The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045410	Roseovarius sp. THAF8 chromosome, complete genome	4049107	371527	401188	4049107	transposase,terminase,integrase	Acidithiobacillus_phage(22.22%)	29	361778:361808	407464:407494
361778:361808	attL	CCAGGGTTCGAATCCCTGTCTCTCCGCCATT	NA	NA	NA	NA
WP_152495634.1|371527_372547_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_152495635.1|372911_374051_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_152495636.1|374441_374708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152495637.1|374672_375781_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	5.3e-53
WP_172978772.1|376477_376636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152498152.1|376740_377736_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_152495639.1|377732_379163_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1R3Y6Z3	Salmonella_virus	26.9	2.2e-11
WP_152495640.1|379908_380520_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152495641.1|380702_381674_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_152495642.1|381999_382578_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152495643.1|382839_383298_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_152495644.1|383564_383864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152495645.1|384039_384738_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	45.2	1.1e-35
WP_152495646.1|384812_385349_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	40.5	7.3e-24
WP_172978773.1|385391_386642_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	55.9	1.0e-129
WP_152495647.1|387002_387956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152495648.1|388158_388788_-	LysE family transporter	NA	NA	NA	NA	NA
WP_152495649.1|388986_392013_-	bifunctional DNA primase/polymerase	NA	I6NPA6	Burkholderia_phage	31.9	1.9e-20
WP_152498154.1|392016_392202_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_152495650.1|392210_392390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152495651.1|392455_393106_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_152495652.1|393279_393495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152495653.1|393587_395786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152495654.1|396105_396561_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	43.1	1.7e-21
WP_152495655.1|396557_397868_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	52.7	8.4e-122
WP_152495656.1|397864_398248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152495657.1|398328_398724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152495658.1|399519_399783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152495659.1|400555_401188_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	27.7	3.0e-08
407464:407494	attR	AATGGCGGAGAGACAGGGATTCGAACCCTGG	NA	NA	NA	NA
>prophage 2
NZ_CP045410	Roseovarius sp. THAF8 chromosome, complete genome	4049107	1970517	1983370	4049107		Enterobacteria_phage(33.33%)	14	NA	NA
WP_152490945.1|1970517_1971396_-	ATP-binding cassette domain-containing protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	31.4	7.5e-10
WP_152496736.1|1971316_1972282_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152496737.1|1972492_1973908_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.8	5.2e-53
WP_152496738.1|1974012_1974579_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	42.9	4.4e-35
WP_152496739.1|1974575_1975625_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.4	2.3e-90
WP_152496740.1|1975716_1976583_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.8	2.9e-30
WP_152496741.1|1976637_1977504_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.3	1.2e-87
WP_172978853.1|1977556_1977700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152496742.1|1977967_1979080_-	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	31.4	2.9e-30
WP_152496743.1|1979173_1979818_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	40.1	2.6e-23
WP_152490936.1|1979923_1980454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152490935.1|1980664_1980907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172978854.1|1980926_1981631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152490934.1|1981759_1983370_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.3	2.2e-15
