The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	431987	438910	5109521	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_117130135.1|431987_432851_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_130942606.1|432861_433635_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-26
WP_004201560.1|433875_434769_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
WP_004201559.1|435014_436376_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.2	1.5e-206
WP_004201558.1|436694_437417_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_152650977.1|437413_438910_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 2
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	481286	497678	5109521		Hokovirus(16.67%)	15	NA	NA
WP_152650984.1|481286_482327_+	acyltransferase family protein	NA	Q716G0	Shigella_phage	34.4	4.1e-39
WP_074388098.1|482433_483840_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	3.6e-38
WP_000926396.1|484066_485482_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	8.9e-53
WP_152650985.1|485504_486875_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.0	8.4e-32
WP_152650986.1|487032_488097_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004175258.1|488123_488993_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_004175259.1|489024_489915_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175260.1|489929_490484_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_009484573.1|490662_491829_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	4.1e-112
WP_004144151.1|492252_492375_-	small membrane protein	NA	NA	NA	NA	NA
WP_038435495.1|492775_493780_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_001310942.1|493735_493930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088879.1|494291_494576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152650987.1|494857_496273_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_012967600.1|496295_497678_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 3
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	1377423	1388309	5109521		Escherichia_phage(87.5%)	9	NA	NA
WP_152651207.1|1377423_1380531_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004205989.1|1380585_1381851_+	MFS transporter	NA	NA	NA	NA	NA
WP_152651208.1|1381881_1382970_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	96.4	3.3e-204
WP_004205993.1|1383056_1383317_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_152651209.1|1383613_1384474_+	OKP family class A broad-spectrum beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.8	2.4e-141
WP_023318186.1|1384494_1385256_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.0	7.5e-131
WP_152651210.1|1385516_1386419_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	97.0	2.6e-154
WP_152651211.1|1386430_1387696_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	91.9	3.3e-216
WP_152651212.1|1387688_1388309_+	aldolase	NA	A0A077SK32	Escherichia_phage	94.2	2.2e-109
>prophage 4
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	1652101	1680845	5109521	holin,terminase,tail	Klebsiella_phage(31.25%)	39	NA	NA
WP_152651282.1|1652101_1655170_-	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
WP_016946669.1|1655166_1655547_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	3.1e-69
WP_152651283.1|1655556_1656039_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	1.3e-85
WP_152651284.1|1656025_1656499_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.9	7.3e-60
WP_015958316.1|1656813_1657149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152651285.1|1657232_1660130_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.8	9.2e-105
WP_077255553.1|1660203_1660686_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	43.6	1.1e-18
WP_004217333.1|1660682_1661039_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|1661115_1661322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190637.1|1661459_1661942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152651286.1|1661995_1663168_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	7.2e-24
WP_004190640.1|1663191_1663584_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_047694613.1|1663580_1664132_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	3.9e-28
WP_004217344.1|1664133_1664517_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_072032792.1|1664503_1664737_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	45.6	3.8e-09
WP_004190649.1|1664746_1665001_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_023300922.1|1665002_1665398_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_152651287.1|1665719_1666673_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	6.5e-132
WP_004190654.1|1666683_1667469_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.4	1.7e-66
WP_117259961.1|1667999_1669112_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	2.1e-110
WP_085862295.1|1669095_1670496_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	7.1e-127
WP_152651288.1|1670497_1671811_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.3	3.8e-183
WP_032434131.1|1671794_1672790_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.1e-38
WP_040244170.1|1673338_1673521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190669.1|1673652_1673898_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	6.7e-33
WP_019405025.1|1674711_1674906_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_152651289.1|1674856_1675132_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.2	3.9e-13
WP_117247224.1|1675128_1675473_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.9	1.7e-37
WP_004184488.1|1675469_1676009_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_031280382.1|1676005_1676305_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_049001106.1|1676916_1677363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805457.1|1677268_1677526_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_023287514.1|1677860_1678682_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_020804605.1|1678797_1679154_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_115194052.1|1679150_1679447_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	6.0e-36
