The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	357269	371934	5539892	tRNA,integrase,tail	Enterobacteria_phage(40.0%)	18	358550:358565	376079:376094
WP_000956557.1|357269_357803_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|358220_358502_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358550:358565	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|358846_359044_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|359379_359664_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|359660_360011_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|360001_360538_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|361859_362459_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|362523_363837_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|363838_364108_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|364219_364792_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|364864_365494_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|365575_366217_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|366377_366626_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|366687_367785_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|367873_368911_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|369044_369287_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|369452_370436_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|370518_371934_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
376079:376094	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	508814	567842	5539892	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|508814_510074_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|510076_511081_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|511162_511360_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|511463_512762_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|512966_513392_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|513430_515872_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|516052_516784_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|516910_517312_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|517330_518029_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|518079_518739_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|518756_519155_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|519164_519803_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|519805_520969_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|521052_522678_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|522794_523070_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|523218_523548_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|523729_524479_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|524475_525231_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|526757_528155_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|528170_528476_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|528485_528950_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|528963_529614_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|529623_530478_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|530477_531164_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|531292_531568_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|531894_532290_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|532296_532611_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|532615_532843_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|532884_533334_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|533404_534199_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|534821_535253_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|535260_536469_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|536603_537242_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|537459_538080_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|538388_539801_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|539845_540508_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|540615_541581_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|541688_542549_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|542637_543018_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|543135_545079_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|545268_546009_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|546220_547159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|547221_547776_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|548100_548307_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|548402_549746_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|550068_550707_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|550912_552646_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|552642_556422_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|556424_556766_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|556977_557229_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|557222_557573_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|557652_558183_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|558492_559449_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|559588_561091_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|561104_562127_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|562113_563109_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|563141_564140_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|564315_565689_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|565844_566396_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|566489_567842_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	600262	612838	5539892		Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772662.1|600262_601537_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|601704_602010_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|602086_602821_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|602858_604103_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|604428_605001_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|605074_605575_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|605571_606306_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|606857_607124_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|607120_607711_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|607703_607991_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|607983_608439_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|608574_608895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|608909_611243_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|611598_611793_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|612010_612838_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
>prophage 4
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	1007644	1089607	5539892	head,holin,transposase,capsid,integrase,terminase,portal,lysis,plate,protease,tail	Shigella_phage(50.0%)	89	1024892:1024906	1090023:1090037
WP_000246433.1|1007644_1008976_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1008978_1009503_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1009499_1010780_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1010804_1011887_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1011850_1013701_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1013704_1014118_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1014208_1015600_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1015650_1015875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1015909_1016410_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1017106_1017625_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1017834_1019976_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|1020051_1024275_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|1024476_1024740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1024654_1024840_-	protein YncO	NA	NA	NA	NA	NA
1024892:1024906	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|1024920_1026093_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|1026210_1026981_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1027134_1027608_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|1027650_1030095_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|1030334_1030913_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|1031017_1031785_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1031755_1032496_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|1032651_1032912_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|1032930_1033191_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|1033376_1034150_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|1034967_1036707_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301640.1|1036666_1037437_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|1037507_1038563_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1038614_1038908_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|1038910_1039309_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059871.1|1039318_1039771_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|1040077_1040344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|1040276_1040813_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|1040869_1042327_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1042587_1043046_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|1043137_1044382_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|1044439_1044841_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1044879_1045935_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1046222_1047326_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1047337_1048591_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_000051887.1|1048795_1049959_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|1049835_1050270_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|1050185_1050491_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1050490_1050853_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1050843_1051380_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|1052056_1052353_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|1052630_1053323_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1053420_1053681_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1053673_1054225_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1054400_1054580_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1054569_1055511_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|1055507_1056002_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|1056001_1056655_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1056651_1056978_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1056974_1057364_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1057383_1058193_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1058200_1059190_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1059203_1059956_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484664.1|1060170_1060710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1060853_1061087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1061365_1061659_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1061795_1062131_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1062134_1062611_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1062827_1063010_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1063100_1063394_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_085948178.1|1064092_1065306_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000929175.1|1065708_1066203_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128484532.1|1066436_1067933_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|1068080_1069307_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|1069299_1069902_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|1069912_1071142_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|1071220_1071544_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|1071540_1071951_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|1071925_1072432_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|1072428_1072989_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|1072997_1073168_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|1073151_1074648_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|1074647_1075004_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|1075003_1075273_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|1075414_1077250_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|1077310_1078639_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|1078635_1079715_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|1079714_1080263_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|1080262_1080688_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1080674_1081733_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1081723_1082308_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000905124.1|1084506_1085061_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1085121_1085895_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|1086719_1087463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1088425_1089607_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1090023:1090037	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 5
