The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	521391	556598	4217124	protease,transposase	Gordonia_phage(33.33%)	32	NA	NA
WP_017697004.1|521391_521991_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014475874.1|522085_522451_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_072557167.1|522616_523633_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_017697002.1|523746_524916_+	alanine racemase	NA	NA	NA	NA	NA
WP_003225183.1|525031_525313_+	type II toxin-antitoxin system antitoxin EndoAI	NA	NA	NA	NA	NA
WP_003156187.1|525317_525668_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
WP_009966610.1|525782_526607_+	RsbT co-antagonist protein RsbRA	NA	NA	NA	NA	NA
WP_003225190.1|526611_526977_+	RsbT antagonist protein RsbS	NA	NA	NA	NA	NA
WP_017697001.1|526980_527382_+	serine/threonine-protein kinase RsbT	NA	NA	NA	NA	NA
WP_003234295.1|527393_528401_+	phosphoserine phosphatase RsbU	NA	NA	NA	NA	NA
WP_017697000.1|528462_528792_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003234299.1|528788_529271_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_003246715.1|529236_530025_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
WP_017696999.1|530024_530624_+	phosphoserine phosphatase RsbX	NA	NA	NA	NA	NA
WP_152425360.1|530730_532890_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003225207.1|532899_533013_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_152425361.1|533116_533569_+	SprT family protein	NA	NA	NA	NA	NA
WP_152425362.1|534628_535192_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152425363.1|535383_535902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|536314_537562_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_017696995.1|537736_538189_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_152425364.1|540113_540587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003240464.1|541376_541610_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129093252.1|541606_541960_+	DUF2178 domain-containing protein	NA	NA	NA	NA	NA
WP_003234247.1|543940_544141_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
WP_152425365.1|546197_547073_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152425366.1|547185_548145_+	EamA family transporter	NA	NA	NA	NA	NA
WP_152425367.1|548319_549852_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479904.1|551572_551890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033880480.1|551886_552801_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_128473644.1|554999_555446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033880480.1|555683_556598_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
>prophage 2
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	685526	693892	4217124		Synechococcus_phage(50.0%)	8	NA	NA
WP_017695640.1|685526_686822_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	4.5e-19
WP_017695639.1|686895_687621_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
WP_003219409.1|687613_687868_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014663062.1|687864_688548_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_041333576.1|688531_690760_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.3	1.7e-159
WP_003233947.1|690735_692166_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_017695637.1|692267_693308_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|693304_693892_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 3
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	1185998	1229976	4217124	tRNA,coat	Planktothrix_phage(50.0%)	50	NA	NA
WP_080333447.1|1185998_1186235_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1186399_1187338_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1187360_1188602_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_033883592.1|1188677_1189463_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_014663522.1|1189654_1190641_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	9.7e-22
WP_014476428.1|1190637_1191627_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	G9BWD6	Planktothrix_phage	28.7	2.5e-17
WP_015252363.1|1191714_1193343_+	Oligopeptide-binding protein AppA precursor	NA	NA	NA	NA	NA
WP_015252362.1|1193417_1194368_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015383348.1|1194383_1195298_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003239298.1|1195504_1196257_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1196291_1197284_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021479550.1|1198027_1199665_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_014479444.1|1199771_1200707_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1200710_1201628_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_015252358.1|1201632_1202709_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1202710_1203628_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-23
WP_152425670.1|1203734_1204952_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|1205116_1205695_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|1205875_1206271_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1206525_1207182_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|1207351_1207492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232942.1|1207458_1208115_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|1208109_1208232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695683.1|1208275_1209427_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_017695684.1|1209473_1211486_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1211523_1211691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967012.1|1211786_1211990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041340381.1|1212004_1212904_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1212900_1213299_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_080031064.1|1213550_1214096_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	61.0	4.8e-39
WP_015252351.1|1214299_1214872_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003232922.1|1214996_1215365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1215393_1216029_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1216047_1216848_+	NAD kinase	NA	NA	NA	NA	NA
WP_080031065.1|1216910_1217762_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_129093318.1|1217774_1218509_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	24.6	1.9e-06
WP_017695687.1|1218743_1220588_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017695688.1|1220836_1221547_+	thiaminase II	NA	NA	NA	NA	NA
WP_129093319.1|1221521_1222139_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_029726273.1|1222122_1223232_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_080031066.1|1223231_1223432_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010886483.1|1223428_1224199_+	thiazole synthase	NA	NA	NA	NA	NA
WP_017695692.1|1224195_1225206_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_015252343.1|1225224_1226040_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1226175_1226952_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_080265338.1|1227052_1227736_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_003244982.1|1227828_1228275_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_003239243.1|1228402_1228891_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_129093320.1|1229042_1229561_-|coat	spore coat protein CotX	coat	NA	NA	NA	NA
WP_024572403.1|1229661_1229976_-|coat	spore coat protein CotW	coat	NA	NA	NA	NA
>prophage 4
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	1262508	1330964	4217124	coat,terminase,plate,portal,holin	Bacillus_phage(28.57%)	75	NA	NA
WP_015715704.1|1262508_1262757_-|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_152425426.1|1263010_1264468_+	peptidoglycan-N-acetylmuramic acid deacetylase PdaC	NA	NA	NA	NA	NA
WP_041056097.1|1265766_1266240_-	YjfA family protein	NA	NA	NA	NA	NA
WP_041056095.1|1266367_1266535_-	putative motility protein	NA	NA	NA	NA	NA
WP_009967034.1|1267570_1267969_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_041056093.1|1268069_1268645_-	YjgB family protein	NA	NA	NA	NA	NA
WP_015715709.1|1271740_1272301_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_041056092.1|1272499_1273144_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_080333378.1|1273218_1273845_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_041056090.1|1273875_1274154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041056089.1|1274542_1275733_+	monooxygenase YjiB	NA	NA	NA	NA	NA
WP_041056088.1|1275755_1276934_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	5.6e-08
WP_017697300.1|1276974_1277163_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	7.7e-21
