The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045300	Kosakonia arachidis strain KACC 18508 chromosome, complete genome	5096793	1736697	1744614	5096793		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_090118632.1|1736697_1736952_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	44.1	2.1e-05
WP_090118630.1|1737055_1737412_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	35.9	7.0e-07
WP_090118627.1|1738071_1739199_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	51.9	4.5e-100
WP_090118625.1|1739405_1739660_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	49.1	1.9e-06
WP_090118623.1|1739744_1740170_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_090118621.1|1740182_1741472_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.6	1.4e-166
WP_090118619.1|1741515_1741836_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.5	2.0e-21
WP_090120638.1|1742014_1743421_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_090118618.1|1743432_1744125_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	1.2e-31
WP_043954427.1|1744281_1744614_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	29.5	4.7e-05
>prophage 2
NZ_CP045300	Kosakonia arachidis strain KACC 18508 chromosome, complete genome	5096793	3009099	3103317	5096793	lysis,protease,portal,plate,tail,integrase,tRNA	Escherichia_phage(45.45%)	97	3053367:3053408	3077741:3077782
WP_090125957.1|3009099_3010200_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_043955909.1|3010237_3010603_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_090125960.1|3010602_3011256_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_090125963.1|3011452_3012853_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_090125967.1|3012835_3013753_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_090126267.1|3014012_3015386_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_090126270.1|3015503_3016280_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_090125970.1|3016290_3017295_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_090125973.1|3017463_3018615_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_090125976.1|3018878_3021530_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_090125979.1|3021624_3022476_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_090125984.1|3022693_3023356_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.4	2.5e-29
WP_090125987.1|3023366_3024470_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_090125990.1|3024555_3025446_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_090125993.1|3025658_3028091_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_090125996.1|3028093_3029254_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_007369220.1|3029517_3029835_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_007369223.1|3030140_3030353_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_090125999.1|3030560_3032753_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_090126002.1|3032877_3033903_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_090126004.1|3033996_3034986_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_090126007.1|3035079_3035610_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_090126010.1|3035620_3036952_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	28.7	1.1e-44
WP_090126014.1|3037018_3037948_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_007369230.1|3038040_3038526_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_090126017.1|3038709_3038955_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_090126019.1|3039380_3040229_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	1.5e-15
WP_090126022.1|3040250_3041759_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_090126028.1|3041861_3042872_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_090126031.1|3042968_3043715_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_090126034.1|3043715_3044135_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_090126037.1|3044247_3044847_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_007369238.1|3044954_3045722_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_090126040.1|3045759_3047064_-	citrate transporter	NA	NA	NA	NA	NA
WP_090126043.1|3047137_3047896_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_090126046.1|3048020_3049010_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_090126049.1|3049156_3050119_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_090126052.1|3050317_3051202_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_090126055.1|3051367_3053167_-	LTA synthase family protein	NA	NA	NA	NA	NA
3053367:3053408	attL	AAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGT	NA	NA	NA	NA
WP_090126058.1|3053523_3054177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090126061.1|3054274_3054493_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	90.3	7.0e-34
WP_090126064.1|3054573_3056136_-|tail	phage tail tape measure protein	tail	A0A0F7LDR0	Escherichia_phage	75.4	4.2e-96
WP_090126067.1|3056128_3056248_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	1.7e-13
WP_090126070.1|3056280_3056556_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	82.4	2.6e-33
WP_090126073.1|3056617_3057136_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	90.7	1.2e-87
WP_090126076.1|3057149_3058340_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	88.6	2.3e-203
WP_167518544.1|3058468_3059077_-|tail	tail fiber assembly protein	tail	Q2A0A8	Sodalis_phage	39.2	2.1e-19
WP_167518545.1|3059076_3060945_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	78.0	3.5e-89
WP_090126080.1|3060955_3061486_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	84.0	7.1e-88
WP_090126083.1|3061478_3062387_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	79.8	4.3e-133
WP_090126086.1|3062391_3062736_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	1.5e-38
WP_090126273.1|3062732_3063368_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	85.8	9.1e-98
WP_090126088.1|3063486_3064029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090126091.1|3064025_3064427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090126094.1|3064427_3064871_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	8.7e-47
WP_090126097.1|3064863_3065331_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	81.9	7.2e-68
WP_090126103.1|3065438_3065852_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	68.6	5.4e-43
WP_090126106.1|3066511_3067549_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	77.9	2.1e-160
WP_090126108.1|3067866_3068589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090126111.1|3068899_3069154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090126114.1|3069300_3070812_-	hypothetical protein	NA	Q38324	Lactococcus_phage	26.9	6.4e-25
