_2775266_-	DUF4118 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.8	4.3e-08
WP_152261332.1|2775339_2775903_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_152261333.1|2775916_2777989_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.6	1.8e-33
WP_152261849.1|2778013_2779783_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_152261334.1|2780108_2780507_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_152261335.1|2780602_2782270_-	Hsp70 family protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	26.5	1.2e-35
WP_152261336.1|2782416_2783118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261337.1|2783084_2783675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261338.1|2783696_2785586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261339.1|2785585_2786272_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_152261340.1|2786249_2787533_-	response regulator	NA	NA	NA	NA	NA
WP_152261341.1|2787510_2788629_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_152261342.1|2788595_2789222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261343.1|2789291_2790989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261344.1|2791006_2791876_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152261345.1|2791893_2792847_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152261346.1|2793200_2794433_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.1	1.4e-78
WP_152261347.1|2794835_2795435_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_152261348.1|2795492_2797112_-	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_152261349.1|2797181_2798027_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_152261350.1|2798099_2798792_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_152261351.1|2798788_2799727_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_152261352.1|2800082_2800997_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_152261353.1|2801083_2802028_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_150392251.1|2802103_2802913_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_152261850.1|2802912_2803710_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_152261851.1|2803717_2804476_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.9	5.5e-09
WP_152261354.1|2804590_2805535_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152261355.1|2805849_2806869_+	sugar kinase	NA	NA	NA	NA	NA
WP_152260286.1|2806945_2807839_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.8e-36
WP_152260121.1|2807790_2808327_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152261356.1|2808406_2809234_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152261357.1|2809340_2810048_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.0	3.3e-16
WP_152261358.1|2810253_2812041_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	24.9	8.2e-11
WP_063516972.1|2812033_2813809_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	4.2e-52
WP_152261359.1|2814007_2814574_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152261360.1|2814827_2815586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063515605.1|2815651_2817082_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_152261361.1|2817372_2817993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150392259.1|2818005_2818887_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_150392260.1|2818950_2820201_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_152261362.1|2821839_2823075_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	46.9	1.3e-87
>prophage 19
NZ_CP045143	Lactobacillus harbinensis strain M1 chromosome, complete genome	3592195	3464067	3567681	3592195	integrase,head,tail,portal,capsid,terminase,transposase	Bacillus_phage(14.71%)	93	3483706:3483765	3566236:3567816
WP_152261666.1|3464067_3465624_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_027829610.1|3465844_3466042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027829609.1|3466016_3466370_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_152260096.1|3466465_3468076_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	31.9	4.9e-15
WP_152261667.1|3468341_3469091_-	tributyrin esterase	NA	NA	NA	NA	NA
WP_150392690.1|3469071_3471498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150392691.1|3471469_3472477_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_051225389.1|3472510_3473344_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_027829090.1|3473356_3474247_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_152261668.1|3474431_3475679_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_152261669.1|3475842_3478974_-	cellobiose phosphorylase	NA	NA	NA	NA	NA
