The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	322056	361986	4503487	transposase,plate,tRNA	Escherichia_phage(33.33%)	29	NA	NA
WP_000255944.1|322056_323079_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002218887.1|323543_323729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220999.1|329375_330584_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002217538.1|330641_331172_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_002213171.1|331171_331759_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002213170.1|331912_332182_+	YihD family protein	NA	NA	NA	NA	NA
WP_002213169.1|332272_333259_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002213168.1|333286_333910_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_002213164.1|334401_337200_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.8	2.7e-69
WP_002213759.1|337608_338067_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|338318_338777_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213160.1|339028_339679_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002213158.1|340423_340990_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_002213155.1|341172_342546_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002213152.1|342599_344012_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-05
WP_002213151.1|344019_345069_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.2	4.2e-07
WP_002213150.1|345321_346731_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002217380.1|347292_349116_+	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.2e-20
WP_002209011.1|349437_350028_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_002209010.1|350124_351009_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002209009.1|351015_351453_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297096.1|351526_352306_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|352305_353328_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209166.1|353461_355525_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_002209167.1|355521_356838_+	McrC family protein	NA	NA	NA	NA	NA
WP_002209169.1|357861_359187_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209170.1|359236_359959_+	histidine kinase	NA	NA	NA	NA	NA
WP_002209171.1|359930_361304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525507.1|361647_361986_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	455190	517549	4503487	transposase,plate,tRNA	Bodo_saltans_virus(16.67%)	46	NA	NA
WP_002210509.1|455190_458007_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|458006_458516_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_002228112.1|458583_459042_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|459022_459976_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002213775.1|460357_460816_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002224085.1|460962_462525_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|462527_463619_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|463620_465051_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|465065_465668_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|465908_467090_-	MFS transporter	NA	NA	NA	NA	NA
WP_002231469.1|467753_469415_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|470354_471347_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|471322_472930_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|472916_473627_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|473695_474463_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|474658_477028_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|477488_480395_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|480650_481004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|484528_486139_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|486135_487491_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|487610_488102_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|488094_488460_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|488465_489083_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|489075_490179_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|490204_492424_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|492436_494785_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|494888_497477_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|497494_498478_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|498470_500315_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|500347_500791_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|500864_501383_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210480.1|501545_503048_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210481.1|503056_503617_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210482.1|503627_504641_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002214747.1|504970_505714_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210485.1|506936_507557_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002210486.1|507854_508688_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002228111.1|508872_511215_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210488.1|511282_512587_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002210489.1|512570_513566_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210490.1|513558_514377_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210491.1|514390_514768_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210492.1|514784_515654_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210493.1|515743_516208_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_071525509.1|516334_516649_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|517090_517549_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	1166791	1172963	4503487	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001297096.1|1166791_1167571_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1167570_1168593_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215951.1|1169197_1169515_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|1169520_1169835_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|1170183_1171272_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002215950.1|1171268_1172228_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002215949.1|1172220_1172763_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|1172762_1172963_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
>prophage 4
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	1286319	1331679	4503487	plate,transposase,coat,tail,protease	Pseudomonas_phage(25.0%)	39	NA	NA
WP_002210815.1|1286319_1286829_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|1286863_1287121_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|1287124_1288255_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|1288417_1290706_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|1291199_1291928_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|1292189_1294865_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|1295052_1297926_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|1297993_1298647_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|1298649_1299222_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002216093.1|1299389_1301342_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|1301365_1302520_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|1303623_1304739_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213759.1|1304940_1305399_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228026.1|1306188_1307355_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|1307629_1309156_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|1309532_1310561_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|1310634_1312422_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1312843_1313779_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|1313950_1314193_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|1314398_1315121_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1315394_1315874_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1316084_1317389_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|1318097_1318910_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1318885_1319680_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1320310_1320601_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1320646_1321264_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1321268_1321463_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1321459_1322968_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1322989_1323358_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|1323359_1323659_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1323779_1325273_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|1325539_1326946_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1326942_1327998_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|1328013_1328610_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|1328606_1329062_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1329065_1330202_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1330198_1330459_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1330455_1330803_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|1330899_1331679_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
>prophage 5
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	1454534	1616733	4503487	transposase,protease,tRNA,plate	Escherichia_phage(15.62%)	120	NA	NA