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	1668545	1706640	5539892	holin,integrase,terminase,portal,lysis,protease,tail	Enterobacteria_phage(51.22%)	48	1657987:1658001	1690276:1690290
1657987:1658001	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|1668545_1669427_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|1669589_1669808_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1669847_1670015_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1670257_1670860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1671070_1671292_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1671390_1671672_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1671682_1671874_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1671846_1672029_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1672025_1672706_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1673403_1673586_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1673582_1673753_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1673745_1674366_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1674362_1675028_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1675239_1676199_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1676536_1676659_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1676673_1677363_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1677546_1678290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1678375_1678534_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1678614_1679013_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1679155_1679371_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1679370_1679868_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1679864_1680332_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1680319_1680472_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000934137.1|1681636_1683739_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|1683735_1683948_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1683875_1685000_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1685121_1685457_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|1685401_1687429_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|1687515_1687839_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1687831_1688107_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1688118_1688697_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1688693_1689095_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1689105_1689849_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1689909_1690296_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1690276:1690290	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1690304_1690634_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1690605_1693671_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1693670_1694000_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1694009_1694708_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1694713_1695457_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|1695393_1696002_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|1699546_1700146_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1700205_1701522_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1701523_1701793_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1701969_1702950_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1702983_1704003_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1704499_1704661_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1704829_1705711_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|1705941_1706640_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 6
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	1831317	1925652	5539892	head,holin,tRNA,capsid,integrase,terminase,portal,lysis,plate,protease,tail	Escherichia_phage(43.86%)	86	1839912:1839929	1881988:1882005
WP_000520781.1|1831317_1831638_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1831668_1833945_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1834631_1834850_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241680.1|1835134_1835839_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202230.1|1835880_1837602_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.1e-20
WP_001043606.1|1837602_1839369_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|1839491_1840457_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
1839912:1839929	attL	GCGGAAACCGTCACGGCG	NA	NA	NA	NA
WP_000228473.1|1841001_1841496_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000076999.1|1841630_1845659_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1845813_1846425_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067749.1|1846435_1847779_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1847869_1849162_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850325.1|1849400_1851845_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000213047.1|1851855_1852473_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000534648.1|1852474_1853338_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
WP_000165876.1|1853373_1854000_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|1854314_1855463_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918514.1|1855672_1857103_+	amino acid permease	NA	NA	NA	NA	NA
WP_000067977.1|1857312_1858110_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|1858141_1859137_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|1859230_1859542_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|1859646_1860003_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217677.1|1860180_1860681_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|1860744_1860969_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277959.1|1860968_1861271_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	2.9e-46
WP_001153795.1|1861270_1861495_+	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	4.2e-34
WP_000027664.1|1861491_1861767_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268620.1|1861756_1864039_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000997853.1|1864155_1865988_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	6.9e-90
WP_000038152.1|1866327_1867362_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	2.1e-200
WP_000156847.1|1867361_1869134_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085975.1|1869307_1870162_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_001248570.1|1870220_1871294_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	2.5e-201
WP_000203428.1|1871297_1872041_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_000988633.1|1872140_1872650_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1872649_1872853_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1872856_1873138_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1873137_1873635_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736606.1|1873649_1874075_+	hypothetical protein	NA	M1SV74	Escherichia_phage	95.0	1.2e-56
WP_000040640.1|1874062_1874488_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.1e-66
WP_001440152.1|1874459_1874633_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917149.1|1874595_1875063_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001001773.1|1875055_1875508_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_001093691.1|1875574_1876210_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.9e-111
WP_000127145.1|1876206_1876554_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	98.3	5.5e-57
WP_001121474.1|1876558_1877467_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285340.1|1877459_1878071_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001480037.1|1879324_1879663_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.0e-15
WP_001008235.1|1879634_1880078_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_000905107.1|1880536_1881130_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	3.9e-103
WP_001286688.1|1881189_1882380_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	2.8e-225
1881988:1882005	attR	CGCCGTGACGGTTTCCGC	NA	NA	NA	NA
WP_001251408.1|1882392_1882911_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1882967_1883243_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1883275_1883395_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069918.1|1883387_1885835_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000978907.1|1885849_1886329_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882928.1|1886328_1887492_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	6.6e-203
WP_000468308.1|1887573_1887792_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292812.1|1888110_1890393_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|1890447_1891305_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001301741.1|1891710_1893471_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642854.1|1893600_1894293_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057165.1|1894491_1895580_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000445231.1|1895650_1896934_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000799175.1|1897102_1897867_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|1898039_1898723_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1898833_1900507_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1900666_1900951_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705685.1|1901157_1903422_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1903458_1905207_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570541.1|1905203_1906190_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056545.1|1906226_1907459_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1907510_1907693_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011613.1|1907689_1908436_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1908589_1909483_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|1909459_1910239_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001301572.1|1910374_1911160_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288845.1|1911156_1912479_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001302273.1|1912459_1913164_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572668.1|1913163_1917624_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925977.1|1917884_1919732_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1919912_1920461_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|1920487_1921135_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462673.1|1921185_1922376_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977914.1|1922560_1923649_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000117895.1|1924251_1925652_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
>prophage 7
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	1953204	2015812	5539892	head,transposase,holin,integrase,portal,protease,tail	Enterobacteria_phage(36.36%)	73	1961692:1961707	1983058:1983073
