The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	438042	510633	4629837	transposase	Escherichia_phage(25.0%)	58	NA	NA
WP_000255944.1|438042_439065_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|439064_439844_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211540.1|439882_440218_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002211541.1|440232_441255_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211542.1|441364_441853_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002215917.1|442100_443597_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002215918.1|443651_444353_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002211545.1|444512_445676_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002211546.1|445687_447877_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211547.1|448203_449535_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_002211548.1|449534_449744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|449848_450307_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211550.1|450895_452347_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|452368_452902_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|453185_453371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161992928.1|455666_455828_-	hypothetical protein	NA	A0A140XBD7	Dickeya_phage	88.7	2.3e-21
WP_002212288.1|459038_460076_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|460072_461032_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|461066_462017_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002217850.1|462227_462779_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|462868_463891_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|463890_464670_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|465726_466911_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|467161_467545_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|467546_468092_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|468282_468711_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|468714_469419_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|469783_470281_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|470347_470716_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|471058_475087_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|475215_479436_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|479562_480021_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210678.1|480452_481583_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002228257.1|481575_482391_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|482392_482608_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|482604_483402_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|483391_484066_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|484052_486098_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|486473_486983_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|487079_487862_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|487954_488740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|488858_489926_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|489955_490696_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|490741_491332_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|491520_491796_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|491845_492499_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|492646_493933_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|493992_495582_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002218887.1|496049_496235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161992928.1|498530_498692_-	hypothetical protein	NA	A0A140XBD7	Dickeya_phage	88.7	2.3e-21
WP_002220999.1|501941_503150_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002217538.1|503207_503738_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_002213171.1|503737_504325_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002213170.1|504478_504748_+	YihD family protein	NA	NA	NA	NA	NA
WP_002213169.1|504838_505825_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002213168.1|505852_506476_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_002213164.1|506967_509766_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.8	2.7e-69
WP_002213759.1|510174_510633_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	627733	690092	4629837	plate,tRNA,transposase	Bodo_saltans_virus(16.67%)	46	NA	NA
WP_002210509.1|627733_630550_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|630549_631059_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_002228112.1|631126_631585_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|631565_632519_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002213775.1|632900_633359_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|633505_635068_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|635070_636162_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|636163_637594_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|637608_638211_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|638451_639633_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|640296_641958_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|642897_643890_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|643865_645473_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|645459_646170_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|646238_647006_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|647201_649571_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|650031_652938_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|653193_653547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|657071_658682_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|658678_660034_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|660153_660645_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|660637_661003_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|661008_661626_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|661618_662722_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|662747_664967_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|664979_667328_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|667431_670020_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|670037_671021_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|671013_672858_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|672890_673334_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|673407_673926_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210480.1|674088_675591_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210481.1|675599_676160_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210482.1|676170_677184_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002214747.1|677513_678257_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210485.1|679479_680100_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002210486.1|680397_681231_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002228111.1|681415_683758_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210488.1|683825_685130_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002210489.1|685113_686109_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210490.1|686101_686920_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210491.1|686933_687311_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210492.1|687327_688197_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210493.1|688286_688751_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_071525509.1|688877_689192_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|689633_690092_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	1222713	1267349	4629837	tRNA,transposase,holin	uncultured_Mediterranean_phage(23.08%)	38	NA	NA
WP_002213775.1|1222713_1223172_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208705.1|1223357_1224962_-	chitin-binding domain protein	NA	Q9J8B0	Spodoptera_exigua_multiple_nucleopolyhedrovirus	31.0	2.3e-20
WP_002216043.1|1225158_1225464_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	46.2	2.0e-10
WP_002208704.1|1225890_1226349_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002208703.1|1226475_1227723_+	esterase FrsA	NA	NA	NA	NA	NA
WP_002208702.1|1227782_1228184_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_002208701.1|1228360_1229464_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.6	1.5e-60
WP_002208700.1|1229473_1230733_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.4	1.0e-92
WP_002213775.1|1230995_1231454_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002264519.1|1231779_1232529_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_002208698.1|1232726_1232981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156357.1|1233106_1233748_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002208694.1|1234477_1235035_+	methyltransferase	NA	NA	NA	NA	NA
WP_002208693.1|1235281_1235806_+	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_002208692.1|1236295_1236583_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_042468846.1|1236818_1237730_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	65.9	7.4e-101
