The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	357247	371912	5401709	integrase,tail,tRNA	Enterobacteria_phage(40.0%)	18	358528:358543	376057:376072
WP_000956557.1|357247_357781_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|358198_358480_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358528:358543	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|358824_359022_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|359357_359642_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|359638_359989_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|359979_360516_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|361837_362437_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|362501_363815_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|363816_364086_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|364197_364770_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|364842_365472_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|365553_366195_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|366355_366604_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|366665_367763_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|367851_368889_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|369022_369265_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|369430_370414_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|370496_371912_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
376057:376072	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	508792	567820	5401709	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|508792_510052_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|510054_511059_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|511140_511338_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|511441_512740_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|512944_513370_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|513408_515850_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|516030_516762_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|516888_517290_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|517308_518007_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|518057_518717_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|518734_519133_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|519142_519781_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|519783_520947_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|521030_522656_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|522772_523048_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|523196_523526_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_153038067.1|523707_524457_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|524453_525209_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|526735_528133_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|528148_528454_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|528463_528928_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|528941_529592_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|529601_530456_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|530455_531142_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|531270_531546_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|531872_532268_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|532274_532589_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|532593_532821_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|532862_533312_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|533382_534177_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|534799_535231_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|535238_536447_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|536581_537220_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|537437_538058_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|538366_539779_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|539823_540486_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|540593_541559_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|541666_542527_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|542615_542996_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|543113_545057_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|545246_545987_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|546198_547137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|547199_547754_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|548078_548285_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|548380_549724_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|550046_550685_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|550890_552624_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|552620_556400_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|556402_556744_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|556955_557207_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|557200_557551_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|557630_558161_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|558470_559427_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|559566_561069_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|561082_562105_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|562091_563087_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|563119_564118_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|564293_565667_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|565822_566374_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|566467_567820_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	600240	612816	5401709		Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772662.1|600240_601515_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|601682_601988_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|602064_602799_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|602836_604081_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|604406_604979_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|605052_605553_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|605549_606284_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|606835_607102_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|607098_607689_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|607681_607969_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|607961_608417_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|608552_608873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|608887_611221_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|611576_611771_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|611988_612816_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
>prophage 4
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	1007579	1089597	5401709	integrase,holin,terminase,plate,head,capsid,lysis,transposase,tail,portal,protease	Shigella_phage(46.55%)	93	1024827:1024841	1090013:1090027
WP_000246433.1|1007579_1008911_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1008913_1009438_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1009434_1010715_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1010739_1011822_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1011785_1013636_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1013639_1014053_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1014143_1015535_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1015585_1015810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1015844_1016345_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1017041_1017560_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1017769_1019911_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|1019986_1024210_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|1024411_1024675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1024589_1024775_-	protein YncO	NA	NA	NA	NA	NA
1024827:1024841	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|1024855_1026028_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|1026145_1026916_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1027069_1027543_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|1027585_1030030_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|1030269_1030848_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|1030952_1031720_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1031690_1032431_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|1032586_1032847_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|1032865_1033126_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|1033311_1034085_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|1034902_1036642_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301640.1|1036601_1037372_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|1037442_1038498_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1038549_1038843_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|1038845_1039244_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059871.1|1039253_1039706_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|1040012_1040279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|1040211_1040748_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|1040804_1042262_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1042522_1042981_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|1043072_1044317_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|1044374_1044776_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1044814_1045870_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1046157_1047261_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1047272_1048526_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_000051887.1|1048730_1049894_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|1049770_1050205_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|1050120_1050426_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1050425_1050788_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1050778_1051315_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|1051991_1052288_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|1052565_1053258_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1053355_1053616_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1053608_1054160_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1054335_1054515_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