WP_000156526.1|1953204_1954965_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1955150_1955603_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1955678_1956719_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1957075_1957585_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1957803_1958433_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1958395_1960558_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1960567_1961014_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1961136_1963191_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1961692:1961707	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1963222_1963681_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1963776_1964439_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1964611_1965025_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1965069_1965387_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1965444_1966635_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1966729_1967008_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1967004_1967334_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1967424_1968084_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1968491_1969511_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1969488_1969731_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1969798_1972270_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1972363_1972555_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1972551_1972740_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1973313_1973499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1973685_1974075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1974216_1974372_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1974649_1974937_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1974936_1975128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1975155_1975557_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1975665_1975938_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1975921_1976347_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1976553_1977009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1977087_1978179_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1978185_1978932_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1978953_1979724_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1979739_1980153_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1980504_1981278_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1981643_1981781_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1981825_1982038_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1982205_1982484_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1982485_1983535_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1983058:1983073	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1983547_1983919_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1983908_1984280_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001303877.1|1985535_1985775_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1985869_1986583_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1987349_1989200_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1989375_1990588_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1990793_1991108_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1991635_1991821_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1992042_1992156_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1992376_1992910_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1993069_1993342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1993597_1993804_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1994554_1994830_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1994905_1995286_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1995282_1995630_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1995679_1997218_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1997267_1997510_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1999394_1999601_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1999597_2001190_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_153037807.1|2001179_2002685_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.6e-100
WP_000256723.1|2002721_2003069_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2003126_2003393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2003374_2004115_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2004128_2004560_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2004586_2005000_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|2004980_2007560_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2007556_2007886_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2007885_2008584_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2008594_2009338_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_129137391.1|2009283_2009916_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_153037808.1|2010172_2013640_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_001426435.1|2013707_2014307_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_153037809.1|2014371_2015541_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	96.4	1.5e-82
WP_001023396.1|2015542_2015812_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 8
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	2073334	2093320	5539892	integrase,transposase,tail	Enterobacteria_phage(79.17%)	28	2086456:2086469	2096462:2096475
WP_032161583.1|2073334_2074471_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2074421_2074745_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2074902_2076087_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2076086_2076599_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2076653_2077019_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2077054_2077183_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2079985_2080474_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2080630_2081203_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2081246_2081663_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2082868_2083183_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2083187_2084147_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2084223_2087046_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2086456:2086469	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2087052_2087418_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2087490_2087721_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2088043_2088343_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2088339_2088606_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2088602_2088806_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2088829_2089246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2089338_2089452_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2089448_2089691_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2089702_2089981_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2089991_2090342_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2090363_2090567_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2090638_2090776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2090865_2091270_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2091285_2091936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2091965_2092313_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2092318_2093320_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2096462:2096475	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 9
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	2369499	2543400	5539892	head,holin,tRNA,capsid,transposase,integrase,terminase,portal,protease,tail	Escherichia_phage(25.6%)	201	2387453:2387469	2549796:2549812
WP_001295400.1|2369499_2370774_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001302086.1|2370835_2371696_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2371739_2372345_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100942.1|2372450_2373953_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030347.1|2374563_2375199_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2375198_2375894_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920789.1|2375897_2376518_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231928.1|2376521_2377580_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915707.1|2377580_2379899_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2379891_2380470_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2380469_2381051_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001302052.1|2381127_2381568_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2381653_2381869_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|2382141_2382267_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|2382509_2383550_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567512.1|2383585_2384587_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459374.1|2384690_2385863_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125634.1|2385872_2387465_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
2387453:2387469	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_000179513.1|2387639_2388668_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|2388779_2389547_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|2389775_2390366_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001075838.1|2392566_2393940_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001043324.1|2395287_2396796_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170658.1|2396896_2398072_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066619.1|2398270_2399917_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|2400059_2401463_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001322334.1|2401459_2402389_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732491.1|2402464_2403766_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
WP_001092494.1|2403769_2404489_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2404617_2404953_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|2404949_2405672_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412375.1|2405708_2407091_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2407276_2408221_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001302608.1|2408744_2410277_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2410287_2411676_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085279.1|2412782_2414012_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	7.1e-131
WP_000953272.1|2414378_2414567_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_153037810.1|2414616_2414943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201456.1|2415067_2415247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2415441_2415639_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|2415631_2415817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2415816_2416008_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|2415997_2416240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770147.1|2416245_2416545_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761790.1|2416541_2418674_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	3.4e-173
WP_000198851.1|2419046_2419298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233312.1|2419717_2419990_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137341.1|2420277_2421435_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000987369.1|2421489_2422047_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	3.5e-61
WP_001398592.1|2422084_2423260_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020674.1|2423256_2423595_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134110.1|2423591_2423888_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	2.6e-31
WP_001145905.1|2423887_2424328_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|2424617_2424974_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127889.1|2424957_2426619_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_001340366.1|2426632_2426914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|2427911_2428082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2428188_2428554_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2428540_2428870_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260835.1|2428908_2429730_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2429829_2429913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2430005_2430341_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2430737_2431991_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2432097_2432991_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2433125_2434346_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2434470_2435166_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2435118_2436411_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2436568_2437183_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2437225_2438080_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2438081_2438699_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2438709_2441133_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2441193_2443620_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2443818_2444124_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2444231_2444942_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2444944_2445505_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2445539_2445881_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2446015_2446342_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2446514_2446640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2447330_2447567_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2447654_2450126_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2450218_2450410_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2450406_2450595_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2450995_2451160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2451163_2451382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2451453_2451753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2452105_2452384_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2452385_2452577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2452597_2452969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2453066_2453369_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2453365_2453791_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2453813_2454776_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2454782_2455523_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2456333_2456729_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2456785_2457370_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2457485_2457590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2457778_2457991_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2458158_2458437_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2458438_2459488_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2459500_2459860_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2459856_2460546_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2461181_2461610_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_153037811.1|2462088_2463939_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.2	0.0e+00