WP_000255944.1|1237792_1238815_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1238814_1239594_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002208690.1|1240022_1240937_+	fructokinase	NA	NA	NA	NA	NA
WP_002223265.1|1241538_1245228_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	26.1	2.2e-10
WP_002208687.1|1245224_1246469_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_002208685.1|1246736_1247426_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.1	1.7e-36
WP_002208684.1|1247450_1248767_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	7.1e-28
WP_002215524.1|1248788_1249853_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208680.1|1250326_1251646_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002223269.1|1251721_1253113_+	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_002213775.1|1253330_1253789_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208678.1|1254384_1256214_+	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_002222306.1|1256210_1256393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208677.1|1256368_1257049_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208675.1|1259410_1260013_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_002216927.1|1260311_1260893_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208673.1|1261095_1262166_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002208672.1|1262258_1263383_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
WP_002208671.1|1263494_1263830_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.6	6.4e-10
WP_002223272.1|1263857_1265705_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002208669.1|1265715_1266684_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.7	1.9e-46
WP_002213759.1|1266890_1267349_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	1367590	1422345	4629837	integrase,tRNA,transposase,protease	uncultured_virus(20.0%)	54	1362928:1362946	1438956:1438974
1362928:1362946	attL	TAAAGGCGATAACTTTACC	NA	NA	NA	NA
WP_002208581.1|1367590_1368070_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|1368333_1369143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223301.1|1369663_1372549_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-111
WP_002208578.1|1372755_1373175_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|1373283_1373733_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|1373735_1374650_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|1374844_1375714_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|1375790_1376567_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208573.1|1376953_1377589_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208572.1|1377559_1378246_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208571.1|1378242_1380672_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|1380715_1381780_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|1381776_1382301_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|1382596_1383319_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|1383329_1383824_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002222677.1|1384034_1385420_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213775.1|1385766_1386225_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209775.1|1386371_1386584_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|1386598_1387465_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002215270.1|1387819_1388002_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|1388260_1388461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|1388574_1389072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|1389207_1389546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|1389628_1389907_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002354559.1|1390118_1390325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209770.1|1390724_1391327_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002209769.1|1391319_1392249_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|1392258_1392891_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209767.1|1392887_1394651_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209766.1|1394643_1395963_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209765.1|1395944_1396346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215253.1|1396442_1396748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|1397114_1397894_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1397893_1398916_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209764.1|1399009_1399903_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209763.1|1399957_1400947_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209762.1|1400972_1401824_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209759.1|1402296_1403925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209758.1|1404003_1406385_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002209757.1|1406543_1407074_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209756.1|1407066_1409274_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|1409725_1410934_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209753.1|1411335_1411917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224869.1|1412205_1412328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|1412451_1414368_-	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002209751.1|1415176_1415416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227852.1|1415454_1415706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209749.1|1415729_1416302_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002209748.1|1416313_1416715_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209746.1|1416947_1417349_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002216002.1|1417616_1418198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209745.1|1418870_1419116_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_138921619.1|1419328_1421641_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002213775.1|1421886_1422345_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
1438956:1438974	attR	TAAAGGCGATAACTTTACC	NA	NA	NA	NA
>prophage 5
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	1704423	1749782	4629837	transposase,coat,plate,tail,protease	Pseudomonas_phage(25.0%)	39	NA	NA
WP_002210815.1|1704423_1704933_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|1704967_1705225_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|1705228_1706359_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|1706521_1708810_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|1709303_1710032_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|1710293_1712969_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_080071931.1|1713156_1716030_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|1716097_1716751_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|1716753_1717326_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002216093.1|1717493_1719446_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|1719469_1720624_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|1721726_1722842_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213759.1|1723043_1723502_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228026.1|1724291_1725458_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|1725732_1727259_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|1727635_1728664_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|1728737_1730525_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1730946_1731882_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|1732053_1732296_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|1732501_1733224_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1733497_1733977_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1734187_1735492_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|1736200_1737013_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1736988_1737783_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1738413_1738704_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1738749_1739367_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1739371_1739566_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1739562_1741071_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1741092_1741461_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|1741462_1741762_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1741882_1743376_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|1743642_1745049_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1745045_1746101_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|1746116_1746713_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|1746709_1747165_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1747168_1748305_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1748301_1748562_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1748558_1748906_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|1749002_1749782_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
>prophage 6
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	1872642	2034842	4629837	plate,protease,tRNA,transposase	Escherichia_phage(15.62%)	120	NA	NA