WP_041056087.1|1277336_1278152_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_017697302.1|1278196_1278949_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_017697303.1|1278948_1279701_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	1.4e-17
WP_041056085.1|1279820_1280795_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_017697305.1|1280926_1281424_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014663610.1|1281812_1282235_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003232765.1|1282274_1283453_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041056084.1|1283650_1285072_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_041056083.1|1285139_1286519_+	MFS transporter	NA	NA	NA	NA	NA
WP_041056082.1|1286623_1287637_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_041056081.1|1287642_1288662_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_017697310.1|1288686_1289766_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_017697311.1|1289762_1290599_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
WP_017697312.1|1290646_1291915_+	MFS transporter	NA	NA	NA	NA	NA
WP_017697313.1|1292002_1293004_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_017697314.1|1293077_1294520_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_017697315.1|1294516_1296010_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_017697316.1|1296048_1296813_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017697317.1|1297037_1297502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080333377.1|1299067_1300204_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	46.8	4.1e-93
WP_003245487.1|1300193_1300328_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_017695145.1|1300357_1300615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695144.1|1300735_1301689_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.5	1.6e-66
WP_014476529.1|1301728_1302106_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
WP_041056078.1|1302211_1302814_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	4.2e-44
WP_015715727.1|1303373_1303970_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_017695142.1|1304132_1304474_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	4.5e-19
WP_015715728.1|1304652_1304832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1304818_1305655_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_015252287.1|1305554_1306355_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
WP_003245588.1|1306354_1306522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695140.1|1306606_1306957_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003244900.1|1306953_1307160_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
WP_017695139.1|1307275_1307785_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.1e-21
WP_017695138.1|1307901_1308699_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.5	1.9e-60
WP_017695137.1|1308695_1309997_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.7	4.8e-154
WP_152425427.1|1310000_1311488_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.9	4.5e-140
WP_017695135.1|1311507_1312335_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.7	3.6e-54
WP_017695134.1|1312360_1313296_+	hypothetical protein	NA	A0A1B1P7E3	Bacillus_phage	63.4	3.3e-104
WP_017695133.1|1313317_1313701_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	1.1e-13
WP_017695132.1|1313697_1314054_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_017695131.1|1314050_1314536_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.4	1.8e-37
WP_041056075.1|1314548_1314989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1314992_1315211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695129.1|1315207_1316608_+|portal	phage portal protein	portal	A0A0A7S087	Clostridium_phage	39.3	1.8e-77
WP_003232677.1|1316609_1317053_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003239113.1|1317612_1317762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080333376.1|1317763_1321750_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	4.4e-41
WP_017695127.1|1321742_1322402_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.7	2.1e-25
WP_003245730.1|1322417_1323395_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|1323394_1323661_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_152425428.1|1323717_1324143_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	40.9	3.2e-14
WP_017695123.1|1324135_1325182_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	1.7e-72
WP_017695122.1|1325165_1325744_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.4	8.2e-13
WP_152425429.1|1325740_1326013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695121.1|1326015_1328073_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	35.7	4.1e-30
WP_017695120.1|1328086_1328416_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_015252267.1|1328412_1328577_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	5.5e-15
WP_017695119.1|1328620_1329460_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232655.1|1329512_1329782_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_017695118.1|1329794_1330058_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	4.0e-23
WP_014479567.1|1330070_1330964_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
>prophage 5
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	1764276	1826200	4217124	tRNA,protease,transposase,coat	Bacillus_phage(58.82%)	60	NA	NA
WP_003231833.1|1764276_1764822_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_041057500.1|1764954_1767531_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.5	7.1e-40
WP_017694904.1|1767546_1769430_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	1.0e-67
WP_026113607.1|1769759_1770215_-	membrane protein	NA	NA	NA	NA	NA
WP_017694906.1|1770369_1770927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694907.1|1771047_1771662_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231786.1|1771800_1772157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694908.1|1772235_1773060_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041057503.1|1773171_1774500_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.9	1.2e-27
WP_014476869.1|1774724_1774958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479835.1|1775237_1775945_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_014479836.1|1776014_1776467_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014479837.1|1776480_1776834_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1776847_1777165_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_014479838.1|1777299_1777578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592536.1|1777666_1778080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152425442.1|1778179_1779124_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1779163_1779385_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|1779580_1779853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1779934_1780165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1780407_1780800_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1780759_1782862_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1782879_1783869_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_017694913.1|1783918_1784539_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	1.0e-45
WP_017694914.1|1784602_1785370_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	5.3e-52
WP_041057514.1|1785987_1786956_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.2	4.4e-51
WP_015483254.1|1787088_1788351_+	GTPase HflX	NA	NA	NA	NA	NA
WP_017694916.1|1788368_1789634_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1789743_1790151_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_017694917.1|1790209_1791544_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_095010668.1|1791653_1791779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015483256.1|1791817_1792117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697662.1|1792170_1792479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697663.1|1792499_1794383_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	5.2e-125
WP_017697664.1|1794631_1794811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479885.1|1796002_1796494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479887.1|1797824_1798076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592598.1|1798259_1798694_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014479904.1|1800555_1800873_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033880480.1|1800869_1801784_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_017697685.1|1802162_1802543_+	membrane protein	NA	NA	NA	NA	NA
WP_017697687.1|1803085_1803316_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	73.5	4.0e-19