1054504_1055446_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|1055442_1055937_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|1055936_1056590_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1056586_1056913_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1056909_1057299_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1057318_1058128_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1058135_1059125_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1059138_1059891_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|1060106_1060646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1060789_1061023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1061301_1061595_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1061731_1062067_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1062070_1062547_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1062763_1062946_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1063036_1063330_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_085948178.1|1064028_1065242_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000929175.1|1065644_1066139_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128484532.1|1066372_1067869_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|1068016_1069243_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|1069235_1069838_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|1069848_1071078_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|1071156_1071480_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|1071476_1071887_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|1071861_1072368_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|1072364_1072925_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|1072933_1073104_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|1073087_1074584_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|1074583_1074940_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|1074939_1075209_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|1075350_1077186_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|1077246_1078575_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|1078571_1079651_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|1079650_1080199_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|1080198_1080624_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1080610_1081669_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1081659_1082244_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_032195359.1|1082514_1082910_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_001008234.1|1082930_1083374_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|1083345_1083948_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001145352.1|1083947_1084466_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000905124.1|1084496_1085051_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1085111_1085885_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|1086709_1087453_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1088415_1089597_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1090013:1090027	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 5
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	1668563	1706658	5401709	integrase,holin,terminase,lysis,tail,portal,protease	Enterobacteria_phage(51.22%)	48	1658005:1658019	1690294:1690308
1658005:1658019	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|1668563_1669445_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|1669607_1669826_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1669865_1670033_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1670275_1670878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1671088_1671310_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1671408_1671690_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1671700_1671892_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1671864_1672047_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1672043_1672724_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1673421_1673604_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1673600_1673771_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1673763_1674384_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1674380_1675046_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1675257_1676217_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1676554_1676677_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1676691_1677381_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1677564_1678308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1678393_1678552_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1678632_1679031_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1679173_1679389_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1679388_1679886_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1679882_1680350_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1680337_1680490_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000934137.1|1681654_1683757_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|1683753_1683966_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1683893_1685018_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1685139_1685475_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|1685419_1687447_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|1687533_1687857_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1687849_1688125_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1688136_1688715_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1688711_1689113_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1689123_1689867_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_153038097.1|1689927_1690314_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
1690294:1690308	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1690322_1690652_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1690623_1693689_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1693688_1694018_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1694027_1694726_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1694731_1695475_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001508920.1|1695411_1696020_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	7.1e-100
WP_001233141.1|1699564_1700164_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1700223_1701540_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1701541_1701811_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1701987_1702968_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1703001_1704021_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1704517_1704679_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1704847_1705729_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|1705959_1706658_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 6
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	1923366	1992931	5401709	integrase,holin,head,transposase,portal,tail,protease	Escherichia_phage(26.67%)	79	1931854:1931869	1953220:1953235
WP_000156526.1|1923366_1925127_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1925312_1925765_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1925840_1926881_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1927237_1927747_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1927965_1928595_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1928557_1930720_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1930729_1931176_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1931298_1933353_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1931854:1931869	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1933384_1933843_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1933938_1934601_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1934773_1935187_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1935231_1935549_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1935606_1936797_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1936891_1937170_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1937166_1937496_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1937586_1938246_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1938653_1939673_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1939650_1939893_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1939960_1942432_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1942525_1942717_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1942713_1942902_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1943475_1943661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1943847_1944237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1944378_1944534_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1944811_1945099_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1945098_1945290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1945317_1945719_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1945827_1946100_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1946083_1946509_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1946715_1947171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1947249_1948341_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1948347_1949094_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1949115_1949886_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1949901_1950315_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1950666_1951440_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1951805_1951943_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1951987_1952200_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1952367_1952646_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1952647_1953697_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1953220:1953235	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1953709_1954081_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1954070_1954442_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1954593_1955412_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1955698_1955938_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1956032_1956746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1957512_1959363_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1959538_1960751_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1960956_1961271_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1961798_1961984_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1962205_1962319_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1962539_1963073_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1963232_1963505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1963760_1963967_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1964717_1964993_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1965068_1965449_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1965445_1965793_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1965842_1967381_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1967430_1967673_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1969557_1969764_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1969760_1971353_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1971342_1972848_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1972884_1973232_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1973289_1973556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1973537_1974278_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1974291_1974723_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1974749_1975163_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1975143_1977723_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1977719_1978049_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1978048_1978747_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_001371725.1|1978757_1979501_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	8.6e-148