WP_002211349.1|1454534_1454855_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|1454880_1457157_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|1457449_1457908_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211347.1|1458279_1458498_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|1458663_1459374_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|1459592_1461317_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002217690.1|1461319_1463086_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	6.8e-26
WP_002211341.1|1463544_1464507_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|1465273_1465768_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002211339.1|1465890_1469808_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|1470000_1470609_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|1470619_1471963_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|1472204_1473497_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_001297096.1|1474349_1475129_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1475128_1476151_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211334.1|1476996_1477731_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|1478717_1479392_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002211332.1|1479509_1481792_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211331.1|1481847_1482705_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_002211330.1|1483402_1485169_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002211329.1|1485317_1486355_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_002211328.1|1486623_1487718_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_002211327.1|1487738_1489586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211326.1|1489952_1491038_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_002211325.1|1491200_1492487_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002211324.1|1492799_1493492_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002211323.1|1493665_1495339_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002211322.1|1495399_1495684_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_002211321.1|1496230_1498522_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002211320.1|1498557_1500306_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
WP_002211319.1|1500302_1501289_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_002216263.1|1501296_1502733_-	VOC family protein	NA	NA	NA	NA	NA
WP_002211317.1|1503459_1503669_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
WP_002211315.1|1504216_1504399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211314.1|1504395_1505148_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002211313.1|1505510_1506404_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_002211311.1|1507176_1507962_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|1507958_1509281_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|1509261_1509990_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|1509986_1514444_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|1514659_1515118_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002217987.1|1515401_1517258_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|1517481_1518030_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|1518090_1518738_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|1518891_1519008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|1519161_1520352_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002354007.1|1520608_1521688_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211301.1|1521988_1523389_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|1523887_1525093_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|1525808_1528424_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|1529077_1530088_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|1530270_1530822_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002363919.1|1530847_1531957_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|1532059_1534180_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|1534185_1536099_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|1536227_1537514_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|1537500_1539153_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|1539149_1539728_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|1539997_1540165_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213775.1|1540362_1540821_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_001297096.1|1541981_1542761_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1542760_1543783_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|1544416_1544605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|1544870_1545389_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|1545457_1547209_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|1547419_1547875_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|1548043_1548502_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213066.1|1548691_1549753_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|1550110_1550617_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|1550845_1551481_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|1551582_1553721_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|1553750_1554197_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|1554390_1556445_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|1556505_1556970_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|1557148_1557829_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|1558144_1558561_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|1558669_1558987_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|1559047_1560238_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|1560331_1560610_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|1560661_1560991_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|1564635_1567053_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|1567206_1567953_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|1568683_1568902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|1569165_1569690_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|1569679_1570963_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|1570964_1571702_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|1571717_1572956_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|1572948_1573668_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|1573669_1574422_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|1574424_1575213_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|1575299_1575740_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|1575777_1576026_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|1576124_1576973_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002211662.1|1577961_1578462_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|1578504_1580049_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|1580060_1581413_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|1581409_1582096_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|1582095_1583832_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|1583835_1584327_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002223447.1|1584714_1587354_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.5	1.5e-90
WP_002211928.1|1587356_1589705_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_059212237.1|1589720_1592021_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|1592017_1592791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|1592944_1593205_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_041175909.1|1593220_1595404_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|1595576_1596047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|1598211_1599444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|1599440_1602863_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|1602906_1604508_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|1604525_1605584_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|1605598_1606054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|1606274_1608038_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|1608001_1609087_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|1609061_1609643_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|1609642_1610095_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002211944.1|1610119_1611487_+	membrane protein	NA	NA	NA	NA	NA
WP_002211945.1|1611698_1612322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|1613004_1614600_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211947.1|1614827_1615481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|1615524_1616733_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 6
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	2001409	2100828	4503487	transposase,integrase,lysis,tail,tRNA	Escherichia_phage(14.81%)	101	2011957:2011987	2052971:2053001