WP_152425443.1|1803312_1803966_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_003245467.1|1804762_1804927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017697690.1|1805066_1805537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017697653.1|1807779_1809171_+	MFS transporter	NA	NA	NA	NA	NA
WP_017697654.1|1809201_1810803_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_017697655.1|1810940_1812095_-	ROK family protein	NA	NA	NA	NA	NA
WP_017697656.1|1812342_1813680_+	xylose isomerase	NA	NA	NA	NA	NA
WP_017697657.1|1813830_1815330_+	xylulokinase	NA	NA	NA	NA	NA
WP_152425444.1|1815741_1816891_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_017697666.1|1817103_1817739_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.1	5.0e-72
WP_026113747.1|1818151_1819567_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003244881.1|1819668_1820853_-	alanine racemase	NA	NA	NA	NA	NA
WP_017697668.1|1821316_1821778_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_003245820.1|1821807_1822242_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.0e-72
WP_041345016.1|1823258_1824098_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	97.8	2.8e-163
WP_119123060.1|1824185_1824473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697367.1|1825397_1825754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231636.1|1825999_1826200_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
>prophage 6
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	1846083	1886061	4217124	integrase,coat,transposase	Bacillus_phage(33.33%)	37	1846983:1846997	1870302:1870316
WP_087614160.1|1846083_1847233_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
1846983:1846997	attL	CAGAAAGCTGTTAAA	NA	NA	NA	NA
WP_017696519.1|1847292_1847721_-	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_015251997.1|1847954_1848347_-|coat	outer spore coat protein CotM	coat	NA	NA	NA	NA
WP_003221237.1|1848427_1848574_-	small acid-soluble spore protein P	NA	NA	NA	NA	NA
WP_003244839.1|1848604_1848751_-	acid-soluble spore protein SspO	NA	NA	NA	NA	NA
WP_003245728.1|1848978_1851708_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003244797.1|1851779_1852292_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003244964.1|1852373_1852499_+	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_003231569.1|1852563_1852710_+	acid-soluble spore protein SspN	NA	NA	NA	NA	NA
WP_003231568.1|1852746_1852998_+	small acid-soluble spore protein Tlp	NA	NA	NA	NA	NA
WP_003231566.1|1853082_1853499_+	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_029726676.1|1853514_1853814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231562.1|1853844_1854132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231560.1|1854219_1854801_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003245606.1|1854970_1855378_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_041055545.1|1855777_1857745_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.2	5.1e-123
WP_041055542.1|1857748_1860169_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.5	3.7e-99
WP_041055539.1|1860366_1860720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696509.1|1861230_1862628_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_017696508.1|1862925_1864428_+	endo-1,4-beta-glucanase EglS	NA	NA	NA	NA	NA
WP_003231535.1|1864494_1864758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152425446.1|1865025_1866537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146260835.1|1866537_1867539_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_152425447.1|1867550_1869494_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_061576697.1|1869495_1870140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880480.1|1870967_1871882_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
1870302:1870316	attR	CAGAAAGCTGTTAAA	NA	NA	NA	NA
WP_014479904.1|1871878_1872196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061576699.1|1872403_1873252_-	hypothetical protein	NA	Q9AYX4	Lactococcus_phage	40.1	2.4e-29
WP_146260838.1|1873387_1873897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425448.1|1875245_1876679_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	38.6	1.1e-13
WP_146260839.1|1878137_1878851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146260840.1|1879000_1880614_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_152425449.1|1880932_1882351_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.3e-35
WP_152425450.1|1882347_1883052_-	response regulator	NA	W8CYM9	Bacillus_phage	37.9	2.0e-37
WP_146260843.1|1883233_1883812_-	DUF1541 domain-containing protein	NA	NA	NA	NA	NA
WP_146260844.1|1884116_1884443_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_031600262.1|1884813_1886061_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 7
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2047870	2061163	4217124	transposase	Bacillus_phage(90.0%)	12	NA	NA
WP_003231154.1|2047870_2048623_+	hypothetical protein	NA	A0A1P8CX59	Bacillus_phage	97.2	1.3e-143
WP_109962767.1|2051304_2051637_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	100.0	1.3e-55
WP_041054825.1|2051810_2052146_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	100.0	4.2e-54
WP_041338710.1|2052189_2052549_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	100.0	3.5e-62
WP_080316884.1|2053343_2053820_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	65.8	5.1e-61
WP_041056186.1|2053920_2054409_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_041056183.1|2054415_2056326_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	91.7	1.4e-215
WP_052470570.1|2056425_2056941_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	94.0	3.9e-91
WP_152425456.1|2057140_2057296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041056256.1|2057474_2057990_-	hypothetical protein	NA	O64017	Bacillus_phage	99.4	7.6e-95
WP_031600262.1|2058360_2059608_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_152425457.1|2059609_2061163_-	recombinase family protein	NA	A0A1P8CWN4	Bacillus_phage	98.6	3.6e-273
>prophage 8
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2077287	2161629	4217124	integrase,transposase	Bacillus_phage(93.88%)	120	2102805:2102864	2133099:2133220
WP_041054622.1|2077287_2077503_-	hypothetical protein	NA	U5PU52	Bacillus_phage	63.8	1.1e-18
WP_041054624.1|2077694_2077958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425463.1|2078125_2078674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425464.1|2078654_2079080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114523501.1|2079221_2079401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425465.1|2079582_2080410_-	hypothetical protein	NA	O64184	Bacillus_phage	97.1	5.6e-164
WP_009967454.1|2080531_2080750_+	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	100.0	5.6e-31
WP_033884587.1|2080857_2081142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425466.1|2081184_2081364_-	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	79.6	1.7e-14
WP_152425467.1|2081360_2082107_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	61.8	1.3e-71
WP_017697112.1|2082119_2082473_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	98.3	8.1e-56
WP_152425468.1|2082745_2083585_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_151262256.1|2083641_2083986_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	98.2	6.7e-55
WP_041056446.1|2084099_2084315_-	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	95.8	1.0e-32
WP_121591866.1|2084314_2084605_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	93.5	6.1e-41
WP_121591865.1|2084609_2084777_-	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	83.6	2.3e-21
WP_033880480.1|2085001_2085916_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_014479904.1|2085912_2086230_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017697107.1|2086337_2086520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121591864.1|2086607_2087036_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	8.9e-73
WP_152425469.1|2087081_2087324_-	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	96.2	3.4e-37
WP_152425470.1|2088700_2089213_-	hypothetical protein	NA	Q7Y5F9	Xanthomonas_virus	48.8	2.3e-11
WP_128992191.1|2090855_2091533_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	87.1	3.3e-106
WP_019712230.1|2091540_2091936_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	93.1	2.6e-63
WP_019712231.1|2091935_2092289_-	hypothetical protein	NA	O64171	Bacillus_phage	98.3	2.7e-59
WP_017697100.1|2092612_2093083_-	hypothetical protein	NA	O64167	Bacillus_phage	98.7	8.8e-82
WP_114168548.1|2093099_2093312_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.2	2.3e-29
WP_152425471.1|2093333_2093696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100244384.1|2093807_2094527_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	59.7	3.6e-74