WP_002211349.1|1872642_1872963_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|1872988_1875265_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|1875557_1876016_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211347.1|1876387_1876606_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|1876771_1877482_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|1877700_1879425_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002217690.1|1879427_1881194_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	6.8e-26
WP_002211341.1|1881652_1882615_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|1883381_1883876_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002211339.1|1883998_1887916_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|1888108_1888717_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|1888727_1890071_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|1890312_1891605_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_001297096.1|1892473_1893253_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1893252_1894275_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211334.1|1895120_1895855_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|1896841_1897516_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002211332.1|1897633_1899916_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211331.1|1899971_1900829_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_002211330.1|1901525_1903292_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002211329.1|1903440_1904478_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_002211328.1|1904746_1905841_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_002211327.1|1905861_1907709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211326.1|1908075_1909161_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_002211325.1|1909323_1910610_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002211324.1|1910922_1911615_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002211323.1|1911788_1913462_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002211322.1|1913522_1913807_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_002211321.1|1914353_1916645_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002211320.1|1916680_1918429_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
WP_002211319.1|1918425_1919412_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_002226050.1|1919419_1920847_-	VOC family protein	NA	NA	NA	NA	NA
WP_002211317.1|1921573_1921783_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
WP_002211315.1|1922330_1922513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211314.1|1922509_1923262_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002211313.1|1923624_1924518_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_002211311.1|1925290_1926076_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|1926072_1927395_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|1927375_1928104_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|1928100_1932558_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|1932773_1933232_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002217987.1|1933515_1935372_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|1935595_1936144_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|1936204_1936852_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|1937005_1937122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|1937275_1938466_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002354007.1|1938722_1939802_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211301.1|1940102_1941503_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|1942001_1943207_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|1943922_1946538_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|1947155_1948166_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|1948348_1948900_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002363919.1|1948925_1950035_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|1950137_1952258_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|1952263_1954177_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|1954305_1955592_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|1955578_1957231_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|1957227_1957806_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|1958075_1958243_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213775.1|1958440_1958899_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_001297096.1|1960059_1960839_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1960838_1961861_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|1962494_1962683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|1962948_1963467_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|1963535_1965287_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|1965497_1965953_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|1966121_1966580_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213066.1|1966769_1967831_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|1968188_1968695_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|1968923_1969559_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|1969660_1971799_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|1971828_1972275_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|1972468_1974523_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|1974583_1975048_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|1975226_1975907_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|1976222_1976639_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|1976747_1977065_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|1977125_1978316_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|1978409_1978688_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|1978739_1979069_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|1982711_1985129_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|1985282_1986029_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|1986759_1986978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|1987241_1987766_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|1987755_1989039_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|1989040_1989778_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|1989793_1991032_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|1991024_1991744_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|1991745_1992498_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|1992500_1993289_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_162006469.1|1993375_1993816_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|1993853_1994102_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|1994200_1995049_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002211662.1|1996037_1996538_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|1996580_1998125_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|1998136_1999489_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|1999485_2000172_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|2000171_2001908_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2001911_2002403_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|2002820_2005469_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_152329052.1|2005465_2007814_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211929.1|2007829_2010130_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|2010126_2010900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|2011053_2011314_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|2011329_2013513_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|2013685_2014156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|2016320_2017553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|2017549_2020972_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|2021015_2022617_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|2022634_2023693_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|2023707_2024163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|2024383_2026147_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|2026110_2027196_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|2027170_2027752_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|2027751_2028204_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002211944.1|2028228_2029596_+	membrane protein	NA	NA	NA	NA	NA
WP_002211945.1|2029807_2030431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2031113_2032709_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211947.1|2032936_2033590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|2033633_2034842_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 7
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	2521142	2621628	4629837	transposase,lysis,integrase,tRNA,tail	Escherichia_phage(14.81%)	104	2531694:2531724	2572708:2572738