WP_072040895.1|1679449_1679656_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	63.2	3.2e-20
WP_064182634.1|1679655_1680255_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.9	5.0e-90
WP_022631486.1|1680312_1680534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|1680611_1680845_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
>prophage 5
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	1684397	1701794	5109521	integrase	Salmonella_phage(35.0%)	23	1686708:1686722	1703095:1703109
WP_023313099.1|1684397_1684634_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	92.2	2.9e-33
WP_004190692.1|1684626_1684830_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	5.7e-30
WP_032416146.1|1684826_1685612_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.6e-65
WP_016946299.1|1685604_1685940_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_115194051.1|1685932_1686676_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	6.9e-65
WP_032409425.1|1686672_1687593_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.2	2.8e-92
1686708:1686722	attL	CCAGCGCGCTGGCGC	NA	NA	NA	NA
WP_023313095.1|1687940_1688477_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	67.8	5.4e-59
WP_023313094.1|1688479_1688710_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	63.5	4.7e-20
WP_023313093.1|1688850_1689411_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	38.3	2.0e-08
WP_023313092.1|1689600_1689909_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	61.2	8.4e-25
WP_022631176.1|1690000_1690099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804303.1|1690205_1690397_+	YebW family protein	NA	NA	NA	NA	NA
WP_016946289.1|1690405_1690561_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_152651290.1|1690698_1693794_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.1	5.7e-294
WP_048270597.1|1693806_1694916_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.0	2.0e-185
WP_022631172.1|1694956_1695196_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_152651291.1|1695205_1695520_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_152651292.1|1695416_1696604_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	9.3e-120
WP_004151901.1|1696780_1697671_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004203899.1|1697670_1698663_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004203898.1|1698664_1699474_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	33.7	1.2e-14
WP_023318042.1|1699503_1701003_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	34.0	4.2e-61
WP_017900863.1|1700999_1701794_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.4	6.6e-29
1703095:1703109	attR	CCAGCGCGCTGGCGC	NA	NA	NA	NA
>prophage 6
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	1821908	1897272	5109521	terminase,protease,portal,tRNA,integrase,holin,tail	Enterobacterial_phage(21.15%)	94	1840578:1840593	1899655:1899670
WP_004203748.1|1821908_1822409_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004203746.1|1822526_1822973_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_152651948.1|1822956_1823748_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152651323.1|1823849_1825034_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_152651324.1|1825065_1825758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152651325.1|1825903_1826413_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_152651949.1|1826399_1826756_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004203736.1|1826745_1826985_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_017898645.1|1827285_1828299_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	9.3e-12
WP_004150782.1|1828356_1828458_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_137910537.1|1828457_1828532_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004203733.1|1828649_1828775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152651326.1|1828834_1829098_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004203730.1|1829228_1829867_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_017898648.1|1829956_1830871_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
WP_017898650.1|1831529_1832573_-	type II asparaginase	NA	NA	NA	NA	NA
WP_152651327.1|1832876_1834121_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_065904678.1|1834157_1835942_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	4.5e-17
WP_130942228.1|1835938_1836838_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004203721.1|1836959_1838462_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_130942227.1|1838547_1838958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203719.1|1839093_1839780_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004203718.1|1840425_1841058_-	hypothetical protein	NA	NA	NA	NA	NA
1840578:1840593	attL	CATCCAGCGCGGTAAC	NA	NA	NA	NA
WP_004203716.1|1841625_1841823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317966.1|1842181_1843192_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004203714.1|1843188_1844595_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|1844649_1845537_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004203713.1|1845553_1846060_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_152651950.1|1846086_1846581_-	DUF892 family protein	NA	NA	NA	NA	NA
WP_004150795.1|1846671_1846857_-	general stress protein	NA	NA	NA	NA	NA
WP_152651328.1|1847478_1848672_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_004203710.1|1848783_1849011_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_048294493.1|1849065_1849611_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_060657020.1|1849901_1850543_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152651951.1|1850700_1851174_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_004203706.1|1851310_1851634_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_048323820.1|1851626_1852019_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_117124039.1|1852015_1852729_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|1853001_1853154_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_024623019.1|1853332_1853704_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	3.5e-25
WP_038434616.1|1853660_1853900_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	2.0e-21