WP_002211184.1|2001409_2002108_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_087768167.1|2002845_2002953_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|2003488_2005177_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|2005336_2006458_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|2006694_2006964_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|2006967_2007780_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|2007804_2008491_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|2009211_2009484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|2009624_2010710_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|2010780_2011437_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|2011539_2011986_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2011957:2011987	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|2012012_2013251_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|2013320_2014343_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2014342_2015122_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|2015289_2015550_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|2015849_2016599_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|2016574_2017021_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|2017094_2017700_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|2017700_2018090_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|2018093_2018312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2018360_2018924_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|2019347_2019557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|2019553_2019829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|2020074_2020272_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|2020302_2020815_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|2020799_2021258_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|2021803_2022517_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|2022973_2023609_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|2023639_2024089_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|2024092_2024677_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|2024724_2025933_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|2025937_2026912_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|2026911_2027640_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|2027658_2028300_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|2028300_2029413_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|2029534_2030308_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|2030321_2031527_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|2031574_2032057_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|2032053_2032308_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|2032309_2032660_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|2032661_2033246_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|2033242_2033650_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|2033715_2034636_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|2034648_2034960_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071530527.1|2035007_2035268_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	48.6	4.1e-12
WP_002211711.1|2035268_2038772_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|2038774_2039116_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211709.1|2039289_2040042_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|2040044_2040755_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|2041015_2041648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|2041726_2042158_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|2042281_2042449_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|2042522_2043530_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|2043628_2044180_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|2044322_2044538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2044593_2045214_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|2045388_2045610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2045785_2048989_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|2048988_2049987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|2050003_2050921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|2050982_2051351_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002209743.1|2051571_2052780_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002214492.1|2053084_2054257_-	MFS transporter	NA	NA	NA	NA	NA
2052971:2053001	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|2054260_2055460_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|2055476_2056217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|2057308_2057665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|2058081_2058612_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211688.1|2060665_2061385_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|2061602_2063138_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211686.1|2063603_2064908_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|2064923_2066126_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|2066390_2067260_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|2067457_2068363_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|2068397_2069516_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|2069623_2070898_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211681.1|2071047_2072982_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|2073425_2074175_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|2074247_2075123_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002224141.1|2075436_2076432_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|2076779_2077193_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|2077263_2077536_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|2077669_2078317_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|2078331_2079348_-	asparaginase	NA	NA	NA	NA	NA
WP_002211674.1|2079464_2081315_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|2081477_2082029_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211671.1|2082253_2083300_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211670.1|2083346_2085272_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|2085268_2085559_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|2085571_2085958_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|2086055_2086862_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|2087671_2088532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|2089403_2090612_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210667.1|2090574_2091444_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002210666.1|2091527_2091992_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|2093325_2094342_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|2094648_2095995_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002223593.1|2096429_2096837_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|2097586_2098177_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_001297096.1|2098545_2099325_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2099324_2100347_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002223594.1|2100405_2100828_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	2362290	2421038	4503487	transposase,protease,tRNA,coat	Tupanvirus(18.18%)	52	NA	NA
WP_002211831.1|2362290_2364678_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|2364691_2365675_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|2366031_2366079_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|2366173_2366530_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|2366567_2366765_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|2366861_2367413_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|2367416_2369345_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|2369735_2369948_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|2370706_2370958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|2371276_2371960_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|2372081_2372744_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|2372955_2373924_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|2373920_2374811_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|2374810_2375695_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|2375691_2376585_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|2376652_2376865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|2376889_2377765_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|2377893_2378448_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|2378858_2379524_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|2379774_2380983_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|2381030_2381381_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|2381716_2382553_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|2382644_2383406_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|2383741_2385409_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|2385449_2386340_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|2386332_2387253_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|2387266_2388394_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|2388409_2389702_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|2389999_2390710_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|2391189_2391738_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|2391941_2393333_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|2393547_2394399_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|2394783_2395575_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|2395761_2396928_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|2397254_2398622_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|2398675_2399479_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|2399475_2400639_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|2400635_2403248_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|2403329_2404109_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|2404261_2404804_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|2405461_2406343_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|2406797_2408870_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|2408889_2409603_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|2409698_2410196_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|2410427_2411675_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|2411643_2414295_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|2414773_2415328_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2415333_2415864_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|2415884_2416442_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|2416472_2417225_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|2417395_2419843_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210858.1|2420048_2421038_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	2488333	2545381	4503487	transposase,tRNA	uncultured_virus(25.0%)	52	NA	NA