WP_050546863.1|1979446_1980079_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1980269_1980797_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1980930_1984404_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1984471_1985071_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1985135_1986449_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1986450_1986720_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1988712_1989831_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1989827_1991621_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1991639_1992347_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1992343_1992931_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	2243915	2364465	5401709	integrase,holin,terminase,head,capsid,tRNA,lysis,transposase,tail,portal,protease	Enterobacteria_phage(38.18%)	155	2309826:2309841	2338080:2338095
WP_000952736.1|2243915_2244737_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2244892_2245939_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2245935_2246730_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2246896_2248015_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2247983_2248253_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2248314_2248704_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2248836_2249352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2249466_2249619_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2249934_2250411_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2250535_2250859_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2250842_2251268_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2251336_2252374_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|2252405_2252828_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|2252861_2253578_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2253574_2253892_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_153038080.1|2253888_2254191_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	86.9	7.2e-45
WP_001017965.1|2254180_2254498_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2254451_2254769_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2254755_2255193_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2255194_2255386_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2255388_2255976_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2256091_2256196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2256384_2256597_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2256764_2257043_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|2257044_2258094_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|2258106_2258481_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2258477_2259299_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2259895_2260063_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|2260377_2262315_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2262462_2262645_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2262682_2262952_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2263027_2263243_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2263247_2263592_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2263642_2264176_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2264446_2265016_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2265015_2265162_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2265389_2265596_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2265660_2265885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2266241_2266382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2266511_2266697_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2266738_2267104_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2267395_2267959_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2267955_2269617_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2269680_2271618_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2271662_2271884_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2271829_2274331_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2274410_2274737_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2274746_2275097_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2275093_2275540_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2275536_2275881_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2275939_2276656_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2276670_2277045_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2277140_2277350_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2277397_2280640_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2280632_2280974_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2280973_2281672_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2281688_2281943_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2282052_2282163_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2282465_2283344_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2283397_2284135_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2284080_2284317_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2284329_2284419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2284438_2286787_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2287377_2290779_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2292882_2293008_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2293087_2293363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2293423_2294785_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2295148_2296012_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2295995_2297132_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2297381_2298608_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2298656_2299778_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|2300139_2301353_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|2301351_2302569_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2302933_2303122_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2303171_2303498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|2303622_2303796_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|2303926_2304124_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2304116_2304329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2304318_2304783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2304775_2305009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2305014_2305314_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2305310_2306711_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2306911_2307163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2307159_2307570_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2307580_2307853_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2307979_2308204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2308455_2308662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2308661_2309717_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2309729_2310065_+|head	head decoration protein	head	NA	NA	NA	NA
2309826:2309841	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2310077_2310491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2310696_2311239_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2311494_2311776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2312376_2313837_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2313836_2314508_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2314676_2316047_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2316050_2316692_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2316727_2317834_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2317887_2318349_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2318358_2319012_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2319183_2320434_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2320547_2321690_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2321679_2321916_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2322019_2322844_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2322840_2323542_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2323538_2323841_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2323908_2324241_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2324305_2324428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2324485_2326012_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2326513_2326969_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2326968_2327139_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2327131_2327422_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2327418_2327781_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2327777_2327918_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2327914_2328604_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2328925_2329231_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2329217_2329694_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2329910_2330093_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2330183_2330477_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2330768_2331179_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2331464_2331671_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2331835_2332030_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2332418_2332964_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_024748455.1|2332938_2334864_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|2334860_2335067_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2335063_2336665_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2336645_2337965_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2337974_2338307_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2338080:2338095	