WP_002211184.1|2521142_2521841_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|2521977_2522583_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|2522583_2522691_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|2523225_2524914_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|2525073_2526195_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|2526431_2526701_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|2526704_2527517_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|2527541_2528228_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|2528948_2529221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|2529361_2530447_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|2530517_2531174_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|2531276_2531723_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2531694:2531724	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|2531749_2532988_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|2533057_2534080_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2534079_2534859_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|2535026_2535287_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|2535586_2536336_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|2536311_2536758_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|2536831_2537437_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|2537437_2537827_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|2537830_2538049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2538097_2538661_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|2539084_2539294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|2539290_2539566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|2539811_2540009_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|2540039_2540552_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|2540536_2540995_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|2541540_2542254_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|2542710_2543346_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|2543376_2543826_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|2543829_2544414_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|2544461_2545670_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|2545674_2546649_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|2546648_2547377_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|2547395_2548037_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|2548037_2549150_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|2549271_2550045_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|2550058_2551264_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|2551311_2551794_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|2551790_2552045_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|2552046_2552397_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|2552398_2552983_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|2552979_2553387_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|2553452_2554373_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|2554385_2554697_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|2554744_2555005_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|2555005_2558509_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|2558511_2558853_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211709.1|2559026_2559779_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|2559781_2560492_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|2560752_2561385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|2561463_2561895_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|2562018_2562186_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|2562259_2563267_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|2563365_2563917_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|2564059_2564275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2564330_2564951_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|2565125_2565347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2565522_2568726_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|2568725_2569724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|2569740_2570658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|2570719_2571088_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002209743.1|2571308_2572517_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002214492.1|2572821_2573994_-	MFS transporter	NA	NA	NA	NA	NA
2572708:2572738	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|2573997_2575197_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|2575213_2575954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|2577045_2577402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|2577818_2578349_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|2578584_2580159_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|2580402_2581122_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|2581339_2582875_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211686.1|2583340_2584645_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|2584660_2585863_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|2586127_2586997_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|2587194_2588100_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|2588134_2589253_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|2589360_2590635_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211681.1|2590784_2592719_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|2593162_2593912_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|2593984_2594860_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002224141.1|2595173_2596169_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|2596516_2596930_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|2597000_2597273_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|2597406_2598054_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|2598068_2599085_-	asparaginase	NA	NA	NA	NA	NA
WP_002211674.1|2599201_2601052_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|2601214_2601766_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211671.1|2601990_2603037_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211670.1|2603098_2605024_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|2605020_2605311_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|2605323_2605710_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2606549_2606840_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|2606852_2607239_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|2607336_2608143_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|2608952_2609813_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|2610684_2611893_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210667.1|2611855_2612725_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002210666.1|2612808_2613273_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|2614606_2615623_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_016582239.1|2615929_2617276_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.0	4.3e-81
WP_002223593.1|2617710_2618118_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|2618867_2619458_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_001297096.1|2619826_2620606_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2620605_2621628_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 8
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	2885123	2943890	4629837	tRNA,transposase,protease,coat	Tupanvirus(18.18%)	52	NA	NA
WP_002211831.1|2885123_2887511_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|2887524_2888508_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|2888864_2888912_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|2889006_2889363_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|2889400_2889598_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|2889694_2890246_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|2890249_2892178_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|2892568_2892781_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|2893539_2893791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|2894109_2894793_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|2894914_2895577_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|2895788_2896757_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|2896753_2897644_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|2897643_2898528_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|2898524_2899418_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|2899485_2899698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|2899722_2900598_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|2900726_2901281_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|2901691_2902357_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|2902607_2903816_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|2903863_2904214_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|2904549_2905386_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|2905477_2906239_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|2906574_2908242_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|2908282_2909173_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|2909165_2910086_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|2910099_2911227_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|2911242_2912535_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|2912832_2913543_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|2914022_2914571_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|2914774_2916166_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