WP_002210913.1|2488333_2489449_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|2489506_2490133_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002210915.1|2490193_2491564_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
WP_002210916.1|2491751_2492375_+	porin family protein	NA	NA	NA	NA	NA
WP_002210917.1|2492585_2493257_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|2493262_2494717_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|2494800_2495922_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|2496154_2497390_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|2497719_2498556_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002210922.1|2499538_2500786_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|2500785_2501490_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|2501482_2502685_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|2502954_2506401_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002210925.1|2506639_2507179_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|2507508_2508717_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002213101.1|2508812_2509226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215856.1|2509233_2509803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213097.1|2510340_2511645_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002213095.1|2512019_2512562_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002215854.1|2512689_2513709_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213090.1|2513791_2514658_-	thiamine kinase	NA	NA	NA	NA	NA
WP_002213089.1|2514638_2515214_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213088.1|2515254_2515644_-	YcfL family protein	NA	NA	NA	NA	NA
WP_002213087.1|2515678_2516032_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002215853.1|2516205_2517024_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000255944.1|2517622_2518645_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2518644_2519424_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_050881381.1|2519474_2519885_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002213085.1|2520074_2521508_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213084.1|2521814_2522624_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213083.1|2522638_2523661_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213082.1|2523660_2524299_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002217396.1|2524288_2525314_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213080.1|2525602_2526409_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002213775.1|2526824_2527283_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213079.1|2527482_2528724_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002220787.1|2528818_2529055_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002210935.1|2529208_2529943_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002210934.1|2529956_2530886_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210933.1|2530923_2531874_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210932.1|2531880_2532915_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210931.1|2532948_2533116_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210930.1|2533128_2533653_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210928.1|2533794_2534391_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002210927.1|2534513_2535476_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016257293.1|2536059_2539701_+	ribonuclease E	NA	NA	NA	NA	NA
WP_002209743.1|2539796_2541005_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002217041.1|2540967_2541264_-	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_002224294.1|2541769_2542015_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	7.7e-13
WP_002213109.1|2542327_2543374_-	dihydroorotase	NA	NA	NA	NA	NA
WP_002213107.1|2543608_2543896_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002209743.1|2544172_2545381_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 9
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	2701575	2771247	4503487	transposase,plate,tRNA	Escherichia_phage(25.0%)	60	NA	NA
WP_032465663.1|2701575_2702406_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002209726.1|2702456_2703467_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209725.1|2703636_2704764_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
WP_002209724.1|2704810_2705596_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002209722.1|2705821_2706739_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002209721.1|2707023_2708061_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002209720.1|2708402_2708933_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002216161.1|2709720_2710416_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_002209717.1|2710823_2712047_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_002209716.1|2712218_2714288_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002209715.1|2714465_2714744_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002209714.1|2714801_2715344_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002209713.1|2715443_2716250_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002225365.1|2716253_2717081_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002209711.1|2717086_2718172_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
WP_002209710.1|2718248_2719181_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002227846.1|2719550_2720081_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002209707.1|2720386_2720878_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002209705.1|2721446_2723771_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002209704.1|2723770_2725081_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002227845.1|2725367_2725664_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002232482.1|2726077_2727343_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002209701.1|2727449_2728214_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002209700.1|2728249_2729476_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002214855.1|2729475_2729988_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002209699.1|2729984_2730551_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_002209698.1|2730547_2732518_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002209697.1|2732514_2733009_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_002209696.1|2733005_2733308_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_002209695.1|2733304_2734042_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_002209694.1|2734104_2734764_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_002209693.1|2734733_2735390_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	4.8e-09
WP_002209692.1|2735834_2736302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209691.1|2736917_2737460_+	LemA family protein	NA	NA	NA	NA	NA
WP_002209690.1|2737464_2739504_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_002209688.1|2739879_2740221_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002209687.1|2740295_2740643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209686.1|2740667_2741147_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|2741291_2742098_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|2742117_2742960_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|2742965_2743226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011055427.1|2743324_2745910_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.3e-29
WP_002214843.1|2746203_2750031_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002209681.1|2750039_2750876_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|2750891_2751671_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2751670_2752693_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|2753371_2754721_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|2754724_2755264_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|2755537_2756023_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|2756348_2757851_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|2757874_2758399_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|2758503_2759112_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|2759096_2760287_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2760311_2761520_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215157.1|2761541_2763092_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|2763219_2763981_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|2764137_2764683_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|2764883_2767559_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|2768341_2770222_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211583.1|2770221_2771247_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 10