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2338361_2339387_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2339428_2339827_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2339838_2340192_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2340203_2340782_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2340778_2341174_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2341181_2341922_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2341937_2342360_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2342341_2342776_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001509030.1|2342768_2345318_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000847331.1|2345314_2345644_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2345643_2346342_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2346347_2347091_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2347027_2347660_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2347720_2351119_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2351185_2351785_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2351849_2354765_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2354764_2355346_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2355465_2356356_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2356374_2356881_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2356917_2357418_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2357496_2357679_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2358176_2358845_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2358901_2359150_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2359225_2359606_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2359602_2359950_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2359999_2361538_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2361840_2363325_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2363511_2364465_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 8
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	2449049	2516576	5401709	integrase,holin,terminase,head,capsid,transposase,tail,portal,protease	Stx2-converting_phage(38.78%)	73	2448886:2448913	2501048:2501075
2448886:2448913	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2449049_2450180_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2450157_2450406_-	excisionase	NA	NA	NA	NA	NA
WP_153038081.1|2450470_2452942_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2453034_2453226_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2453222_2453411_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2453808_2453976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2453969_2454203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2454180_2454588_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2454610_2454829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2454901_2455201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2455464_2455872_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2455948_2456176_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2456159_2456711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2456682_2457723_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2457754_2458177_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2458363_2458945_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2458941_2459106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2459804_2460563_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2460841_2461054_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2461274_2461532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2461601_2461880_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2461881_2462928_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2462940_2463300_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2463308_2463839_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2464080_2464278_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2464428_2465487_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2466283_2468137_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2468286_2468502_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2468506_2468851_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2468901_2469435_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2469705_2470275_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2470274_2470421_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2470648_2470834_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2471258_2471486_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2471527_2471893_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|2472182_2472746_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2472742_2474404_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2474467_2476405_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2476449_2476671_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2476616_2479118_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2479197_2479524_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2479533_2479884_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2479880_2480327_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2480323_2480668_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2480726_2481443_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2481448_2481823_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2481918_2482128_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2482180_2485423_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2485415_2485757_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2485756_2486455_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_024748465.1|2486465_2487209_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	6.6e-148
WP_129137391.1|2487154_2487787_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748464.1|2488033_2491513_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230495.1|2491579_2492179_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748463.1|2492243_2493557_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001023426.1|2493558_2493828_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_085952403.1|2495476_2496690_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001079499.1|2501225_2501732_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2501048:2501075	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2501777_2502278_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2502363_2502543_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2502923_2503730_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2503729_2504923_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001416116.1|2504934_2506293_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000763503.1|2506296_2507892_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2507891_2509454_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2509545_2509590_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2509727_2510609_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2510605_2511226_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2511253_2512837_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2513049_2513922_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2513961_2514552_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2514548_2515307_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2515526_2516576_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	2789286	2936635	5401709	holin,integrase,terminase,head,capsid,transposase,tail,portal	Stx2-converting_phage(30.77%)	176	2836310:2836357	2939520:2939567
WP_000214712.1|2789286_2789490_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2789525_2790986_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2791074_2792358_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2792417_2792732_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2792893_2793535_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_153038083.1|2793616_2794207_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	94.0	7.4e-78
WP_001131658.1|2794279_2794855_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2794968_2795238_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|2795239_2796553_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230509.1|2796617_2797217_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_137049505.1|2797284_2800695_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_050546863.1|2800998_2801631_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_024748514.1|2801576_2802320_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_001416783.1|2802330_2803029_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|2803028_2803358_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748467.1|2803354_2805967_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000533440.1|2805947_2806361_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2806387_2806810_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2806823_2807576_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2807583_2807979_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2807975_2808509_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2808523_2808877_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2808888_2809287_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_024748468.1|2809328_2810354_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	9.6e-190
WP_001295978.1|2810409_2810742_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2810751_2812071_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2812051_2813653_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2813649_2813856_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_153038084.1|2813852_2815778_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	97.8	0.0e+00