WP_000411805.1|2464387_2464594_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2464598_2464943_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2464993_2465527_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2465797_2466367_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2466366_2466513_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2466740_2466926_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2467350_2467578_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2467619_2467985_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2468274_2468838_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2468834_2470496_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2470559_2472497_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2472541_2472763_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2472708_2475210_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2475289_2475616_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2475625_2475976_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2475972_2476419_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2476415_2476760_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2476818_2477535_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2477540_2477915_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2478010_2478220_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2478272_2481515_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2481507_2481849_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_024748472.1|2481848_2482286_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_012779365.1|2482471_2485732_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2485734_2485950_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2486017_2486617_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2486681_2487905_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2487906_2488176_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2488289_2488865_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2489574_2490225_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2490807_2492346_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2492395_2492743_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2492739_2493120_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2494082_2494397_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2495035_2496280_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2496372_2496561_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2496557_2496746_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2497310_2497520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2497520_2498159_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2498170_2498323_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2498615_2498954_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2499345_2499588_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2499571_2499997_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_136760546.1|2500065_2501103_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.7	2.2e-85
WP_001379651.1|2501134_2501557_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2501590_2502307_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2502339_2502621_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2502617_2502845_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2502837_2503149_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2503276_2503495_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2503496_2504054_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2504287_2504500_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2504619_2504964_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2505085_2505358_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2505359_2506409_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2506421_2506727_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2506789_2507344_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2507568_2507766_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2507901_2508615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2509065_2509497_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_153037812.1|2509974_2511825_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000411805.1|2512273_2512480_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2512484_2512829_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2512879_2513413_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2513683_2514253_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2514252_2514399_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2514621_2514807_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2515332_2515647_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2515728_2515953_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2516339_2516885_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2516859_2518785_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2518781_2518988_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2518984_2520586_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2520566_2521886_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2521895_2522228_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2522283_2523309_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2523350_2523749_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2523760_2524114_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2524128_2524662_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2524658_2525054_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2525061_2525814_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2525827_2526250_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2526276_2526690_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2526670_2529283_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2529279_2529609_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2529608_2530307_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2530317_2531061_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_129137391.1|2531006_2531639_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_153037808.1|2531895_2535363_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_001230509.1|2535430_2536030_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_024748460.1|2536094_2537408_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2537409_2537679_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2537792_2538368_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2538440_2539070_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2539151_2539793_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|2539954_2540269_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2540328_2541612_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2541700_2543161_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2543196_2543400_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
2549796:2549812	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 10
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	2724049	2775400	5539892	holin,tRNA,integrase,terminase,portal,protease,tail	Escherichia_phage(39.66%)	64	2724684:2724709	2770039:2770064
WP_001295593.1|2724049_2724484_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
2724684:2724709	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001143784.1|2725064_2725706_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2725787_2726417_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2726489_2727065_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|2727177_2727447_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_153037815.1|2727448_2728771_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001228289.1|2728835_2729435_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000514990.1|2729502_2732976_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_122994373.1|2733216_2733846_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	7.9e-102
WP_000194797.1|2733791_2734535_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	1.4e-150
WP_001356552.1|2734545_2735244_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|2735243_2735573_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_046671471.1|2735569_2738215_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|2738258_2738567_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2738593_2739016_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2739029_2739782_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2739789_2740188_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2740200_2740824_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2740826_2741108_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2741100_2741427_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|2741514_2743539_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2743483_2744986_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|2744985_2745198_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2745194_2747318_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2747314_2747791_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2747823_2748096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2748307_2748493_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2748720_2748867_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2748866_2749436_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2749706_2750240_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|2750244_2750460_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2750537_2750783_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2750823_2751003_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_153037816.1|2751140_2753087_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000640110.1|2753788_2754331_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|2754327_2754618_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|2754617_2755217_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_071525388.1|2755288_2755540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902698.1|2755776_2755989_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|2756111_2757233_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|2757219_2757870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|2758024_2758255_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|2758251_2758674_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|2758689_2759451_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|2759473_2760220_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_001356605.1|2760226_2761015_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|2761092_2761515_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|2761511_2761754_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|2761850_2762270_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|2762576_2762729_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|2763140_2763989_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2764035_2764257_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001427414.1|2764256_2764427_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000102194.1|2764507_2767177_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|2767169_2767979_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|2768035_2768230_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2768222_2768411_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|2768510_2768726_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|2768727_2769963_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_001157382.1|2770014_2770950_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2770039:2770064	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123746.1|2771078_2772452_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2772484_2772655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2772929_2773913_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2774167_2775400_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 11
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	2858660	2918313	5539892	holin,integrase,terminase,portal,protease,tail	Enterobacteria_phage(34.78%)	71	2908023:2908037	2925630:2925644