|2916380_2917232_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|2917616_2918408_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|2918594_2919761_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|2920087_2921455_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|2921508_2922312_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|2922308_2923472_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|2923468_2926081_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|2926162_2926942_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|2927094_2927637_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|2928294_2929176_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|2929649_2931722_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|2931741_2932455_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|2932550_2933048_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|2933279_2934527_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|2934495_2937147_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|2937625_2938180_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2938185_2938716_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|2938736_2939294_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|2939324_2940077_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|2940247_2942695_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210858.1|2942900_2943890_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 9
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	3222365	3292391	4629837	plate,tRNA,transposase	uncultured_virus(22.22%)	60	NA	NA
WP_032465663.1|3222365_3223196_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002209726.1|3223246_3224257_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209725.1|3224426_3225554_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
WP_002209724.1|3225600_3226386_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002209722.1|3226611_3227529_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002209721.1|3227813_3228851_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002209720.1|3229192_3229723_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002216161.1|3230510_3231206_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_002209717.1|3231613_3232837_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_002209716.1|3233008_3235078_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002209715.1|3235255_3235534_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002209714.1|3235591_3236134_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002209713.1|3236233_3237040_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002225365.1|3237043_3237871_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002209711.1|3237876_3238962_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
WP_002209710.1|3239038_3239971_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002227846.1|3240340_3240871_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002209707.1|3241248_3241740_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002209705.1|3242308_3244633_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002209704.1|3244632_3245943_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002227845.1|3246229_3246526_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002209702.1|3246939_3248205_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002209701.1|3248311_3249076_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002209700.1|3249111_3250338_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002214855.1|3250337_3250850_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002209699.1|3250846_3251413_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_002209698.1|3251409_3253380_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002209697.1|3253376_3253871_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_002209696.1|3253867_3254170_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_002209695.1|3254166_3254904_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_002209694.1|3254966_3255626_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_002209693.1|3255595_3256252_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	4.8e-09
WP_002209692.1|3256696_3257164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209691.1|3257779_3258322_+	LemA family protein	NA	NA	NA	NA	NA
WP_002209690.1|3258326_3260366_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_002209688.1|3260741_3261083_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_152329057.1|3261157_3261499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|3261555_3262764_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209686.1|3262852_3263332_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|3263460_3264267_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|3264286_3265129_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|3265134_3265395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011055427.1|3265493_3268079_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.3e-29
WP_002214843.1|3268372_3272200_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002209681.1|3272208_3273045_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|3273060_3273840_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3273839_3274862_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|3275540_3276890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|3276893_3277433_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|3277706_3278192_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|3278517_3280020_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|3280043_3280568_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|3280672_3281281_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|3281265_3282456_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|3282480_3283689_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215157.1|3283710_3285261_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|3285388_3286150_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|3286306_3286852_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|3287052_3289728_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|3290510_3292391_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	3427737	3504175	4629837	tRNA,transposase,holin	Bacillus_phage(18.75%)	59	NA	NA
WP_002213775.1|3427737_3428196_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209776.1|3428371_3428998_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002209777.1|3429394_3430438_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.3	9.1e-71
WP_002209778.1|3430552_3431191_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.4	3.1e-29
WP_002209779.1|3431419_3431965_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_002209780.1|3433475_3434288_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.3e-16
WP_002214668.1|3434315_3436028_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002214670.1|3436027_3438259_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002209782.1|3438529_3440593_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002209783.1|3440603_3442163_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_012303868.1|3442298_3442487_+	YfgG family protein	NA	NA	NA	NA	NA
WP_002209784.1|3442538_3444014_+	magnesium transporter	NA	NA	NA	NA	NA
WP_002209785.1|3444153_3445506_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002209786.1|3445777_3446626_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209787.1|3446687_3447953_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209788.1|3447999_3449028_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209789.1|3449080_3450370_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-24
WP_002209790.1|3450551_3452057_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	31.7	4.0e-19
WP_002209791.1|3452439_3453525_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	8.4e-27
WP_002214676.1|3453888_3455223_+	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002209793.1|3455222_3458381_+	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002209794.1|3458377_3461452_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_002209795.1|3461485_3462883_+	MFS transporter	NA	NA	NA	NA	NA
WP_002209796.1|3464307_3465027_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.8	2.3e-33
WP_002209797.1|3465163_3465502_+	YegP family protein	NA	NA	NA	NA	NA
WP_002209798.1|3465776_3467171_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.4	1.5e-177
WP_002209799.1|3467806_3468697_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_002265214.1|3468718_3468955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209800.1|3468983_3469493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209801.1|3470673_3471474_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002209803.1|3471995_3472463_+	DUF943 family protein	NA	NA	NA	NA	NA
WP_002209804.1|3472521_3472800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|3472811_3474020_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002223532.1|3474194_3474509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|3474592_3474829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|3474969_3475296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228620.1|3475329_3475524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220152.1|3476737_3478093_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_002220154.1|3478483_3479194_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220156.1|3479245_3480232_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_015683568.1|3480245_3481988_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