WP_000867498.1|2815752_2816298_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2816684_2816909_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2816990_2817305_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2817830_2818016_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2818238_2818385_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2818384_2818954_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2819224_2819758_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2819808_2820153_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2820157_2820364_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|2820812_2822663_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2823140_2823572_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2824022_2824736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2824871_2825069_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2825293_2825848_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2825910_2826216_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2826228_2827278_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2827279_2827552_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2827673_2828018_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2828137_2828350_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2828583_2829141_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2829142_2829361_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2829488_2829800_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2829792_2830020_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2830016_2830298_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2830330_2831047_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|2831080_2831503_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|2831534_2832578_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2832646_2833072_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2833055_2833298_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2833689_2834028_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2834320_2834473_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2834484_2835123_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2835123_2835333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2835897_2836086_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2836082_2836271_+	DUF1482 family protein	NA	NA	NA	NA	NA
2836310:2836357	attL	ATGCCAGCAATGGCAGGGATTTGTTCACCCTTAAATCTGTAATGAGGT	NA	NA	NA	NA
WP_000102123.1|2836363_2837608_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|2838246_2838561_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2839523_2839904_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2839900_2840248_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2840297_2841836_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2842418_2843069_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2843778_2844354_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2844467_2844737_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_153038085.1|2844738_2845908_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	3.6e-84
WP_001230509.1|2845972_2846572_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_001304111.1|2846639_2846855_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|2846857_2850118_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_024748472.1|2850305_2850743_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|2850742_2851084_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2851076_2854319_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2854366_2854576_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2854671_2855046_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2855060_2855777_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2855835_2856180_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2856176_2856623_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2856619_2856970_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2856979_2857306_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2857385_2859887_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2859832_2860054_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2860098_2862036_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2862099_2863761_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2863757_2864321_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|2864609_2864975_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2865016_2865241_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2865322_2865637_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2866164_2866350_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|2866566_2867064_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|2867063_2867270_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_024748518.1|2867717_2869568_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|2870059_2871118_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|2871268_2871466_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|2871692_2872514_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|2872510_2872885_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001304183.1|2873948_2874227_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000967408.1|2874756_2874969_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2875157_2875262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|2875377_2875740_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|2875736_2876108_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2876143_2876356_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2876404_2876761_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2876817_2877213_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|2877228_2877999_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|2878028_2878769_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|2878775_2879729_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|2879751_2880177_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2880160_2880436_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2880538_2880928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|2881097_2881250_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|2881737_2881926_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2881922_2882111_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102181.1|2882203_2884648_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|2884712_2884961_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|2884938_2886069_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000147167.1|2886556_2886775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2887368_2887797_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2889525_2890116_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2890299_2890947_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2891083_2891230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2891657_2891936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2892275_2892656_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2892652_2893000_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2893049_2894588_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|2897252_2898578_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2899604_2899874_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_024748516.1|2899875_2901189_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001228304.1|2901340_2901940_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2902007_2904353_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2904304_2905480_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2905822_2906455_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|2906400_2907144_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|2907154_2907853_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2907852_2908194_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2908186_2911429_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2911481_2911691_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2911786_2912161_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2912166_2912883_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2912941_2913286_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2913282_2913729_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2913725_2914076_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2914085_2914412_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2914491_2916993_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2916938_2917160_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2917204_2919142_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_024748457.1|2919205_2920867_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_001303051.1|2920863_2921427_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|2921716_2922082_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2922123_2922351_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2922775_2922961_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2923188_2923335_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2923334_2923904_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2924174_2924708_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2924758_2925103_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2925107_2925314_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|2925762_2927613_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2928091_2928520_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2929155_2929845_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2929841_2930201_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2930213_2931263_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2931264_2931543_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2931710_2931923_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2932111_2932216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2932331_2932916_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2932972_2933368_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2934178_2934919_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2934925_2935888_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2935910_2936336_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2936332_2936635_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