WP_041056316.1|2094733_2094859_-	hypothetical protein	NA	O64165	Bacillus_phage	80.5	5.3e-10
WP_152425472.1|2094872_2095220_-	hypothetical protein	NA	O64164	Bacillus_phage	93.0	6.3e-53
WP_041336502.1|2095234_2095642_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	60.4	2.2e-33
WP_152425473.1|2095684_2095864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425474.1|2096161_2096353_-	hypothetical protein	NA	A0A1P8CX22	Bacillus_phage	96.8	4.1e-30
WP_152425671.1|2096429_2096612_-	hypothetical protein	NA	O64158	Bacillus_phage	91.7	3.2e-24
WP_152425475.1|2096624_2096852_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	97.3	3.0e-35
WP_114523513.1|2096891_2097257_-	hypothetical protein	NA	O64156	Bacillus_phage	96.7	1.7e-61
WP_094246812.1|2097513_2097783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041352029.1|2097815_2098334_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	94.2	7.9e-92
WP_152425476.1|2098342_2098840_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	93.9	9.9e-84
WP_010331040.1|2098839_2098995_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	96.1	3.3e-22
WP_064814903.1|2098987_2099203_-	hypothetical protein	NA	O64150	Bacillus_phage	97.2	3.9e-37
WP_152425477.1|2099250_2099559_-	hypothetical protein	NA	A0A2D1GQC1	Lysinibacillus_phage	40.2	1.5e-10
WP_152425478.1|2099572_2099851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425479.1|2099956_2100607_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	49.0	2.7e-20
WP_152425480.1|2100681_2104599_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	99.2	0.0e+00
2102805:2102864	attL	ACTTTGTATATTCATCGTTAAAGATAATTACTCCGGCTGCATGAGAAGAGCGCTTATTAG	NA	NA	NA	NA
WP_152425481.1|2104611_2106342_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	99.3	0.0e+00
WP_041338492.1|2106341_2107478_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	98.7	5.6e-223
WP_152425482.1|2107493_2109011_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	72.5	2.4e-213
WP_152425483.1|2109025_2109496_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	46.8	4.6e-38
WP_152425484.1|2109537_2110509_-	AAA family ATPase	NA	A0A1P8CX29	Bacillus_phage	94.4	1.3e-172
WP_152425485.1|2110587_2111502_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	91.1	1.9e-157
WP_041338755.1|2111520_2111889_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	99.2	5.5e-63
WP_086352525.1|2112941_2113322_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	98.4	1.1e-66
WP_086352526.1|2113393_2113687_-	hypothetical protein	NA	O64136	Bacillus_phage	83.3	5.7e-39
WP_017697067.1|2113878_2114274_-	hypothetical protein	NA	O64133	Bacillus_phage	94.7	7.9e-68
WP_152425486.1|2114333_2115038_-	HNH endonuclease	NA	O64121	Bacillus_phage	40.5	2.2e-28
WP_152425487.1|2115040_2115259_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	100.0	2.4e-34
WP_072692918.1|2115329_2116004_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	98.6	5.9e-79
WP_072692919.1|2116073_2116886_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	93.3	1.8e-146
WP_014470183.1|2117672_2117918_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	91.5	6.7e-33
WP_032721727.1|2118037_2118190_+	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	80.0	2.7e-16
WP_041352063.1|2118272_2118623_-	hypothetical protein	NA	O64127	Bacillus_phage	86.2	1.4e-52
WP_087961574.1|2118624_2118981_-	hypothetical protein	NA	O64126	Bacillus_phage	94.9	3.3e-49
WP_087961573.1|2118973_2119282_-	hypothetical protein	NA	O64125	Bacillus_phage	96.0	2.4e-51
WP_087961570.1|2120266_2120482_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	73.2	5.5e-23
WP_152425488.1|2120661_2120910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041054516.1|2121142_2121781_-	DUF3920 family protein	NA	NA	NA	NA	NA
WP_026113712.1|2121816_2122074_-	hypothetical protein	NA	O64116	Bacillus_phage	92.9	3.5e-40
WP_017697053.1|2122106_2122904_-	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	54.6	8.2e-72
WP_152425672.1|2122954_2123383_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	90.3	4.7e-66
WP_041054512.1|2123385_2123778_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	44.3	4.2e-21
WP_152425489.1|2123774_2124056_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	57.8	1.4e-21
WP_016075790.1|2124071_2124260_-	hypothetical protein	NA	M4ZS01	Bacillus_phage	100.0	9.7e-32
WP_152425490.1|2124256_2124541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425491.1|2124540_2124972_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	98.6	3.7e-79
WP_033880506.1|2124968_2125169_-	hypothetical protein	NA	M4ZRU5	Bacillus_phage	87.5	8.4e-26
WP_041338559.1|2125282_2125522_-	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	98.7	9.7e-37
WP_041338562.1|2125639_2125879_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	98.7	1.7e-36
WP_086352552.1|2125951_2126251_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	100.0	1.5e-47
WP_041338568.1|2126465_2126687_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	100.0	1.1e-34
WP_071581180.1|2126917_2127889_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	98.5	1.6e-178
WP_152425492.1|2127907_2129254_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	99.8	2.2e-250
WP_086352550.1|2129338_2130400_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	98.9	3.6e-200
WP_061187761.1|2130605_2130851_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	100.0	3.9e-41
WP_086352548.1|2130867_2131074_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	97.1	9.0e-31
WP_134982144.1|2131512_2131644_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_086352547.1|2131674_2132826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425673.1|2133037_2133160_+	hypothetical protein	NA	A0A1P8CX14	Bacillus_phage	97.5	1.5e-14
WP_120363393.1|2133337_2133469_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	95.3	5.5e-18
2133099:2133220	attR	CTAATAAGCGCTCTTCTCATGCAGCCGGAGTAATTATCTTTAACGATGAATATACAAAGTGATGGATATTTTTCTTGTAGTATTGGGAATGTAAGCAAAGAGATTATTCAAAAATATATTCA	NA	NA	NA	NA
WP_152425493.1|2133500_2135750_-	DNA translocase FtsK	NA	U5PXY9	Bacillus_phage	97.6	0.0e+00
WP_152425494.1|2135869_2136940_-	hypothetical protein	NA	A0A2I6UHR1	Bacillus_phage	97.2	8.4e-197
WP_152425495.1|2136993_2137545_-	hypothetical protein	NA	A0A2I6UHQ9	Bacillus_phage	98.4	4.8e-87
WP_017696845.1|2137558_2137759_-	hypothetical protein	NA	S6BV38	Bacillus_phage	98.5	3.7e-29
WP_052470547.1|2137925_2138486_-	M23 family metallopeptidase	NA	S6B1Q4	Bacillus_phage	96.2	4.0e-97
WP_017696847.1|2138614_2138923_-	hypothetical protein	NA	U5PXY3	Bacillus_phage	94.1	3.5e-47
WP_051053181.1|2138903_2140004_-	ParM/StbA family protein	NA	U5PUH1	Bacillus_phage	98.1	3.1e-202
WP_017696849.1|2140172_2140592_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017696850.1|2140869_2141334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696852.1|2141564_2141855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696853.1|2141874_2142075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086352602.1|2142071_2142320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041352096.1|2142365_2144162_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.5	0.0e+00
WP_041054495.1|2144163_2144766_-	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	99.0	2.5e-105
WP_152425496.1|2144767_2145685_-	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	91.9	3.4e-146
WP_152425497.1|2145690_2146545_-	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	96.1	7.1e-146
WP_121572580.1|2146904_2148122_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	100.0	2.9e-233
WP_152425498.1|2148209_2148368_-	hypothetical protein	NA	A0A1P8CWU3	Bacillus_phage	67.3	8.7e-10
WP_152425499.1|2148412_2148628_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	6.1e-30
WP_134982316.1|2149792_2150293_-	hypothetical protein	NA	A0A1P8CWU7	Bacillus_phage	96.8	1.9e-66
WP_041338634.1|2150659_2150839_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	98.3	1.2e-26
WP_041054484.1|2150883_2152761_+	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	99.8	0.0e+00
WP_003230983.1|2153176_2153791_+	hypothetical protein	NA	A0A1P8CWS4	Bacillus_phage	99.0	2.2e-112
WP_152425500.1|2154053_2154329_+	DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	83.5	2.9e-32
WP_010328101.1|2156259_2156451_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
WP_041054480.1|2156463_2157681_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	99.5	5.6e-229
WP_152425501.1|2157917_2158247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114523550.1|2158284_2158785_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	97.6	2.2e-86
WP_114523551.1|2158888_2159881_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.0	1.5e-06
WP_032721637.1|2159880_2161629_+	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.2	2.4e-63