WP_000422055.1|2858660_2859710_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2859929_2860688_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2860684_2861275_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2861314_2862187_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2862399_2863983_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2864010_2864631_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2864627_2865509_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2865646_2865691_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2865782_2867345_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2867344_2868940_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2868943_2870302_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2870313_2871507_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2871506_2872313_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2872693_2872873_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2872958_2873459_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2873504_2874011_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_032156508.1|2875048_2875633_-	protein kinase	NA	NA	NA	NA	NA
WP_001023406.1|2876767_2877037_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_153037817.1|2877038_2878352_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.4e-76
WP_001228289.1|2878416_2879016_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000514990.1|2879083_2882557_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_122994373.1|2882797_2883427_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	7.9e-102
WP_000194797.1|2883372_2884116_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	1.4e-150
WP_001356552.1|2884126_2884825_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|2884824_2885154_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_046671471.1|2885150_2887796_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|2887839_2888148_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2888174_2888597_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2888610_2889363_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2889370_2889769_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2889781_2890405_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2890407_2890689_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2890681_2891008_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|2891095_2893120_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2893064_2894567_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|2894566_2894779_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2894775_2896899_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2896895_2897372_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2897404_2897677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208683.1|2897888_2898074_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	8.1e-23
WP_153037818.1|2898290_2898824_-	glycoside hydrolase family protein	NA	A0A2R2Z343	Escherichia_phage	97.2	3.6e-100
WP_001072899.1|2898828_2899044_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2899121_2899367_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2899407_2899587_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_153037816.1|2899721_2901668_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000483514.1|2902171_2903230_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.3	4.9e-205
WP_000917735.1|2903380_2903578_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2903804_2904626_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2904622_2904997_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265189.1|2905009_2906059_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_024177817.1|2906060_2906330_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001452497.1|2906383_2906611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|2906834_2907206_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|2907198_2907516_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2907618_2907831_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
2908023:2908037	attL	CATATCAAGGTTAAC	NA	NA	NA	NA
WP_000211435.1|2908045_2908594_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000215514.1|2908941_2909127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537579.1|2909186_2909945_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
WP_001302109.1|2909979_2910402_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	2.2e-76
WP_000020565.1|2910433_2911474_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_000705370.1|2911445_2911997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2911980_2912208_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2912285_2912693_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|2912882_2913038_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|2913197_2913416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|2913419_2913584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2913981_2914170_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2914166_2914355_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|2914447_2916892_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|2916956_2917205_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|2917182_2918313_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
2925630:2925644	attR	GTTAACCTTGATATG	NA	NA	NA	NA
>prophage 12
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	2965009	3059981	5539892	head,transposase,tRNA,capsid,holin,integrase,terminase,portal,lysis,protease,tail	Enterobacteria_phage(48.21%)	103	2988174:2988189	3053884:3053899
WP_001299679.1|2965009_2966266_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2966479_2967103_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2967102_2967954_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2968104_2969052_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033348.1|2969176_2970856_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.0e-23
WP_000823885.1|2970910_2971189_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2971466_2972051_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2972167_2973259_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|2974102_2976988_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|2977087_2979007_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|2979713_2980325_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2980424_2981339_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2981434_2983171_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|2983273_2983363_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_085949318.1|2983328_2984542_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000197859.1|2984879_2985950_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2985959_2987258_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2987587_2989120_+	SpoVR family protein	NA	NA	NA	NA	NA
2988174:2988189	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2989171_2989891_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2990112_2991654_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2991799_2992330_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2992375_2993644_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2993643_2994063_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2994435_2995347_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2995553_2996015_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2996091_2996751_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2996822_2997116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874954.1|2997127_2997286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2997356_2997758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|2997860_2998229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2998748_2999444_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_153037819.1|2999467_3000280_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3000283_3000550_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3001781_3002366_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3002585_3003798_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001201843.1|3004177_3005131_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3005317_3006802_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3007104_3008643_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3008692_3009040_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3009036_3009417_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3009492_3009741_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3009797_3010466_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3010963_3011146_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3011224_3011725_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3011761_3012268_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3012286_3013177_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3013296_3013878_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3013877_3016793_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3016857_3017457_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3017523_3020922_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3020982_3021615_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3021551_3022295_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3022300_3022999_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3022998_3023328_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3023324_3025874_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3025866_3026301_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3026282_3026705_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3026720_3027461_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3027468_3027864_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3027860_3028439_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3028450_3028804_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3028815_3029214_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3029255_3030281_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3030335_3030668_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3030677_3031997_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3031977_3033579_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3033575_3033782_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3033778_3035704_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3035678_3036224_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3036612_3036807_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3036971_3037178_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3037463_3037874_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3038165_3038459_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3038549_3038732_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3038948_3039425_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3039411_3039717_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3040038_3040728_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3040724_3040865_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3040861_3041224_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3041220_3041511_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3041503_3041674_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3041673_3042129_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3042630_3044157_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3044214_3044337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3044401_3044734_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3044801_3045104_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3045100_3045802_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3045798_3046623_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088657.1|3046726_3046963_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3046952_3048095_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3048208_3049459_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3049630_3050284_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3050293_3050755_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3050808_3051915_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3051950_3052592_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3052595_3053966_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3053884:3053899	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3054134_3054806_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3054805_3056266_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3056866_3057148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3057403_3057946_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3058151_3058565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3058577_3058913_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3058925_3059981_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 13