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	3186403	3231795	4503487	transposase,tRNA,protease,integrase	Escherichia_phage(22.22%)	46	3202149:3202163	3229754:3229768
WP_002213775.1|3186403_3186862_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_138921619.1|3187107_3189420_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002209745.1|3189632_3189878_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_002216002.1|3190550_3191132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209746.1|3191399_3191801_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209748.1|3192033_3192435_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209749.1|3192446_3193019_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002227852.1|3193042_3193294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209751.1|3193332_3193572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|3194380_3196297_+	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002224869.1|3196420_3196543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209753.1|3196831_3197413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|3197814_3199023_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209756.1|3199474_3201682_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209757.1|3201674_3202205_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
3202149:3202163	attL	TCGGCGTTGCTGACC	NA	NA	NA	NA
WP_002209758.1|3202363_3204745_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002209759.1|3204823_3206452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209762.1|3206924_3207776_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209763.1|3207801_3208791_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|3208845_3209739_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|3209832_3210855_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3210854_3211634_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215253.1|3212000_3212306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209765.1|3212402_3212804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209766.1|3212785_3214105_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209767.1|3214097_3215861_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|3215857_3216490_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209769.1|3216499_3217429_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|3217421_3218024_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|3218423_3218630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|3218841_3219120_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002215266.1|3219202_3219541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|3219676_3220174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|3220287_3220488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|3220746_3220929_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002209774.1|3221283_3222150_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002209775.1|3222164_3222377_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002213775.1|3222523_3222982_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222677.1|3223328_3224714_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002208567.1|3224924_3225419_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002208568.1|3225429_3226152_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208569.1|3226447_3226972_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208570.1|3226968_3228033_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208571.1|3228076_3230506_-	ABC transporter permease	NA	NA	NA	NA	NA
3229754:3229768	attR	GGTCAGCAACGCCGA	NA	NA	NA	NA
WP_002208572.1|3230502_3231189_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208573.1|3231159_3231795_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 11
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	3894824	3962253	4503487	transposase	Escherichia_phage(40.0%)	51	NA	NA
WP_000255944.1|3894824_3895847_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3895846_3896626_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086016626.1|3897290_3898390_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_002218887.1|3904060_3904246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210692.1|3904713_3906303_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002210691.1|3906362_3907649_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002355296.1|3907796_3908450_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|3908499_3908775_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002210688.1|3908963_3909554_-	YjaG family protein	NA	NA	NA	NA	NA
WP_002210687.1|3909599_3910340_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210686.1|3910369_3911437_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210685.1|3911555_3912341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210684.1|3912433_3913216_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210683.1|3913312_3913822_+	sigma D regulator	NA	NA	NA	NA	NA
WP_002210682.1|3914197_3916243_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210681.1|3916229_3916904_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210680.1|3916893_3917691_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|3917687_3917903_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002228257.1|3917904_3918720_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|3918712_3919843_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002213775.1|3920274_3920733_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210677.1|3920859_3925080_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002210676.1|3925208_3929237_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210675.1|3929579_3929948_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210674.1|3930014_3930512_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210673.1|3930876_3931581_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210672.1|3931584_3932013_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210671.1|3932203_3932749_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210670.1|3932750_3933134_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210669.1|3933384_3934569_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_001297096.1|3935625_3936405_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3936404_3937427_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002217850.1|3937516_3938068_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002212290.1|3938278_3939229_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002212289.1|3939263_3940223_-	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212288.1|3940219_3941257_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|3946924_3947110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215920.1|3947393_3947927_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002211550.1|3947948_3949400_-	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002213759.1|3949988_3950447_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211548.1|3950551_3950761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211547.1|3950760_3952092_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_002211546.1|3952418_3954608_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211545.1|3954619_3955783_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002215918.1|3955942_3956644_-	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002215917.1|3956698_3958195_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002211542.1|3958442_3958931_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002211541.1|3959040_3960063_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211540.1|3960077_3960413_-	deoxyribonuclease	NA	NA	NA	NA	NA
WP_001297096.1|3960451_3961231_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3961230_3962253_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 12