WP_002220159.1|3481992_3483168_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220162.1|3483180_3484287_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220163.1|3484325_3484652_-	EthD family reductase	NA	NA	NA	NA	NA
WP_002220165.1|3484662_3484890_-	N5,N10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
WP_002220168.1|3485444_3486356_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015683567.1|3486356_3487466_-	alkene reductase	NA	NA	NA	NA	NA
WP_002220170.1|3487813_3489178_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220171.1|3489164_3490979_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
WP_002220173.1|3491336_3491810_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_002213759.1|3492615_3493074_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|3494002_3494866_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|3495211_3496060_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|3496097_3496991_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|3497222_3499271_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|3499635_3500232_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|3500289_3501762_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|3501784_3503488_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|3503716_3504175_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	3573889	3580061	4629837	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_002210709.1|3573889_3574090_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|3574089_3574632_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|3574624_3575584_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|3575580_3576669_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|3577017_3577332_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|3577337_3577655_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|3578259_3579282_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3579281_3580061_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 12
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	3820059	3895410	4629837	plate,protease,tRNA,transposase	Staphylococcus_phage(25.0%)	54	NA	NA
WP_002213759.1|3820059_3820518_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209965.1|3820825_3822820_-	transketolase	NA	NA	NA	NA	NA
WP_002209967.1|3823310_3824063_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071525520.1|3824208_3824319_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|3824352_3824673_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002209969.1|3824832_3826812_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|3828018_3829173_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002228653.1|3829365_3829878_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209973.1|3829975_3830683_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|3830943_3831675_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209976.1|3831700_3832660_+	glutathione synthase	NA	NA	NA	NA	NA
WP_002209977.1|3832775_3833339_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|3833338_3833761_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|3833940_3834825_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|3834828_3835944_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209981.1|3836052_3837177_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002215609.1|3837196_3837895_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|3838027_3838849_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|3839136_3839691_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|3839687_3839978_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|3840077_3840671_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|3840663_3841794_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_042593583.1|3841983_3851316_-	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_002209989.1|3852661_3853588_-	glutaminase B	NA	NA	NA	NA	NA
WP_002213775.1|3853749_3854208_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209990.1|3854409_3854736_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|3854735_3855455_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002228057.1|3855792_3856908_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209994.1|3857085_3857358_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|3857540_3858617_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|3858916_3860017_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|3860120_3862154_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|3862236_3863220_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|3863252_3864752_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|3864797_3865757_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|3866312_3868475_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|3869803_3870439_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|3871046_3871744_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|3871839_3872607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|3872593_3874891_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210010.1|3874906_3875542_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002216110.1|3876766_3876961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257642.1|3877154_3877511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210011.1|3877654_3879877_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_152329053.1|3879891_3882240_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002211927.1|3882242_3884885_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002210014.1|3885272_3885764_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002228049.1|3885767_3887504_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|3887503_3888190_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002211664.1|3888186_3889539_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002215896.1|3889550_3891095_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211662.1|3891137_3891638_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|3893913_3894309_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|3894759_3895410_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 13
NZ_CP045154	Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome	4629837	4230023	4292459	4629837	tail,protease,transposase	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002216203.1|4230023_4230539_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|4230544_4231186_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|4231365_4231563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|4231559_4231952_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|4231966_4232395_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|4232708_4233836_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|4234059_4234464_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|4234734_4236108_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|4236224_4236683_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|4236908_4237997_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|4238177_4239440_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|4239593_4239848_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|4239994_4240297_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|4240332_4240956_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|4240968_4241526_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|4241530_4242313_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|4242530_4243349_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|4243613_4244588_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|4244698_4245685_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|4245933_4246497_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|4246493_4247057_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|4247040_4247586_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|4247592_4248318_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|4248379_4249813_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|4250241_4250724_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|4251029_4251884_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|4251880_4252153_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|4252490_4253426_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|4253437_4253902_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|4254039_4254426_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|4254724_4255201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210106.1|4255434_4256388_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|4256798_4258214_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|4258308_4259976_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|4260328_4260739_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|4260970_4261357_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|4261564_4262209_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|4262457_4263798_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_002210099.1|4263978_4264527_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210098.1|4264638_4264920_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002214288.1|4264924_4265398_-	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210095.1|4267327_4269283_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002210094.1|4269284_4270220_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210093.1|4270227_4270431_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002210092.1|4270733_4271645_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002214297.1|4271905_4272772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210090.1|4273007_4275509_+	toxin	NA	NA	NA	NA	NA