2939520:2939567	attR	ATGCCAGCAATGGCAGGGATTTGTTCACCCTTAAATCTGTAATGAGGT	NA	NA	NA	NA
>prophage 10
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	3250194	3302629	5401709	integrase,transposase,tail,tRNA	Enterobacteria_phage(64.52%)	60	3243418:3243433	3302708:3302723
3243418:3243433	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3250194_3251928_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3252104_3252593_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3252712_3253105_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3253104_3255183_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3255175_3256324_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3256525_3257170_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3257180_3257570_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3257584_3258634_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3258636_3259497_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3259515_3261117_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3261162_3262824_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3262966_3263470_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3263490_3265455_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3265459_3266386_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3266382_3267270_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3267396_3267975_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3267977_3268328_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3269107_3269536_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3269542_3270967_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3270941_3271742_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3271908_3272895_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3272909_3274424_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3274493_3275483_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3276279_3276783_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3276862_3277114_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3277228_3277315_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3277576_3277900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3278070_3278568_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3278604_3278844_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3279035_3280247_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3280308_3280974_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|3281330_3282332_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3282337_3282685_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3282714_3283365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3283380_3283785_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3283874_3284012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3284083_3284287_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3284308_3284659_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3284669_3284948_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3284959_3285202_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3285198_3285312_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3285404_3285821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3285844_3286048_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3286044_3286311_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3286307_3286607_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3286929_3287160_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3287232_3287598_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3287604_3290427_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3290503_3291463_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3291467_3291782_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3292987_3293404_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3293447_3294020_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3294176_3294665_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_085952403.1|3295176_3296390_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000763327.1|3298780_3298909_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3298944_3299310_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3299364_3299877_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3299876_3301061_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3301218_3301542_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3301492_3302629_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3302708:3302723	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	3360200	3427271	5401709	holin,integrase,terminase,head,transposase,tail,portal	Enterobacteria_phage(31.11%)	68	3375864:3375879	3431616:3431631
WP_001023396.1|3360200_3360470_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_153038086.1|3360471_3361641_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	97.4	2.8e-84
WP_001230509.1|3361705_3362305_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000514788.1|3362372_3365852_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_129137391.1|3366098_3366731_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_153038087.1|3366676_3367420_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.0	1.5e-144
WP_001151105.1|3367430_3368129_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3368128_3368458_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3368454_3371034_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3371014_3371428_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3371454_3371886_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3371899_3372640_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3372621_3372888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3372945_3373293_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3373329_3374835_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3374824_3376417_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3375864:3375879	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3376413_3376620_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3376603_3378532_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|3378503_3379013_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3379407_3379632_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3379713_3380028_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3380554_3380740_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3380967_3381099_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3381111_3381294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3381449_3381983_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3382033_3382378_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3382382_3382589_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3382908_3384121_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|3384203_3386054_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3387593_3388283_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3388279_3388639_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3388651_3389701_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3389702_3389981_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3390148_3390361_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3390547_3390652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3390761_3391325_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3391451_3391763_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3391759_3391912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3391944_3392301_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3392297_3392522_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3392543_3393242_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3393276_3393699_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_024748451.1|3393730_3394768_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3394836_3395262_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3395258_3395486_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3395583_3396228_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3396502_3396655_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3397135_3397324_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3397320_3397509_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3397604_3400076_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3400134_3400338_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_046671474.1|3400337_3401372_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.1e-99
WP_001302302.1|3401582_3402380_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3402869_3410852_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3411113_3412166_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3412479_3413796_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3413897_3415352_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3415694_3416411_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3417036_3418680_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3418797_3419748_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3419849_3420767_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3421223_3422159_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3422220_3423300_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3423311_3424055_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3424051_3424597_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3424958_3425339_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3425335_3425683_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3425732_3427271_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3431616:3431631	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	3529150	3630093	5401709	holin,integrase,terminase,tRNA,tail,portal,protease	Enterobacteria_phage(50.7%)	109	3582651:3582671	3627599:3627619