NZ_CP045163	Yersinia pestis strain SCPM-O-B-6291 (C-25) chromosome, complete genome	4503487	4253026	4315462	4503487	transposase,tail,protease	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002216203.1|4253026_4253542_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|4253547_4254189_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|4254368_4254566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|4254562_4254955_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|4254969_4255398_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|4255711_4256839_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|4257062_4257467_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|4257737_4259111_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|4259227_4259686_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|4259911_4261000_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|4261180_4262443_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|4262596_4262851_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|4262997_4263300_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|4263335_4263959_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|4263971_4264529_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|4264533_4265316_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|4265533_4266352_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|4266616_4267591_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|4267701_4268688_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|4268936_4269500_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|4269496_4270060_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|4270043_4270589_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|4270595_4271321_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|4271382_4272816_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|4273244_4273727_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|4274032_4274887_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|4274883_4275156_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|4275493_4276429_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|4276440_4276905_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|4277042_4277429_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|4277727_4278204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210106.1|4278437_4279391_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|4279801_4281217_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|4281311_4282979_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|4283331_4283742_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|4283973_4284360_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|4284567_4285212_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|4285460_4286801_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_002210099.1|4286981_4287530_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210098.1|4287641_4287923_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002214288.1|4287927_4288401_-	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210095.1|4290330_4292286_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002210094.1|4292287_4293223_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210093.1|4293230_4293434_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002210092.1|4293736_4294648_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002214297.1|4294908_4295775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210090.1|4296010_4298512_+	toxin	NA	NA	NA	NA	NA
WP_002220204.1|4298552_4302146_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210089.1|4302202_4306693_+	toxin	NA	NA	NA	NA	NA
WP_002214300.1|4306826_4307129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210087.1|4307141_4307543_+	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_032486133.1|4307539_4307899_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210084.1|4308099_4310931_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210083.1|4310955_4313814_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210082.1|4314016_4315462_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 1
NZ_CP045164	Yersinia pestis strain SCPM-O-B-6291 (C-25) plasmid pMT, complete sequence	100989	0	97803	100989	tail,transposase,terminase,integrase	Salmonella_phage(79.22%)	97	13550:13567	26608:26625
WP_002214164.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|1634_1847_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|1846_2182_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|2178_2358_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|2398_2674_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|2741_3152_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|3135_3507_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|3660_4491_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|4494_4695_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|4785_5817_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|5864_6131_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|6130_7075_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|7135_8164_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_011114024.1|8283_8715_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	97.9	2.2e-71
WP_002215095.1|8935_9187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|9259_9823_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|9852_10278_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|10292_13817_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
13550:13567	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|13997_15233_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|15329_17696_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|17805_18018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|18280_18667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|18661_19765_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|20524_21037_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211762.1|23643_24420_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|24747_25653_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|26167_26473_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|26618_26834_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
26608:26625	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
WP_002233024.1|26993_28031_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|28106_28886_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|28885_29908_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002224267.1|30309_30567_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_002224265.1|30867_31662_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224263.1|31914_32637_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|32670_33879_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211760.1|34347_35370_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|37445_39209_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|39286_39775_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|40513_40789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|40811_41753_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|41818_42439_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|42638_42965_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|42964_43192_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|43493_44699_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|44695_45667_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|46045_47443_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|47604_47805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|48305_48983_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|48982_49204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|49214_49634_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|49687_50467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|50865_51372_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|52084_52315_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|52387_54397_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_000255944.1|54520_55543_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|55542_56322_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|56455_57064_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|57365_60254_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|60334_60913_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|60969_65601_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|65622_66210_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|66197_66995_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|66987_67686_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|67775_68111_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|68152_72730_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|72737_72962_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|73087_73405_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|73464_74211_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|74285_74669_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|74670_75144_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|75134_75479_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|75576_76410_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|76409_76844_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|76887_77550_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|77624_78500_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211786.1|79449_81024_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|81057_82314_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|82316_82958_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|83153_83420_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|83429_84320_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|84325_84580_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|84572_85211_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|85207_85876_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|85875_86574_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|86638_88198_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|88200_88479_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|88538_88961_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|88965_89493_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|89816_90467_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|90551_90779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|91417_91900_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|92105_92387_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|92586_93045_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|93253_93823_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|93835_94582_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|94571_94931_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|96717_97803_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