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	3066073	3181670	5539892	head,transposase,holin,capsid,integrase,terminase,portal,tail	Stx2-converting_phage(33.64%)	136	3167237:3167257	3188326:3188346
WP_032174463.1|3066073_3067291_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_085952403.1|3067289_3068502_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001301987.1|3068864_3069986_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3070034_3071261_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3071510_3072647_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3072630_3073494_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3073857_3075219_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3075279_3075555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3075634_3075760_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3077863_3081265_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3081855_3084204_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3084223_3084313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3084325_3084562_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3084507_3085245_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3085298_3086177_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3086479_3086590_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3086699_3086954_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3086970_3087669_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3087668_3088010_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3088002_3091245_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3091292_3091502_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3091597_3091972_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3091986_3092703_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3092761_3093106_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3093102_3093549_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3093545_3093896_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3093905_3094232_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_106378527.1|3094311_3096651_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_001063099.1|3096596_3096818_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3096862_3098800_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3098863_3100525_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3100521_3101085_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|3101373_3101739_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|3101780_3102005_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3102086_3102401_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3102928_3103114_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|3103330_3103828_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|3103827_3104034_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_024748518.1|3104481_3106332_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|3106823_3107882_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|3108032_3108230_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762905.1|3108456_3109278_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.5e-84
WP_000904137.1|3109274_3109649_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001304183.1|3110712_3110991_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000967408.1|3111520_3111733_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|3111921_3112026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|3112141_3112504_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|3112500_3112872_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|3112907_3113120_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_153037898.1|3113168_3113525_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.1	5.3e-55
WP_001118161.1|3113581_3113977_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|3113992_3114763_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|3114792_3115533_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|3115539_3116493_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|3116515_3116941_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|3116924_3117200_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|3117302_3117692_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|3117860_3118013_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|3118500_3118689_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3118685_3118874_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102181.1|3118966_3121411_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|3121475_3121724_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|3121701_3122832_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000147167.1|3123319_3123538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|3124131_3124560_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|3126288_3126879_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3127062_3127710_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3127846_3127993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3128420_3128699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3129038_3129419_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3129415_3129763_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3129812_3131351_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|3134015_3135341_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3136367_3136637_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_153037820.1|3136638_3137952_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	4.6e-80
WP_001228304.1|3138103_3138703_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_153037899.1|3138770_3141116_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	99.6	0.0e+00
WP_001304109.1|3141067_3142243_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3142585_3143218_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|3143163_3143907_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|3143917_3144616_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|3144615_3144957_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|3144949_3148192_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3148244_3148454_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3148549_3148924_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3148929_3149646_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3149704_3150049_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3150045_3150492_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3150488_3150839_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3150848_3151175_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3151254_3153756_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3153701_3153923_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3153967_3155905_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3155968_3157630_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3157626_3158190_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3158481_3158847_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3158888_3159074_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3159203_3159344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3159700_3159925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3159989_3160196_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3160423_3160570_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3160569_3161139_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3161409_3161943_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3161993_3162338_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3162342_3162558_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3162633_3162903_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3162940_3163123_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3163270_3165208_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3165522_3165690_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3166286_3167108_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3167104_3167479_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3167237:3167257	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3167491_3168541_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3168542_3168821_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3168988_3169201_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3169389_3169494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3169609_3170197_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3170199_3170391_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3170392_3170830_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3170816_3171134_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3171087_3171405_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3171394_3171697_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3171693_3172011_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3172007_3172724_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3172757_3173180_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|3173211_3174249_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3174317_3174743_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3174726_3175050_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3175174_3175651_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3175966_3176119_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3176233_3176749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3176881_3177271_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3177332_3177602_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3177570_3178689_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3178855_3179650_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3179646_3180693_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3180848_3181670_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3188326:3188346	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 14
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	3432646	3506686	5539892	head,holin,transposase,integrase,terminase,portal,protease,tail	Escherichia_phage(33.33%)	72	3455264:3455279	3512345:3512360
WP_000003653.1|3432646_3433234_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3433230_3433938_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3433956_3435750_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3435746_3436865_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3438857_3439127_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3439128_3440442_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3440506_3441106_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3441173_3444647_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3444780_3445308_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3445498_3446131_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_088136431.1|3446076_3446820_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	1.2e-149
WP_001302968.1|3446830_3447529_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3447528_3447858_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3447854_3450434_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3450414_3450828_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3450854_3451286_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3451299_3452040_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3452021_3452288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3452345_3452693_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3452729_3454235_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3454224_3455817_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3455264:3455279	