>prophage 9
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2166919	2178677	4217124	integrase	Bacillus_phage(85.71%)	19	2170737:2170751	2181968:2181982
WP_114523554.1|2166919_2167582_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	78.3	7.1e-69
WP_017696880.1|2167578_2168085_+	hypothetical protein	NA	O64060	Bacillus_phage	85.1	9.8e-79
WP_041351132.1|2168081_2168810_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	43.4	1.6e-45
WP_152425503.1|2168845_2169640_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	39.6	5.6e-20
WP_080317092.1|2169657_2170269_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	97.0	1.1e-63
WP_009967521.1|2170268_2170496_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_152425504.1|2170559_2170916_+	hypothetical protein	NA	O64055	Bacillus_phage	86.4	7.9e-51
2170737:2170751	attL	GATGAAAATGGTGAA	NA	NA	NA	NA
WP_152425505.1|2170915_2172247_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	42.3	2.5e-20
WP_014470096.1|2172260_2172536_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	1.2e-09
WP_014470095.1|2172536_2172689_+	XkdX family protein	NA	NA	NA	NA	NA
WP_152425506.1|2172707_2173556_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_102421754.1|2173638_2174124_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	63.9	4.7e-54
WP_152425507.1|2174123_2174540_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	71.7	5.1e-49
WP_152425508.1|2174553_2175555_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWP6	Bacillus_phage	98.2	1.1e-190
WP_152425509.1|2175710_2176211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470088.1|2176207_2177260_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
WP_014470087.1|2177288_2177471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152425510.1|2177564_2177978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696891.1|2178050_2178677_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	32.5	5.9e-17
2181968:2181982	attR	GATGAAAATGGTGAA	NA	NA	NA	NA
>prophage 10
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2186405	2196519	4217124	holin	Bacillus_phage(100.0%)	10	NA	NA
WP_152425511.1|2186405_2189033_+	hypothetical protein	NA	O64044	Bacillus_phage	97.7	0.0e+00
WP_152425674.1|2189047_2189869_+	hypothetical protein	NA	O64043	Bacillus_phage	80.2	4.6e-118
WP_152425512.1|2189911_2192467_+	hypothetical protein	NA	D6R401	Bacillus_phage	33.4	2.9e-110
WP_152425513.1|2192639_2193680_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1P8CWN6	Bacillus_phage	59.6	1.9e-76
WP_010328137.1|2193795_2194188_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	99.2	2.9e-62
WP_017696899.1|2194209_2194461_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	97.6	2.1e-37
WP_152425514.1|2194426_2194615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041338702.1|2194615_2195731_+	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.5	8.8e-96
WP_004399440.1|2195727_2195850_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_152425515.1|2195904_2196519_-	DNA polymerase	NA	A0A1P8CWP4	Bacillus_phage	97.8	3.3e-97
>prophage 11
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2341514	2347610	4217124		Staphylococcus_phage(66.67%)	8	NA	NA
WP_041053267.1|2341514_2342108_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	1.2e-14
WP_015714192.1|2342097_2342853_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.4e-09
WP_041053269.1|2343133_2343658_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2343671_2344046_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_041053270.1|2344158_2344623_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.6e-43
WP_003230496.1|2344655_2345852_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	5.3e-115
WP_004398505.1|2345866_2346514_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_017695915.1|2346524_2347610_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	4.6e-57
>prophage 12
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2584888	2646062	4217124	transposase,terminase,portal,tail,holin,capsid	uncultured_Caudovirales_phage(27.27%)	74	NA	NA
WP_031600262.1|2584888_2586136_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_003229947.1|2586235_2586598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399085.1|2586613_2587093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425526.1|2587257_2588076_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.2	1.1e-63
WP_003246208.1|2588120_2588543_-|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_103750556.1|2588589_2589483_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_152425527.1|2589569_2589734_-	XkdX family protein	NA	NA	NA	NA	NA
WP_072182662.1|2589730_2590066_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_152425528.1|2590075_2591176_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_003229942.1|2591178_2591451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095432548.1|2591447_2592026_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	2.8e-13
WP_152425529.1|2592009_2593056_-|portal	phage portal protein	portal	S6AVU3	Thermus_phage	44.0	1.2e-73
WP_103750552.1|2593048_2593474_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	35.6	7.3e-11
WP_024122153.1|2593486_2593753_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_152425530.1|2593749_2594730_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.9	2.4e-41
WP_152425531.1|2594742_2595402_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.2	4.8e-25
WP_152425532.1|2595394_2600152_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.8	1.9e-43
WP_095252404.1|2600333_2600783_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	40.2	5.9e-11
WP_106610765.1|2600939_2601026_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_019715091.1|2601352_2601796_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_152425533.1|2601798_2603199_-|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	38.6	1.2e-73
WP_152425534.1|2603199_2603391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425535.1|2603387_2603825_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_152425536.1|2603837_2604341_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.3	1.4e-37
WP_152425537.1|2604337_2604697_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_017697475.1|2604693_2605089_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_152425538.1|2605093_2605405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425539.1|2605415_2606351_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.4	6.6e-105
WP_043856839.1|2606369_2607344_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	56.2	9.1e-57
WP_152425540.1|2607349_2608228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425541.1|2608272_2609190_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.4	6.8e-54
WP_152425542.1|2609186_2610719_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.7	2.7e-148
WP_152425543.1|2610722_2612018_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.6	1.0e-156
WP_103030691.1|2612010_2612805_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	57.7	3.0e-66
WP_059352316.1|2612865_2613729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425544.1|2613997_2614789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059352314.1|2614930_2615386_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	73.5	3.5e-59
WP_059352313.1|2615480_2616185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059352312.1|2616261_2616810_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_059352311.1|2616915_2617122_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	73.1	1.4e-20
WP_032725202.1|2617206_2617635_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	2.8e-42
WP_083510055.1|2617729_2617879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083510054.1|2617869_2618811_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	4.0e-57
WP_116758330.1|2618692_2619370_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.5e-05
WP_059352309.1|2619446_2620301_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	74.8	4.6e-113
WP_059352308.1|2620303_2621263_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.9	9.7e-136
WP_041055602.1|2621368_2621563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125825444.1|2621522_2621696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722183.1|2621692_2621950_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	4.9e-10
WP_015714341.1|2621946_2622516_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_032725213.1|2622589_2622730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722187.1|2622732_2622972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021480133.1|2623127_2623481_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	48.6	8.0e-11