WP_152651329.1|1855520_1856276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152651330.1|1856618_1857422_-	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	43.5	9.5e-52
WP_152651331.1|1860225_1863294_-	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
WP_004152651.1|1863290_1863671_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_008806077.1|1863680_1864163_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	99.4	4.6e-86
WP_071599323.1|1864149_1864623_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.5	7.8e-54
WP_049095300.1|1864622_1867319_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.9	1.2e-202
WP_032420719.1|1867299_1867617_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_152651332.1|1867637_1868033_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.4	2.9e-09
WP_023304948.1|1868075_1868558_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|1868565_1868964_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_049095302.1|1868960_1869512_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	68.5	5.3e-54
WP_020317349.1|1869501_1869795_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020804328.1|1869787_1870114_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.4	4.0e-33
WP_040164891.1|1870194_1872210_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
WP_020804347.1|1872154_1873654_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	1.1e-247
WP_014228569.1|1873650_1873866_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_049095303.1|1873862_1875971_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.6	0.0e+00
WP_049095304.1|1875970_1876462_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	83.4	1.1e-66
WP_072002796.1|1876783_1876969_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|1877036_1877297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040221224.1|1877532_1877769_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	91.0	8.7e-30
WP_019405025.1|1878581_1878776_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_152651289.1|1878726_1879002_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.2	3.9e-13
WP_117247224.1|1878998_1879343_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.9	1.7e-37
WP_004184488.1|1879339_1879879_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_031280382.1|1879875_1880175_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_129307065.1|1880773_1881100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152651333.1|1881367_1882189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886665.1|1882213_1882699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100757123.1|1882747_1883089_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	3.5e-56
WP_152651334.1|1883107_1884088_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	2.4e-134
WP_000779146.1|1884100_1884478_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_152651335.1|1884487_1885297_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	2.0e-110
WP_110203540.1|1885293_1886262_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	67.6	4.5e-88
WP_085206676.1|1886251_1886431_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_152651336.1|1886668_1887121_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	4.5e-67
WP_004197463.1|1887149_1887413_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_004184740.1|1887514_1887991_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004184742.1|1888162_1889317_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_110203538.1|1889449_1889677_+	hypothetical protein	NA	K7PGV8	Enterobacterial_phage	85.2	3.0e-19
WP_049006289.1|1889909_1890827_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.9	5.2e-46
WP_152651337.1|1890916_1891216_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
WP_152651338.1|1891215_1892001_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.3	1.3e-61
WP_064148646.1|1892496_1892703_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.4e-31
WP_151152326.1|1892699_1893377_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	63.0	7.9e-07
WP_071885116.1|1893376_1893592_+	molecular chaperone DnaJ	NA	R9TNC2	Aeromonas_phage	95.8	1.0e-37
WP_087759359.1|1893588_1894029_+	hypothetical protein	NA	R9TQX3	Aeromonas_phage	81.7	2.1e-21
WP_040176407.1|1894021_1894240_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.5e-09
WP_071562415.1|1894239_1894512_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
WP_000089156.1|1894540_1894777_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|1894766_1895909_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_023317932.1|1896021_1897272_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
1899655:1899670	attR	GTTACCGCGCTGGATG	NA	NA	NA	NA
>prophage 7
NZ_CP035207	Klebsiella quasipneumoniae strain TH114 chromosome, complete genome	5109521	2134717	2144179	5109521	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023320058.1|2134717_2136439_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	9.9e-14
WP_053810603.1|2136478_2137183_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2137533_2137752_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004201360.1|2137875_2140155_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.8e-165
WP_002896520.1|2140185_2140503_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2140828_2141050_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_069602577.1|2141126_2143067_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
WP_004201357.1|2143063_2144179_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP035209	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence	73414	1452	63550	73414	transposase,integrase	Escherichia_phage(20.0%)	60	31525:31555	63246:63276
WP_004118297.1|1452_2937_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_072143941.1|2936_3188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776034.1|3345_3777_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_152651988.1|3776_5048_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|5129_6107_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|6103_7309_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|7723_7993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|8169_9036_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|9798_10056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020956881.1|10113_10890_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	7.0e-52