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3455813_3456020_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3457905_3458415_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3458809_3459034_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3459115_3459430_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3459956_3460142_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3460369_3460501_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3460513_3460696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3460851_3461385_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3461435_3461780_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3461784_3461991_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3462310_3463523_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153037831.1|3463605_3465456_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001059369.1|3466995_3467685_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3467681_3468041_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3468053_3469103_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3469104_3469383_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3469550_3469763_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3469949_3470054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3470163_3470727_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3470853_3471165_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3471161_3471314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3471346_3471703_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3471699_3471924_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3471945_3472644_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3472678_3473101_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|3473132_3474170_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3474238_3474664_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3474660_3474888_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3474985_3475630_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3475904_3476057_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3476537_3476726_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3476722_3476911_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3477006_3479478_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3479536_3479740_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|3479739_3480762_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|3480997_3481795_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3482284_3490267_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3490528_3491581_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3491894_3493211_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3493312_3494767_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3495109_3495826_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3496451_3498095_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3498212_3499163_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3499264_3500182_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3500638_3501574_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3501635_3502715_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3502726_3503470_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3503466_3504012_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3504373_3504754_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3504750_3505098_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3505147_3506686_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3512345:3512360	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	3510652	3582587	5539892	head,transposase,holin,capsid,integrase,terminase,lysis,protease,tail	Stx2-converting_phage(59.49%)	92	3526960:3526974	3589730:3589744
WP_148713549.1|3510652_3511865_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	4.8e-164
WP_032174098.1|3511831_3512731_+	vimentin yjdA	NA	NA	NA	NA	NA
WP_000203545.1|3512727_3513633_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|3513629_3514700_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|3514835_3515519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|3515534_3515945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|3516165_3516987_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860079.1|3517068_3517548_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001186192.1|3517562_3518039_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3518101_3518323_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|3518396_3518765_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|3519223_3519418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|3519430_3519544_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|3520032_3520215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|3520315_3520645_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|3520816_3521875_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|3522073_3522547_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|3522665_3523832_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_000491542.1|3526030_3526906_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
3526960:3526974	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023452.1|3527046_3527316_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_153037833.1|3527317_3528631_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.1	5.9e-83
WP_001230314.1|3528695_3529295_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000515107.1|3529361_3532841_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_050546863.1|3533100_3533733_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|3533678_3534416_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|3534469_3535393_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3535463_3535637_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3535744_3536065_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001179515.1|3536081_3536780_-|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_000807954.1|3536779_3537121_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_015994262.1|3537113_3540356_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|3540407_3540617_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3540712_3541087_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3541092_3541809_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3541867_3542212_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3542208_3542655_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3542651_3543002_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3543011_3543338_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|3545864_3546086_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173024.1|3546130_3548068_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_085948178.1|3549220_3550433_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000958396.1|3551102_3551666_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|3551957_3552323_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|3552364_3552592_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|3553054_3553312_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|3553308_3553806_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|3554008_3554446_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|3554442_3554940_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|3554939_3555155_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|3555231_3555504_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3555544_3555724_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143115.1|3555860_3557798_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_001303568.1|3558041_3558365_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|3558661_3558931_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_072140857.1|3558942_3559179_-	toxin	NA	Q5TJL6	Enterobacteria_phage	98.7	1.5e-37
WP_085952403.1|3559320_3560533_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000512807.1|3561864_3562353_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|3562343_3563015_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|3563011_3563617_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|3563616_3564339_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|3564413_3565178_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|3565452_3565635_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3565631_3566159_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|3566155_3566602_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|3566558_3566795_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|3566805_3567021_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001303053.1|3567153_3567375_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	1.1e-37
WP_001220560.1|3567949_3568561_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_001248388.1|3568639_3570016_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|3570012_3570834_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|3571014_3571311_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|3571452_3571668_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3571742_3572438_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3572939_3573461_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3574029_3574212_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3574189_3574462_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|3574520_3574772_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|3574954_3575323_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3575395_3575560_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3575528_3575672_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3575746_3576043_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3576048_3576834_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|3576830_3577511_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|3577507_3577690_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|3577662_3577854_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|3577864_3578146_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3578244_3578466_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|3578462_3579410_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|3580276_3580627_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|3580814_3581159_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|3581236_3581428_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|3581408_3582587_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
3589730:3589744	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 16
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	3668604	3769573	5539892	holin,tRNA,integrase,terminase,portal,protease,tail	Enterobacteria_phage(52.05%)	112	3722115:3722135	3767079:3767099
WP_000476014.1|3668604_3669966_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3670295_3670613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3671018_3671918_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3671999_3672779_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3672878_3673919_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3673966_3675322_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3675325_3675610_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3675640_3676093_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3676102_3677365_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3677393_3678248_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3678546_3679599_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|3679855_3681133_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3681129_3682134_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3682130_3683096_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3683069_3683816_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3683867_3684686_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3684750_3685551_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3685547_3686336_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3686669_3686909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3687959_3688307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3688316_3688631_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3688740_3689013_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134557.1|3689133_3689985_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3690202_3690541_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3690622_3691657_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3691667_3694148_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3694163_3694838_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3694925_3695468_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3695769_3696051_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3696312_3697422_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3697553_3699587_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3703549_3704830_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3706543_3710173_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3710234_3710552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153037835.1|3711792_3712881_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_001294377.1|3712891_3714421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3714439_3715171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3715163_3716300_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3716296_3718300_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3718424_3718886_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3718927_3719398_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3719444_3720164_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3720160_3721846_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3722115:3722135	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|3722360_3722609_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3722770_3723412_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3723493_3723910_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3724070_3724340_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_153037809.1|3724341_3725511_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	96.4	1.5e-82