WP_002220204.1|4275549_4279143_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210089.1|4279199_4283690_+	toxin	NA	NA	NA	NA	NA
WP_002214300.1|4283823_4284126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210087.1|4284138_4284540_+	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002210086.1|4284536_4284896_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210084.1|4285096_4287928_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210083.1|4287952_4290811_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210082.1|4291013_4292459_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 1
NZ_CP045156	Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pCD, complete sequence	68554	43798	66770	68554	protease,transposase	Enterobacteria_phage(50.0%)	20	NA	NA
WP_002213006.1|43798_44767_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|45266_45815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|46412_47042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|49053_50220_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|50216_51182_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|51341_51578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|52443_52686_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|52678_52978_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|53117_53777_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|53970_54363_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002220893.1|55172_56345_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|57119_57545_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|57692_58792_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|58891_59221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|59359_59824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|59842_60394_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|60557_62873_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|65484_65754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|65822_66281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213244.1|66452_66770_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045155	Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pMT, complete sequence	99286	0	96100	99286	integrase,terminase,tail,transposase	Salmonella_phage(78.38%)	95	13549:13566	26607:26624
WP_002214164.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|2740_3151_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|3134_3506_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|3659_4490_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|4493_4694_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|4784_5816_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|5863_6130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|6129_7074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|7134_8163_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_011114024.1|8282_8714_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	97.9	2.2e-71
WP_002215095.1|8934_9186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|9258_9822_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|9851_10277_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|10291_13816_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
13549:13566	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|13996_15232_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|15328_17695_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|17804_18017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|18279_18666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|18660_19764_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|20523_21036_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|21116_23618_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
WP_002211762.1|23642_24419_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|24746_25652_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|26166_26472_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|26617_26833_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
26607:26624	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
WP_002233024.1|26992_28030_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|28105_28885_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|28884_29907_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002224267.1|30308_30566_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_002224265.1|30866_31661_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224263.1|31913_32636_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|32669_33878_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211760.1|34346_35369_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|37444_39208_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|39285_39774_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|40512_40788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|40810_41752_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|41817_42438_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|42637_42964_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|42963_43191_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|43492_44698_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|44694_45666_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|46044_47442_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|47603_47804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|48304_48982_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|48981_49203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|49213_49633_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|49686_50466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|50864_51371_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|52083_52314_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|52386_54396_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_000255944.1|54519_55542_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|55541_56321_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|56450_57059_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|57360_60249_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|60329_60908_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|60964_65596_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|65617_66205_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|66192_66990_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|66982_67681_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|67770_68106_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|68147_72725_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|72732_72957_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|73082_73400_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|73459_74206_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|74280_74664_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|74665_75139_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|75129_75474_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|75571_76405_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|76404_76839_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|76882_77545_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|77619_78495_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211786.1|79444_81019_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|81052_82309_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|82311_82953_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|83148_83415_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|83424_84315_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|84320_84575_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|84567_85206_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|85202_85871_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|85870_86569_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|86633_88193_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|88195_88474_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|88533_88956_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|88960_89488_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|89811_90462_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|90546_90774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|90883_91342_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|91550_92120_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|92132_92879_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002213300.1|95014_96100_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
