The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045420	Maribius sp. THAF1 chromosome, complete genome	3249532	136143	190612	3249532	transposase,integrase	Virus_Rctr41k(28.57%)	53	149756:149776	196110:196130
WP_124109949.1|136143_137013_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.6	1.1e-26
WP_124109958.1|138630_139095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124109957.1|139283_139856_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_124109956.1|141223_141922_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_172971361.1|142542_143973_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_172971362.1|143962_144367_+	response regulator	NA	NA	NA	NA	NA
WP_124109953.1|144656_145883_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_124109952.1|146375_146972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152460894.1|148648_149406_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
149756:149776	attL	GTGGCGGAGACGAAGGGATTC	NA	NA	NA	NA
WP_124110922.1|150468_152730_-	AAA family ATPase	NA	M4QMW8	Micromonas_pusilla_virus	33.8	4.0e-39
WP_124110921.1|152817_153747_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_124110920.1|153855_154362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172971363.1|154469_154634_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_124110918.1|155060_156229_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	2.2e-36
WP_124109949.1|156576_157446_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.6	1.1e-26
WP_124111148.1|159040_159406_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_124111147.1|160770_161547_-	DsbA family protein	NA	NA	NA	NA	NA
WP_124111179.1|161546_162347_-	glutaredoxin	NA	NA	NA	NA	NA
WP_124111178.1|162513_162969_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_124111146.1|163142_163415_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_124111145.1|163421_163826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111144.1|163822_164293_-	cytochrome c	NA	NA	NA	NA	NA
WP_124111143.1|164289_164784_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_124111142.1|164876_165191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172971364.1|165258_165852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172971365.1|165913_166432_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_124111177.1|166624_167746_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_124111139.1|168427_168793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124111138.1|170590_171949_+	copper oxidase	NA	NA	NA	NA	NA
WP_124111176.1|172098_172482_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_124111137.1|172520_173000_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_172971502.1|173100_173331_+	copper-binding protein	NA	NA	NA	NA	NA
WP_124111135.1|173934_174600_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_124111175.1|174682_174952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111134.1|175101_177450_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.9	1.6e-118
WP_124111133.1|177513_178026_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_172971366.1|178016_178511_-	signal peptidase II	NA	NA	NA	NA	NA
WP_124111132.1|178515_179298_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_124111131.1|179325_179781_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_124111130.1|179784_181158_-	M23 family metallopeptidase	NA	A0A223FZJ1	Rhodococcus_phage	33.6	2.1e-06
WP_124111129.1|181154_181781_-	SCO family protein	NA	NA	NA	NA	NA
WP_124111128.1|181780_182230_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_124111127.1|182277_182937_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_124111126.1|182933_183335_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_172971367.1|183358_183955_-	SCO family protein	NA	NA	NA	NA	NA
WP_108892396.1|184140_184569_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124111172.1|184689_185277_+	cation transporter	NA	NA	NA	NA	NA
WP_124111171.1|185278_185605_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	54.1	1.4e-22
WP_124111125.1|185674_186595_+	cation transporter	NA	NA	NA	NA	NA
WP_124111124.1|186610_186973_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_124111170.1|186981_187740_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_124111123.1|187966_189454_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_172971368.1|190333_190612_+|transposase	transposase	transposase	NA	NA	NA	NA
196110:196130	attR	GTGGCGGAGACGAAGGGATTC	NA	NA	NA	NA
>prophage 2
NZ_CP045420	Maribius sp. THAF1 chromosome, complete genome	3249532	194680	232487	3249532	capsid,tRNA,protease,terminase,integrase,head,portal	uncultured_Caudovirales_phage(22.22%)	42	222798:222821	233919:233942
WP_124111120.1|194680_195964_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_124111119.1|196323_197427_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_124111118.1|197467_198391_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	27.3	4.2e-19
WP_124111117.1|198394_198877_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_124111116.1|199087_200068_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_124111115.1|200043_201594_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_124111114.1|201580_202264_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.4	8.8e-14
WP_124111113.1|202320_203133_-	cytochrome c1	NA	NA	NA	NA	NA
WP_124111112.1|203144_204488_-	cytochrome b N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_124111111.1|204500_205064_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_124111110.1|205253_205850_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_124111109.1|205971_207228_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_124111108.1|207224_208052_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_124111107.1|208251_208515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111106.1|209473_210076_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SEH9	Indivirus	30.7	1.8e-15
WP_124111105.1|210134_212399_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	28.6	2.8e-40