WP_152261670.1|3478991_3481154_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_152261671.1|3481354_3482611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261672.1|3482688_3483636_-	hypothetical protein	NA	NA	NA	NA	NA
3483706:3483765	attL	CTGAAACTTGAAAGCCCGAAAGTGCACTGATGCCTTGGTAATTGTGAGATGGCGGCGGGA	NA	NA	NA	NA
WP_152260028.1|3483780_3485151_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_152261673.1|3485279_3486050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261674.1|3486298_3486769_+	DUF3290 family protein	NA	NA	NA	NA	NA
WP_152261675.1|3486775_3487405_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_035440836.1|3487449_3488136_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.7	1.2e-18
WP_152261676.1|3488753_3490139_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_152261677.1|3490135_3490951_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152261860.1|3490947_3491838_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_027829080.1|3491869_3492994_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	2.5e-18
WP_152261678.1|3493336_3493612_-	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_152261861.1|3493633_3494332_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	45.7	1.7e-12
WP_152261679.1|3494467_3496447_+	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	31.1	5.6e-61
WP_146995015.1|3496846_3498229_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.6	4.2e-23
WP_081674947.1|3498373_3499240_-	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.0	5.3e-32
WP_027829465.1|3499259_3500096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261680.1|3500096_3501545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261681.1|3501498_3503379_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.3	4.2e-34
WP_027829462.1|3503403_3504117_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.9	3.3e-40
WP_152261682.1|3504368_3505670_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_150392702.1|3506154_3506403_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_146994994.1|3506419_3506560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261683.1|3507215_3507521_-|head,tail	phage gp6-like head-tail connector protein	head,tail	C0LZZ4	Enterococcus_phage	38.3	9.9e-10
WP_152261684.1|3507705_3509277_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	26.6	1.4e-43
WP_152261685.1|3509269_3510451_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	33.0	3.8e-57
WP_152261686.1|3510463_3510667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261687.1|3510632_3512324_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.7	2.0e-115
WP_152261688.1|3512320_3512794_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J4D1	uncultured_Caudovirales_phage	34.4	2.1e-19
WP_152261689.1|3512949_3513363_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	41.1	1.2e-18
WP_152261690.1|3513535_3513871_-|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	43.0	1.4e-12
WP_152261691.1|3514138_3515548_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	39.9	1.7e-67
WP_152261692.1|3515537_3516362_-	DNA replication protein	NA	A0A1I9SE87	Arthrobacter_phage	27.1	4.9e-11
WP_152261693.1|3516342_3516624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261694.1|3516687_3516873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261695.1|3516993_3517428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261696.1|3517417_3517639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261697.1|3517685_3517958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261698.1|3518095_3518698_+	helix-turn-helix domain-containing protein	NA	Q20DG0	Lactobacillus_phage	51.5	3.2e-12
WP_152261699.1|3518761_3519922_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.0	3.1e-43
WP_152261700.1|3520334_3525686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063516717.1|3526095_3526494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261862.1|3526500_3527358_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_152261701.1|3527476_3528670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261702.1|3528673_3530497_-	potassium transporter	NA	NA	NA	NA	NA
WP_152261703.1|3530515_3532045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261704.1|3532070_3532784_-	endonuclease III	NA	NA	NA	NA	NA
WP_152261705.1|3533084_3534248_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.5	7.6e-34