WP_032725216.1|2623722_2624079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103030695.1|2624151_2624550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714342.1|2624693_2625212_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015714344.1|2627557_2628238_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017697647.1|2630195_2631293_-	mannan endo-1,4-beta-mannosidase	NA	NA	NA	NA	NA
WP_017697646.1|2632063_2632843_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017697645.1|2632902_2633130_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_017697644.1|2633163_2634291_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017697642.1|2634633_2635191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015251635.1|2635376_2635859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237170.1|2635995_2636256_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_152425545.1|2636954_2638307_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.6	3.4e-86
WP_017697681.1|2638571_2639132_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	56.9	4.0e-57
WP_033880545.1|2639149_2639362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722385.1|2639358_2639502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425546.1|2639675_2640497_-	multidrug efflux transcriptional regulator BltR	NA	NA	NA	NA	NA
WP_017697683.1|2641984_2642443_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
WP_017697706.1|2642601_2643906_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017697705.1|2644169_2644313_-	YrzO family protein	NA	NA	NA	NA	NA
WP_014479904.1|2644833_2645151_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033880480.1|2645147_2646062_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
>prophage 13
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	2649845	2684431	4217124	protease,coat,transposase	Gordonia_phage(25.0%)	37	NA	NA
WP_033880480.1|2649845_2650760_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_014479904.1|2650756_2651074_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017697604.1|2651625_2652573_-	CDF family zinc transporter CzcD	NA	NA	NA	NA	NA
WP_003245988.1|2654736_2655069_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_017697605.1|2655065_2655830_-	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_017697606.1|2656640_2656916_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_017697607.1|2657173_2658406_-	cytochrome P450	NA	NA	NA	NA	NA
WP_017697608.1|2658455_2658860_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015251614.1|2659092_2659656_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_010886579.1|2659884_2660256_-	YrdB family protein	NA	NA	NA	NA	NA
WP_015251612.1|2661068_2661572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|2661684_2662932_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_041053663.1|2663175_2664030_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.2	2.2e-94
WP_015714372.1|2664422_2665466_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_072557202.1|2665662_2665857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026113666.1|2665798_2666596_+	glutamate racemase	NA	NA	NA	NA	NA
WP_017696046.1|2666976_2667684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072175780.1|2668260_2668338_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003245984.1|2668624_2668786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714387.1|2669436_2669967_-	RNA polymerase sigma factor SigZ	NA	NA	NA	NA	NA
WP_017696048.1|2670102_2671083_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003246029.1|2671358_2672675_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_015251604.1|2672789_2673659_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017696050.1|2673803_2674907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696051.1|2675731_2675983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696052.1|2676119_2676935_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004398671.1|2677342_2677699_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004399021.1|2677751_2678111_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_121517030.1|2678382_2678484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696053.1|2678623_2679010_-	VOC family protein	NA	NA	NA	NA	NA
WP_014477469.1|2679283_2679529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026113667.1|2679546_2679882_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003229843.1|2679933_2681070_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	2.2e-14
WP_014480384.1|2681088_2681286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696054.1|2681301_2681601_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_004398725.1|2681831_2682254_-	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_003229836.1|2683921_2684431_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
>prophage 14
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	3069742	3100547	4217124	holin,coat,transposase	Staphylococcus_phage(25.0%)	33	NA	NA
WP_014477741.1|3069742_3070147_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|3070312_3070750_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|3070842_3071019_+	YtzI protein	NA	NA	NA	NA	NA
WP_014477743.1|3071012_3071450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003219361.1|3071569_3072043_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003229076.1|3072171_3072399_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_014477744.1|3072395_3072959_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_014665094.1|3073052_3073301_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_041337043.1|3073481_3074813_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_041337042.1|3074856_3075897_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014480632.1|3075950_3076109_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_087614167.1|3076212_3077401_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_014480633.1|3077440_3078328_-	manganese ABC transporter permease MntD	NA	NA	NA	NA	NA
WP_041052644.1|3078317_3079625_-	manganese ABC transporter permease MntC	NA	NA	NA	NA	NA
WP_041052646.1|3079630_3080383_-	manganese ABC transporter ATP-binding protein MntB	NA	G9BWD6	Planktothrix_phage	34.9	5.5e-17
WP_041052648.1|3080401_3081322_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_041052650.1|3081599_3082715_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_041052652.1|3082711_3084172_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.1	2.9e-75
WP_003229054.1|3084262_3085078_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_041052656.1|3085112_3085937_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_041052658.1|3085924_3087667_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_017695436.1|3087663_3089079_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_080262681.1|3089137_3089335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695435.1|3089368_3090088_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_017695433.1|3091084_3092371_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	3.9e-71
WP_017695432.1|3092367_3093318_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.6	2.9e-31
WP_017695431.1|3093320_3094529_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017695430.1|3094616_3095048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695429.1|3095049_3096105_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_017695428.1|3096119_3097253_-|coat	spore coat protein CotSA	coat	NA	NA	NA	NA
WP_072557162.1|3097442_3098516_+|coat	spore coat kinase CotI	coat	NA	NA	NA	NA
WP_003229024.1|3098595_3099063_+	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_014478984.1|3099194_3100547_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 15
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	3120882	3173529	4217124	transposase,integrase,head,portal,terminase,tail,holin	uncultured_Caudovirales_phage(39.02%)	74	3110709:3110726	3173690:3173707
3110709:3110726	attL	GCTCTCCCAGCTGAGCTA	NA	NA	NA	NA
WP_003243227.1|3120882_3122091_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_041056042.1|3122107_3123580_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015251366.1|3123778_3124321_+	transcriptional regulator GbsR	NA	NA	NA	NA	NA
WP_041056044.1|3124516_3125062_+	biofilm-surface layer protein BslA	NA	NA	NA	NA	NA
WP_152425567.1|3125116_3126306_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	2.1e-31
WP_003228942.1|3126740_3127409_+	potassium uptake protein KtrA	NA	NA	NA	NA	NA
WP_041054267.1|3127415_3128753_+	Ktr system potassium transporter KtrB	NA	NA	NA	NA	NA
WP_003222348.1|3128788_3129052_-	membrane protein	NA	NA	NA	NA	NA
WP_003228938.1|3129160_3130009_-	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
WP_041054270.1|3130168_3131704_-	MFS transporter	NA	NA	NA	NA	NA