WP_020956882.1|10901_11588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020956883.1|11651_11945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420785.1|12103_12538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|12521_12752_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|12748_13165_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|13238_14801_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|14785_15808_+	helicase UvrD	NA	NA	NA	NA	NA
WP_032411229.1|16351_17260_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004187110.1|17445_17796_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_004187113.1|17943_18375_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|18625_20101_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_065801211.1|20093_20774_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.7e-31
WP_000475512.1|20963_22349_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|22377_22731_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_032413333.1|22844_24137_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|24147_27294_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_008322815.1|27380_27821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413330.1|27947_30395_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	3.8e-83
WP_000843497.1|30435_30633_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|30666_31404_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
31525:31555	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
WP_001138073.1|33077_36050_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|36052_36610_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001447826.1|36647_36971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845054.1|36915_37929_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001083725.1|38073_38571_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|38682_38973_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|38978_39770_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_039026396.1|39849_40164_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039026397.1|40160_40982_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	3.5e-09
WP_001067855.1|41261_41966_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001294663.1|43366_43717_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|43788_44223_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|44309_45014_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|45047_45539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|45645_46383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|46379_46604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|46814_48308_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|48338_49223_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|49439_50654_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|50681_50987_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|51098_52592_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|52622_52874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|52767_53070_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|53156_53972_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|54061_55151_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_072202717.1|55348_55828_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000027057.1|56406_57267_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|57449_58007_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_152651989.1|58011_58908_+	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	98.8	3.7e-145
WP_000844627.1|63307_63550_+|transposase	transposase	transposase	NA	NA	NA	NA
63246:63276	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
>prophage 1
NZ_CP035208	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-3, complete sequence	59814	0	1269	59814		Escherichia_phage(50.0%)	2	NA	NA
WP_000780222.1|677_959_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|939_1269_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
>prophage 2
NZ_CP035208	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-3, complete sequence	59814	4686	7527	59814	integrase	Klebsiella_phage(33.33%)	4	766:781	8307:8322
766:781	attL	TCCAGGCGGGAAATAA	NA	NA	NA	NA
WP_032440555.1|4686_4935_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
WP_032440556.1|5019_5505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556681.1|5634_6312_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
WP_032440558.1|6552_7527_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
8307:8322	attR	TCCAGGCGGGAAATAA	NA	NA	NA	NA
>prophage 3
NZ_CP035208	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-3, complete sequence	59814	10922	11783	59814		Marinomonas_phage(100.0%)	1	NA	NA
WP_032440562.1|10922_11783_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
>prophage 4
NZ_CP035208	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-3, complete sequence	59814	19291	20986	59814		Hokovirus(100.0%)	1	NA	NA
WP_032440570.1|19291_20986_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.9	2.1e-24
>prophage 5
NZ_CP035208	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-3, complete sequence	59814	49990	50524	59814		Wolbachia_phage(100.0%)	1	NA	NA
WP_032440594.1|49990_50524_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	7.0e-19
>prophage 6
NZ_CP035208	Klebsiella quasipneumoniae strain TH114 plasmid pTH114-3, complete sequence	59814	53578	56961	59814	transposase,integrase	Morganella_phage(33.33%)	4	53219:53231	57736:57748
53219:53231	attL	AACTGGAATTACC	NA	NA	NA	NA
WP_045325066.1|53578_54004_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
WP_152651987.1|54003_54936_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F1C5A5	Cronobacter_phage	50.8	2.9e-68
WP_063102497.1|55129_55516_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_152650736.1|56040_56961_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.7	6.9e-06
57736:57748	attR	GGTAATTCCAGTT	NA	NA	NA	NA