WP_001426435.1|3725575_3726175_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_153037845.1|3726242_3729722_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_122997399.1|3729974_3730607_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_000194801.1|3730552_3731296_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3731306_3732005_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3732004_3732334_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_153037858.1|3732330_3734976_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.2	0.0e+00
WP_000532073.1|3735019_3735328_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3735354_3735777_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3735790_3736543_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3736550_3736949_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3736961_3737585_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3737587_3737869_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3737861_3738188_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|3738275_3740300_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|3740244_3741747_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3741746_3741959_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|3741955_3744079_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|3744075_3744552_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|3744584_3744857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|3745068_3745254_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3745481_3745628_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3745627_3746197_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3746467_3747001_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|3747005_3747221_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|3747298_3747544_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3747584_3747764_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_153037816.1|3747901_3749848_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_001356551.1|3750651_3750804_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3751052_3751487_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3751572_3751713_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3751709_3752072_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3752068_3752359_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3752351_3752522_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3752521_3752977_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3752973_3753075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3753165_3753447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3753490_3753688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3753915_3754200_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3754196_3754898_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|3754894_3755824_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|3755910_3756450_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3756813_3757506_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3757612_3759220_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3759723_3760014_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3760089_3760386_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3760391_3761177_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3761173_3761851_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3761850_3762033_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3762005_3762197_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3762207_3762489_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3762587_3762809_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3762805_3763753_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3763754_3763931_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3764264_3764621_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3764617_3764980_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3765067_3765310_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3765313_3765448_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3765466_3765721_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3765754_3767041_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3767061_3767763_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3767079:3767099	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3767822_3767930_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3767910_3768642_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3768646_3769573_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 17
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	4013853	4019240	5539892	integrase	Enterobacteria_phage(50.0%)	6	4004304:4004320	4016268:4016284
4004304:4004320	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|4013853_4014786_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|4015097_4016255_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|4016429_4017566_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
4016268:4016284	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|4017575_4018256_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|4018242_4018710_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|4018709_4019240_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 18
NZ_CP040305	Escherichia coli strain HB6 chromosome, complete genome	5539892	4260960	4320365	5539892	holin,transposase,tRNA,integrase,tail	Enterobacteria_phage(31.58%)	58	4278408:4278422	4325324:4325338
WP_000997403.1|4260960_4261998_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4262204_4262624_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4262692_4263391_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4263422_4266083_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4266196_4267552_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4267597_4267921_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4267917_4269216_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4274991_4277565_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4277694_4278426_-	polyphenol oxidase	NA	NA	NA	NA	NA
4278408:4278422	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4278422_4279403_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4279537_4280275_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4280545_4280887_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4280990_4281038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4281136_4282297_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4282339_4283461_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4283471_4284542_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4284751_4285117_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4285266_4285785_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4285774_4287001_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_153037886.1|4287016_4287499_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4287575_4287923_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4287964_4288732_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4288762_4289311_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4289329_4289578_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4289714_4291076_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4291242_4292034_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4292055_4293342_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4293396_4293990_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4294112_4294991_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|4295076_4296738_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4296886_4297228_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4297289_4297580_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4297569_4298046_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4298177_4298660_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4299505_4299754_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4300255_4300846_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4301028_4301679_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4301757_4302816_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4302945_4303368_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4303528_4303798_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4303799_4304366_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4304415_4304763_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4304759_4305140_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4305496_4305841_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4305845_4306061_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|4306210_4308064_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4308471_4308639_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4308724_4309468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4309720_4310344_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4310340_4311006_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4311002_4311614_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_153037889.1|4311588_4312155_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	8.6e-108
WP_001254939.1|4312454_4313210_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4313245_4313548_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000361847.1|4315292_4315706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4315803_4316202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|4317844_4319158_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4319159_4320365_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4325324:4325338	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 1
NZ_CP040306	Escherichia coli strain HB6 plasmid pO157, complete sequence	95621	8200	60690	95621	integrase,protease,transposase	Macacine_betaherpesvirus(35.71%)	45	NA	NA
WP_001034097.1|8200_12103_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_000998048.1|12404_13943_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|13992_14340_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|14336_14717_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_071525077.1|15949_16129_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|16730_17552_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|17551_18658_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|18747_20469_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|20542_21541_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_072141201.1|22410_25107_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25193_26069_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26126_28037_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28036_29542_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29543_30767_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_000082929.1|31227_31782_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31796_32144_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32140_32740_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32736_33714_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33752_34925_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34911_35424_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35481_36315_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36406_36808_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38698_39214_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|39215_42212_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42261_44382_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44385_45825_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45891_46086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46115_46400_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010891288.1|46568_46799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46919_47660_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47944_48922_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49329_49530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49526_50147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50143_50827_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51285_51504_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51505_51811_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51811_52618_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|53294_53375_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|53340_54554_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|54629_55385_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|55972_57139_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|57138_58110_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|58718_59621_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|59624_59930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|60006_60690_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