WP_015251362.1|3132222_3132708_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_128737605.1|3133061_3133250_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	56.7	4.5e-13
WP_152425568.1|3133273_3134560_-	ImmA/IrrE family metallo-endopeptidase	NA	B7SV90	Oryctes_rhinoceros_nudivirus	28.1	5.7e-06
WP_152425569.1|3134690_3135026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425570.1|3135206_3135452_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	57.5	1.4e-17
WP_152425571.1|3136042_3136864_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.3	3.8e-64
WP_100276292.1|3136916_3137180_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	4.2e-25
WP_080348108.1|3137195_3137465_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.9	1.0e-26
WP_152425572.1|3137551_3137809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121591683.1|3137820_3137991_-	XkdX family protein	NA	NA	NA	NA	NA
WP_152425573.1|3138151_3138556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425574.1|3138570_3141903_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.8	4.1e-133
WP_134976607.1|3141915_3142680_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_152425575.1|3142676_3147392_-	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	23.9	4.8e-34
WP_116363003.1|3147396_3147705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100276285.1|3147752_3148265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152425576.1|3148318_3148534_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_152425676.1|3148577_3148910_-	alkaline phosphatase	NA	Q0PDK9	Bacillus_phage	76.5	2.0e-27
WP_033884267.1|3148833_3149346_-|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	45.9	1.7e-30
WP_134976609.1|3149359_3149758_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.8	1.4e-24
WP_100276281.1|3149776_3150193_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	52.2	1.5e-32
WP_152425577.1|3150179_3150524_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_144460338.1|3150520_3150817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033884273.1|3150821_3151037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103803590.1|3151050_3151257_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	59.1	3.4e-14
WP_033884274.1|3151297_3152278_-	hypothetical protein	NA	D2J006	Enterococcus_phage	37.4	9.2e-49
WP_152425578.1|3152290_3152956_-	scaffolding protein	NA	I1TLE1	Bacillus_phage	50.4	6.5e-22
WP_152425579.1|3153761_3154685_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	45.8	1.5e-69
WP_151262044.1|3154671_3156126_-|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	48.6	1.3e-123
WP_134976625.1|3156128_3156407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134976628.1|3156403_3157672_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1Q1PVS1	Bacillus_phage	79.9	2.6e-197
WP_072566768.1|3157668_3158097_-|terminase	terminase small subunit	terminase	A0A0K2CNQ5	Brevibacillus_phage	66.2	2.7e-45
WP_152425580.1|3158427_3158772_-	hypothetical protein	NA	Q38578	Bacillus_phage	60.0	1.1e-09
WP_033884286.1|3158898_3159360_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	2.4e-23
WP_134976630.1|3159380_3159566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033884289.1|3159581_3159713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696646.1|3159850_3160057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026113689.1|3160056_3160245_-	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	61.0	4.5e-13
WP_152425581.1|3160241_3160493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696649.1|3160489_3160681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696650.1|3160673_3161072_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	43.8	2.4e-19
WP_041057255.1|3161325_3161574_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	43.6	7.1e-06
WP_095045982.1|3161570_3161894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041057260.1|3161964_3162171_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.8	1.7e-21
WP_041057265.1|3162545_3162995_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	77.9	2.7e-56
WP_052470594.1|3162981_3163392_-	hypothetical protein	NA	A0A0K2CPB0	Brevibacillus_phage	46.7	3.9e-25
WP_152425582.1|3163625_3164573_-	AAA family ATPase	NA	A6XMI1	Bacillus_virus	52.2	4.7e-58
WP_041344345.1|3164457_3165156_-	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	42.6	7.0e-43
WP_041057271.1|3165163_3165346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041057273.1|3165320_3166163_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.8	6.1e-118
WP_041057275.1|3166165_3167116_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	71.4	1.7e-132
WP_041344346.1|3167115_3167304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015382933.1|3167406_3167607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121591658.1|3167557_3167740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033884313.1|3167736_3167994_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	2.2e-10
WP_121591656.1|3167990_3168560_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.6	1.4e-60
WP_121591655.1|3168692_3169454_-	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.8	5.8e-99
WP_010329848.1|3169518_3169710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010329849.1|3169721_3169949_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	61.6	4.8e-17
WP_072565180.1|3170112_3170496_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	68.3	3.6e-33
WP_121591654.1|3170825_3171347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072565182.1|3171359_3171707_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	64.3	3.6e-16
WP_152425583.1|3171778_3172282_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	65.9	5.9e-60
WP_063334566.1|3172302_3173529_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	48.5	4.6e-106
3173690:3173707	attR	GCTCTCCCAGCTGAGCTA	NA	NA	NA	NA
>prophage 16
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	3437945	3468119	4217124	holin,transposase	Thermus_phage(28.57%)	32	NA	NA
WP_014478984.1|3437945_3439296_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_152425678.1|3439425_3441837_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	2.2e-120
WP_003228406.1|3441920_3442130_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_003228404.1|3442205_3442511_-	copper-sensing transcriptional repressor CsoR	NA	NA	NA	NA	NA
WP_152425607.1|3442638_3443715_+	scyllo-inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_017695153.1|3443751_3444387_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_041054144.1|3444546_3446442_-	FUSC family protein	NA	NA	NA	NA	NA
WP_017695155.1|3446606_3447008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695156.1|3447004_3447364_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017695157.1|3447360_3447933_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003220025.1|3449560_3450031_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
WP_017695158.1|3450175_3452515_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	43.1	4.8e-88
WP_017695159.1|3452533_3453274_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|3453405_3453636_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017695160.1|3453784_3454558_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220031.1|3454591_3454825_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|3454976_3455384_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_017695161.1|3455413_3455833_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|3455924_3456251_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_017695162.1|3458087_3458768_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_017695163.1|3458784_3459705_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017695164.1|3459716_3460370_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_017695165.1|3460386_3461532_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.2	1.0e-14
WP_014480910.1|3461815_3462349_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041054139.1|3462570_3463047_+	sporulation-delaying system protein SdpA	NA	NA	NA	NA	NA
WP_015251217.1|3463043_3464015_+	sporulation-delaying protein SdpB	NA	NA	NA	NA	NA
WP_003243360.1|3464057_3464669_+	sporulation delaying protein SdpC	NA	NA	NA	NA	NA
WP_003228357.1|3464715_3465339_-	immunity protein SdpI	NA	NA	NA	NA	NA
WP_003243541.1|3465335_3465608_-	sporulation delaying system autorepressor SdpR	NA	NA	NA	NA	NA
WP_003244403.1|3465827_3466517_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_152425679.1|3466534_3467446_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3467465_3468119_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
>prophage 17
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	3809823	3880704	4217124	tRNA,coat,transposase,bacteriocin,protease	Bacillus_phage(18.75%)	66	NA	NA