WP_090126117.1|3071297_3073544_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	84.7	0.0e+00
WP_035889134.1|3073533_3073809_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	75.8	3.4e-33
WP_090126120.1|3073805_3074030_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	75.7	1.2e-23
WP_090126123.1|3074034_3074331_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	69.7	2.3e-27
WP_090126126.1|3074330_3074555_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	84.7	2.5e-26
WP_090126129.1|3074618_3075119_-	replication protein B	NA	M1SV55	Escherichia_phage	80.7	6.5e-75
WP_090126132.1|3075288_3075561_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	93.3	4.2e-44
WP_090126135.1|3075714_3076008_+	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	75.3	1.6e-36
WP_090126139.1|3076077_3077058_+|integrase	tyrosine-type recombinase/integrase	integrase	Q858U3	Yersinia_virus	92.3	5.4e-174
WP_090126142.1|3077061_3077298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090126145.1|3077281_3077617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090126148.1|3077807_3078302_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3077741:3077782	attR	AAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGT	NA	NA	NA	NA
WP_090126152.1|3078453_3079152_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
WP_090126155.1|3079148_3080522_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.1	3.2e-15
WP_090126157.1|3080554_3081229_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_090126276.1|3081389_3082280_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_090126159.1|3082385_3083369_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_043955942.1|3083627_3084248_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.2e-62
WP_090126166.1|3084537_3085572_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_090126168.1|3085572_3086421_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_090126170.1|3086494_3087331_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_090126173.1|3087631_3089101_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_090126176.1|3089097_3090357_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_090126179.1|3090505_3091336_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_090126183.1|3091552_3092701_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_090126186.1|3092697_3093012_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_090120483.1|3093350_3093563_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_090126190.1|3093677_3094517_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_139234448.1|3094755_3097806_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.2e-07
WP_090126196.1|3097818_3098721_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_090126199.1|3098717_3099353_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_090126202.1|3099349_3100279_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_090126210.1|3100578_3101490_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_090126215.1|3101507_3101846_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_152406447.1|3101893_3102835_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_090126221.1|3102879_3103317_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP045300	Kosakonia arachidis strain KACC 18508 chromosome, complete genome	5096793	3739825	3752732	5096793	protease,head,capsid,portal,tail,terminase,integrase	uncultured_Caudovirales_phage(83.33%)	18	3739599:3739646	3755991:3756038
3739599:3739646	attL	TTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_090121495.1|3739825_3741247_+|integrase	integrase family protein	integrase	H7BV31	unidentified_phage	28.4	2.6e-07
WP_167518588.1|3741609_3741969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090121494.1|3742111_3742321_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_090121493.1|3742422_3743277_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	60.4	4.9e-38
WP_090121491.1|3743260_3744271_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_044179410.1|3744267_3744465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090121490.1|3744457_3744769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044179416.1|3744765_3745134_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	88.5	6.5e-56
WP_090121488.1|3745130_3746498_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	84.0	1.6e-224
WP_090121487.1|3747006_3747780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090121484.1|3748024_3749191_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	92.8	5.2e-200
WP_090121482.1|3749243_3749804_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	94.1	4.0e-97
WP_139234402.1|3749805_3751032_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	91.2	3.9e-222
WP_032979707.1|3751028_3751367_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	85.7	3.2e-49
WP_032979710.1|3751363_3751657_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	2.9e-43
WP_090121480.1|3751656_3752100_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.8	1.4e-76
WP_167518552.1|3752092_3752245_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	80.0	7.8e-16
WP_000113647.1|3752375_3752732_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
3755991:3756038	attR	TTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
>prophage 4
NZ_CP045300	Kosakonia arachidis strain KACC 18508 chromosome, complete genome	5096793	4335215	4399964	5096793	holin,transposase,plate,tail,integrase,tRNA	Escherichia_phage(24.32%)	66	4358813:4358828	4400958:4400973
WP_090126389.1|4335215_4336454_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_090126392.1|4336840_4338082_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	6.3e-103
WP_007370697.1|4338864_4339347_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_090126535.1|4339466_4339943_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_090126395.1|4339932_4340226_+	RnfH family protein	NA	NA	NA	NA	NA
WP_090126397.1|4340294_4340636_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_090126400.1|4340783_4342445_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_074773957.1|4342531_4343422_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_139234457.1|4343544_4344141_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_090126406.1|4344183_4345470_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_090126409.1|4345488_4346277_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_090126412.1|4346444_4347806_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_090126415.1|4348057_4348306_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_090126418.1|4348324_4348873_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_090126421.1|4348903_4349671_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|4349714_4350062_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_090126423.1|4350218_4350410_-	late control protein B	NA	Q37973	Salmonella_virus	70.3	2.3e-20