WP_152261706.1|3534366_3535323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150392726.1|3535365_3536181_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	4.5e-17
WP_152261707.1|3536352_3537798_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.0	1.8e-08
WP_152261708.1|3537901_3538126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152260039.1|3538225_3539311_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.3	3.1e-37
WP_152261709.1|3539424_3539736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261710.1|3539950_3540214_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_063516727.1|3540336_3540771_+	macro domain-containing protein	NA	G3MAH8	Bacillus_virus	45.8	1.5e-27
WP_152261711.1|3540908_3542813_-	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	26.0	1.2e-65
WP_152261712.1|3542883_3543336_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152261713.1|3543541_3543808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152261714.1|3543810_3544632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150392731.1|3544738_3545557_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	31.3	2.7e-33
WP_152261863.1|3545701_3546064_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_081674952.1|3546590_3547091_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027828954.1|3547346_3547931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261715.1|3548109_3548739_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_152261716.1|3548842_3550096_+	MFS transporter	NA	NA	NA	NA	NA
WP_152261717.1|3550114_3550867_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	45.2	3.4e-43
WP_027828950.1|3550863_3551259_+	HIT family protein	NA	D7NW73	Streptomyces_phage	46.9	1.6e-15
WP_152261718.1|3551322_3552171_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_063516180.1|3552191_3552419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063516179.1|3552534_3553719_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	6.8e-30
WP_152261719.1|3553961_3554351_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	33.8	8.5e-06
WP_152261720.1|3554320_3555436_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.6	1.8e-16
WP_150392736.1|3555454_3556912_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.1	1.1e-24
WP_082231132.1|3556957_3558841_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.5	1.7e-22
WP_152261721.1|3559037_3559886_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_152261722.1|3559971_3560823_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_152261723.1|3562870_3564124_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152261724.1|3564120_3565683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152261725.1|3565679_3566216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152260028.1|3566310_3567681_-|transposase	transposase	transposase	NA	NA	NA	NA
3566236:3567816	attR	CTGAAACTTGAAAGCCCGAAAGTGCACTGATGCCTTGGTAATTGTGAGATGGCGGCGGGAATGATCTTGTTTTTGTCAGATTCCCAATAGGTCGACAAGATTCTTCGGAAGAAAACTGACAAAATGGTCAACGATGTTATTTATTACTTCCTCTGCCGTGCCCACTAAAGTGGCTCCCAGTGTGGATAGTGCCTTCAGAAGCCATGCCAGTGCTTGCGTTACTGCAATGTCTGGCATGACTTCATTCATCTCGTAAAACAGATCGCCAAGTGTGCGTTCATCCTCGTTTAACCGCTGTTGCCACGCCAACAGGTCATACGTCATCATCACGACGGCCAAATGACCGCAAAGACCGTCATAGCTTTGAATCTGGGACTTGTCCAAACGTAGATACTGCTTGGCTACTTTGAAATAGCCTTCAATCTGCCACCGACGACCGTACATCTGGATAATTTCTTCAGGACGCAAATTAGTTTGGGTCGTAGCTAATACCAGATAACTACTGGCATTCTTCCGGTTAGTCACAAATACCAGCTTCAGTGGGTACGCTACTTGCGTCCCATCATCCAAGTTCACATAAGCTGTGACGATGGGGCTGTACTGATAATTGGTGTGCGTTTGCCGGCGTGAAGCGCAGAACCGTTCGTAGAGATCCTTGACGGAGTAAAGTCGGCCACGATAGCGGTAGTAGATCTTCTTCGTGCGCTTGATCATCCCGATACCGGCTAACCCCATTGTTTTCAAGGTATAGAACATCCGCGGTGAACTGAACCAACTGTCGAAAAGTACGTAGTGAGCCGGAATATGATTTGCCAGAGCCTGCGTTAGCAGTTCTACCGAGACGTCATTCATTTTGCCTTGGGCTTGAACACGGCGTTGACCAGCAATTGACCGGCCACTGGTAGTTTTAGCTGGGCTCCCCAGTCGCTGGGCAGCACTCTTAGAGGACATCAGCGCATAATCCACTGGTAACAGGGTGTTACCATCGCTCCAAGCCAAAGTGAGTGCCCGGAATCCGCGTTGATAGACATGATCGTCGTGGTTAAACACACGGGCAAGCAGTTCTGTCTTGGTGGAATAATCCCGTGCAAAAAGGGTATCATCCAGAATAAACGCGAATCGTCGGCGGGCATCAATGTATGGTCGTAGATGTTTAATAATCGCGGCCCCAACCAGACAAGTCAGTCGTTGCCAATTGATACGGCCATCGTTCAGATCATTACGGACCGTCCGAATCGTACAATCCGGATCGGGCATCGCTCGGTAAAGGGAACGGCCCAAAAACTTGGTTTGGATCAGCCATGCCAGCACCTTGGTCAGTGAAATTGATGAGCGTCTTCTAAAATTCGCCTTTTTTGTCAGCTTGCTCAAGCCCACGAGTGACGAAAAACGAAGAATGATGTTCTTAAGTCCCAATTCAGTCCGTGTATGTTCTATAATATTCATGGCGCGGCTCTCCTCTGTATCAGATTTTTGGTCGAATCAAGTATACAACGCAGGAGAGTCTGCGCTTATTTTTTTGCCAAAAAAGCCAGGAACCACGCATGTTTAACGTGATTTCCAGCTTTCAAGTTTCAGTTA	NA	NA	NA	NA