WP_080320312.1|3809823_3810279_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.3	2.1e-19
WP_003227612.1|3810334_3811942_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
WP_014481200.1|3812183_3812690_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_014481201.1|3812872_3814012_-	acyl-CoA dehydrogenase AcdA	NA	NA	NA	NA	NA
WP_129093485.1|3814008_3816126_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_152425633.1|3816280_3817477_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_152425634.1|3817489_3818452_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.2	2.2e-39
WP_003227597.1|3818532_3818805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152425635.1|3818941_3820294_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.6	6.9e-87
WP_003227570.1|3820435_3822106_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_152425636.1|3822102_3822531_-	DUF1934 family protein	NA	NA	NA	NA	NA
WP_003222002.1|3822843_3822975_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3822931_3823084_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_017696262.1|3823108_3824455_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3824467_3824629_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_017696261.1|3824625_3825345_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	8.1e-18
WP_038829818.1|3825337_3826648_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_080015532.1|3826637_3827798_+	insulinase family protein	NA	NA	NA	NA	NA
WP_017696258.1|3827802_3829083_+	insulinase family protein	NA	NA	NA	NA	NA
WP_017696257.1|3829079_3829781_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_017696256.1|3829786_3831154_-	YncE family protein	NA	NA	NA	NA	NA
WP_017696255.1|3831202_3832558_-	YncE family protein	NA	NA	NA	NA	NA
WP_041334639.1|3832554_3832785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696253.1|3832787_3833933_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.8	5.1e-83
WP_014665774.1|3833916_3834036_+	phosphatase	NA	NA	NA	NA	NA
WP_003227545.1|3834631_3835504_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3835564_3836395_-	spermidine synthase	NA	NA	NA	NA	NA
WP_017696252.1|3836597_3838673_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_017696251.1|3838965_3839484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3839497_3840157_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3840265_3840454_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_017696250.1|3840496_3840916_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017696249.1|3841035_3842952_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	42.9	1.2e-140
WP_017696248.1|3843796_3845197_-	MFS transporter	NA	NA	NA	NA	NA
WP_017696247.1|3845196_3845667_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_017696246.1|3845778_3846279_-	YwgA family protein	NA	NA	NA	NA	NA
WP_017696245.1|3846314_3847616_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	7.2e-25
WP_003222050.1|3847777_3848002_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_017696244.1|3848216_3848996_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	28.4	6.5e-05
WP_017696243.1|3849139_3850030_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3850197_3851043_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_017696242.1|3851091_3851991_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_017696241.1|3852136_3853108_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003242896.1|3853383_3854148_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_017696240.1|3854280_3855060_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_017696239.1|3855075_3856290_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|3856290_3857475_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_026113673.1|3858838_3859600_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	3.7e-21
WP_017696236.1|3860284_3860899_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_017696235.1|3861050_3862289_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|3862498_3863911_-	amino acid permease	NA	NA	NA	NA	NA
WP_017696234.1|3863910_3865611_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_017696233.1|3865684_3867232_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_152425637.1|3867458_3868733_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014481242.1|3869697_3870153_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_069837836.1|3870145_3870997_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
WP_003244201.1|3871010_3871958_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_017696230.1|3871957_3872698_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_152425638.1|3872722_3873742_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_152425639.1|3873744_3874467_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_152425640.1|3874459_3875581_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_152425641.1|3875580_3876450_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152425642.1|3876450_3877620_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1D8KU11	Synechococcus_phage	26.6	1.6e-15
WP_152425643.1|3877640_3879839_-	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	9.7e-06
WP_017696223.1|3879831_3880011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696222.1|3880158_3880704_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 18
NZ_CP045425	Bacillus subtilis strain JAAA chromosome, complete genome	4217124	3894559	3939127	4217124	holin,protease,lysis,transposase	Bacillus_phage(33.33%)	40	NA	NA
WP_041334562.1|3894559_3896980_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
WP_017696212.1|3897017_3898019_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017696211.1|3898192_3898942_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_015250943.1|3899047_3900229_-	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_003227411.1|3900723_3900987_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_087614160.1|3901105_3902255_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003227410.1|3902317_3902692_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227409.1|3902693_3903308_-	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_003227407.1|3903321_3905271_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010886637.1|3905298_3906264_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_009968363.1|3906779_3907025_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_017697023.1|3907095_3908637_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_017697024.1|3908640_3909813_-	galactokinase	NA	NA	NA	NA	NA
WP_003227398.1|3909891_3910275_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017697025.1|3910292_3910964_-	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_014478351.1|3911318_3911477_+	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_017697026.1|3911919_3912228_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_152425647.1|3912224_3913766_+	sodium/solute symporter	NA	NA	NA	NA	NA
WP_017697027.1|3913777_3914410_-	DsbA family protein	NA	NA	NA	NA	NA
WP_017697028.1|3914614_3915865_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_017697029.1|3915883_3917041_-	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_017697030.1|3917037_3918480_-	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_017697031.1|3918636_3919305_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017697032.1|3919301_3920120_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003227377.1|3920127_3921033_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481281.1|3921138_3921525_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227371.1|3921506_3922184_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_017697033.1|3922289_3923492_+	MFS transporter	NA	NA	NA	NA	NA
WP_015385004.1|3923525_3923723_+	YwbE family protein	NA	NA	NA	NA	NA
WP_017697034.1|3923755_3924943_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.5	5.3e-75
WP_003243380.1|3925063_3925444_+	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_026113710.1|3925482_3926160_-	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_017697035.1|3926251_3927574_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_026113711.1|3927801_3929739_+|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	34.9	8.5e-46
WP_041334520.1|3930165_3931545_+	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_152425648.1|3931598_3932441_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003242748.1|3932493_3933354_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
WP_152425649.1|3933463_3934177_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_003227345.1|3934327_3934843_+	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_152425567.1|3937938_3939127_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	2.1e-31