WP_124111104.1|212483_212915_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_124111103.1|212911_214045_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_124111102.1|214108_214432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111101.1|214521_214776_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_124111100.1|214862_215891_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_124111099.1|216050_216875_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_124111098.1|216959_217814_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	30.4	8.7e-11
WP_124111097.1|217874_218519_+	DUF4396 domain-containing protein	NA	NA	NA	NA	NA
WP_124111096.1|218522_218741_-	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_124111095.1|218826_220023_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_124111094.1|220092_220614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111168.1|220808_221777_+	asparaginase	NA	NA	NA	NA	NA
WP_124111093.1|221823_222693_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
222798:222821	attL	GGGACACCCTTCCCCAACGAAGGG	NA	NA	NA	NA
WP_124111092.1|222827_223853_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_124111091.1|224031_224535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111090.1|224587_224788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111089.1|224780_224999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111088.1|225048_225300_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172971352.1|225231_225552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111087.1|225548_227192_-	hypothetical protein	NA	L7TJL7	Rhizobium_phage	40.1	1.9e-67
WP_124111086.1|227191_228256_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_124111085.1|228257_228776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124111084.1|228766_229372_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	31.6	1.0e-05
WP_124111083.1|229371_230631_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_124111082.1|230634_230964_-	HNH endonuclease	NA	A0A2H4JAW8	uncultured_Caudovirales_phage	42.4	2.9e-07
WP_124111081.1|230954_232487_-|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	26.3	1.4e-22
233919:233942	attR	GGGACACCCTTCCCCAACGAAGGG	NA	NA	NA	NA
>prophage 3
NZ_CP045420	Maribius sp. THAF1 chromosome, complete genome	3249532	1168960	1214219	3249532	capsid,tRNA,holin,protease,tail,head,portal	Dinoroseobacter_phage(13.33%)	48	NA	NA
WP_124112635.1|1168960_1169446_+|holin	holin family protein	holin	NA	NA	NA	NA
WP_124112636.1|1169435_1169618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124112637.1|1169754_1170168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124112638.1|1170215_1172186_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_124112639.1|1172182_1172632_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_124112640.1|1172757_1173534_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_124112641.1|1173530_1174307_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_124112642.1|1174424_1175525_+	alkene reductase	NA	NA	NA	NA	NA
WP_124112643.1|1175582_1176881_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_124112644.1|1176937_1178377_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_124112904.1|1178459_1180505_+	ComEC family competence protein	NA	NA	NA	NA	NA
WP_124112645.1|1180501_1181197_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	30.5	1.3e-09
WP_124112646.1|1181263_1182430_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_124112647.1|1182426_1182903_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_124112648.1|1182899_1183694_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.8	8.8e-58
WP_124112649.1|1183694_1184936_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	38.2	5.2e-65
WP_124112650.1|1185001_1186126_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_124112651.1|1186219_1186699_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_124112652.1|1186989_1188330_+	trigger factor	NA	NA	NA	NA	NA
WP_124112653.1|1188435_1189323_-	lytic transglycosylase domain-containing protein	NA	E5RV25	Ralstonia_phage	39.7	1.7e-09
WP_124112654.1|1189364_1190513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124112905.1|1190778_1191435_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005608650.1|1191453_1191681_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_124112655.1|1191693_1192050_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_124112656.1|1192300_1192870_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_124112657.1|1192917_1193331_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_124112658.1|1193377_1194550_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_124112659.1|1194688_1195627_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_124112660.1|1195629_1196367_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_124112661.1|1196541_1196781_+	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	56.8	1.2e-05
WP_124112662.1|1196840_1197683_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_124112663.1|1197811_1199068_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_124112664.1|1199069_1200251_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_172971506.1|1200827_1202081_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.1	2.4e-73
WP_124112665.1|1202177_1203347_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	39.3	2.5e-61
WP_124112666.1|1203336_1203861_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	52.0	2.6e-34
WP_124112667.1|1203894_1205079_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	39.8	6.3e-68
WP_172971409.1|1205220_1205805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124112669.1|1205818_1206154_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_124112670.1|1206150_1206564_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_124112671.1|1206578_1206998_+|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	32.8	2.7e-05
WP_124112672.1|1207003_1207309_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_124112673.1|1207305_1207503_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_124112674.1|1207516_1208170_+|tail	phage tail tape measure protein	tail	A0A1B2AQ26	Escherichia_phage	29.0	4.7e-09
WP_124112675.1|1208195_1208831_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	45.9	2.7e-49
WP_124112676.1|1208908_1209727_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	37.5	4.4e-44
WP_124112677.1|1209723_1210164_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	49.3	9.6e-30
WP_124112678.1|1210235_1214219_+|tail	glycoside hydrolase/phage tail family protein	tail	F4YXU5	Roseobacter_phage	36.5	2.1e-208