WP_090126426.1|4350489_4351650_-	hypothetical protein	NA	S4TRX8	Salmonella_phage	44.5	1.3e-89
WP_090126429.1|4351646_4352108_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	59.5	1.0e-45
WP_090126432.1|4352110_4354015_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	37.4	1.9e-29
WP_061493592.1|4354007_4354127_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	7.5e-14
WP_090126435.1|4354159_4354441_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.5	3.6e-30
WP_007370716.1|4354503_4355022_-|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	90.1	4.5e-87
WP_074773984.1|4355034_4356216_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	88.0	8.1e-201
WP_090126439.1|4356346_4356940_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	49.2	3.0e-42
WP_090126442.1|4356939_4358088_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.5	1.3e-113
WP_090126445.1|4358304_4359255_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	81.7	1.2e-80
4358813:4358828	attL	GTCGCCAGCACCACCG	NA	NA	NA	NA
WP_090126448.1|4359409_4360018_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	75.5	3.8e-85
WP_090126451.1|4360010_4360919_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	77.5	2.4e-128
WP_090126454.1|4360923_4361271_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	73.0	4.3e-41
WP_090126457.1|4361267_4361903_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	81.5	1.4e-93
WP_090126460.1|4361990_4362458_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	58.2	1.8e-47
WP_090126462.1|4362553_4362979_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	54.7	2.5e-27
WP_090126465.1|4362975_4363485_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	75.0	5.6e-66
WP_035888412.1|4363468_4363690_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	43.8	2.9e-11
WP_090126467.1|4363680_4363884_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	65.2	4.5e-19
WP_090126470.1|4364081_4364267_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	55.7	3.5e-10
WP_090126473.1|4364341_4366312_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	71.5	1.5e-263
WP_090126475.1|4366312_4366534_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	66.2	1.0e-19
WP_090126478.1|4366533_4366761_-	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	43.5	4.2e-05
WP_090126481.1|4366829_4367168_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	68.5	1.2e-37
WP_090126484.1|4367206_4367584_-	Cro/Cl family transcriptional regulator	NA	A0A0M4R4X7	Salmonella_phage	70.0	2.1e-41
WP_090126538.1|4367699_4368548_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	62.6	2.1e-94
WP_090126488.1|4368554_4369604_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	73.9	1.9e-153
WP_090126491.1|4369765_4370197_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_090126494.1|4370261_4371626_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_090126497.1|4371806_4372877_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	1.4e-90
WP_090126500.1|4372886_4374008_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_090126503.1|4374074_4374947_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_090126506.1|4374943_4376104_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_090126509.1|4376351_4376693_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_090126512.1|4376958_4377696_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_090126515.1|4377827_4378808_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_090126518.1|4378804_4379536_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_090126522.1|4379665_4382239_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.0	5.5e-125
WP_090124424.1|4387959_4389258_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	3.1e-44
WP_074778660.1|4389254_4389578_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_090124428.1|4389622_4390978_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_090124430.1|4391091_4393752_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_090124432.1|4393784_4394483_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_090124435.1|4394552_4394972_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	2.0e-13
WP_090124438.1|4395178_4396276_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_090124441.1|4396326_4397016_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.9	4.6e-55
WP_090124446.1|4397329_4397713_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	3.1e-32
WP_090124449.1|4397762_4399097_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.1	1.1e-41
WP_090124452.1|4399226_4399964_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
4400958:4400973	attR	GTCGCCAGCACCACCG	NA	NA	NA	NA
>prophage 5
NZ_CP045300	Kosakonia arachidis strain KACC 18508 chromosome, complete genome	5096793	4839668	4848054	5096793	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_090123123.1|4839668_4840616_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.7	6.2e-10
WP_090123125.1|4840599_4841337_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_090123127.1|4841311_4841425_-	protein YohO	NA	NA	NA	NA	NA
WP_090123128.1|4841483_4842215_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	73.4	1.4e-81
WP_090123836.1|4842435_4844124_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.7	2.7e-258
WP_090123130.1|4844117_4844837_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_090123132.1|4844889_4845366_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.5	2.2e-64
WP_090123134.1|4845495_4845951_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	44.9	8.4e-29
WP_090123838.1|4846020_4848054_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.9	1.8e-54
>prophage 6
NZ_CP045300	Kosakonia arachidis strain KACC 18508 chromosome, complete genome	5096793	4922506	4928858	5096793		Enterobacteria_phage(50.0%)	6	NA	NA
WP_090123247.1|4922506_4923922_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.2	1.4e-18
WP_090123249.1|4924108_4925002_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.2	7.4e-45
WP_090123251.1|4925401_4926484_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.6e-102
WP_090123253.1|4926486_4927386_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	33.8	2.2e-28
WP_090123255.1|4927433_4928312_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.3e-105
WP_090123257.1|4928315_4928858_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.3	2.7e-50