WP_000476014.1|3529150_3530512_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3530841_3531159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3531564_3532464_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3532545_3533325_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3533424_3534465_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3534512_3535868_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3535871_3536156_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3536186_3536639_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3536648_3537911_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3537939_3538794_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3539092_3540145_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_024177454.1|3540401_3541679_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3541675_3542680_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3542676_3543642_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3543615_3544362_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3544413_3545232_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3545296_3546097_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3546093_3546882_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3547215_3547455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3548505_3548853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3548862_3549177_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3549286_3549559_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|3549679_3550531_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3550748_3551087_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3551168_3552203_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3552213_3554694_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3554709_3555384_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3555471_3556014_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3556305_3556587_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3556848_3557958_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3558089_3560123_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3564085_3565366_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3567079_3570709_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3570770_3571088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3572328_3573417_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3573427_3574957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3574975_3575707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3575699_3576836_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3576832_3578836_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3578960_3579422_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3579463_3579934_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3579980_3580700_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3580696_3582382_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3582651:3582671	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|3582896_3583145_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3583306_3583948_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3584029_3584446_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3584606_3584876_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3584877_3586047_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|3586111_3586711_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_137049505.1|3586778_3590189_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_050546863.1|3590492_3591125_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_024748514.1|3591070_3591814_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_001416783.1|3591824_3592523_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|3592522_3592852_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532073.1|3595537_3595846_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3595872_3596295_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_024748478.1|3596308_3597061_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000682716.1|3597068_3597467_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3597479_3598103_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3598105_3598387_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3598379_3598706_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|3598793_3600818_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|3600762_3602265_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3602264_3602477_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3602473_3604597_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|3604593_3605070_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|3605587_3605773_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3606000_3606147_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3606146_3606716_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3606986_3607520_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3607524_3607740_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3607817_3608063_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3608103_3608283_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001356551.1|3611171_3611324_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3611572_3612007_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3612092_3612233_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3612229_3612592_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3612588_3612879_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3612871_3613042_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3613041_3613497_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3613493_3613595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3613685_3613967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3614010_3614208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3614435_3614720_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3614716_3615418_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|3615414_3616344_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|3616430_3616970_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3617333_3618026_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3618132_3619740_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3620243_3620534_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3620609_3620906_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3620911_3621697_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3621693_3622371_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3622370_3622553_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3622525_3622717_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3622727_3623009_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3623107_3623329_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3623325_3624273_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3624274_3624451_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3624784_3625141_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3625137_3625500_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3625587_3625830_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3625833_3625968_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3625986_3626241_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3626274_3627561_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3627581_3628283_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3627599:3627619	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3628342_3628450_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3628430_3629162_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3629166_3630093_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	3874374	3879761	5401709	integrase	Enterobacteria_phage(50.0%)	6	3864825:3864841	3876789:3876805
3864825:3864841	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3874374_3875307_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3875618_3876776_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_153038089.1|3876950_3878087_-	acyltransferase	NA	Q716G3	Shigella_phage	72.4	9.0e-80
3876789:3876805	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3878096_3878777_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3878763_3879231_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3879230_3879761_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 14
NZ_CP040309	Escherichia coli strain 21B8 chromosome, complete genome	5401709	4121480	4180970	5401709	holin,integrase,tRNA,transposase,tail	Enterobacteria_phage(31.58%)	59	4138928:4138942	4185929:4185943
WP_000997403.1|4121480_4122518_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4122724_4123144_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4123212_4123911_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4123942_4126603_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4126716_4128072_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4128117_4128441_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4128437_4129736_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4135511_4138085_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4138214_4138946_-	polyphenol oxidase	NA	NA	NA	NA	NA
4138928:4138942	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4138942_4139923_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4140057_4140795_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4141065_4141407_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4141510_4141558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4141656_4142817_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4142859_4143981_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4143991_4145062_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4145271_4145637_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4145786_4146305_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4146294_4147521_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4147536_4148019_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4148095_4148443_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4148484_4149252_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4149282_4149831_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4149849_4150098_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4150234_4151596_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4151762_4152554_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4152575_4153862_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4153916_4154510_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4154632_4155511_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|4155596_4157258_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4157406_4157748_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4157809_4158100_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4158089_4158566_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4158697_4159180_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4160025_4160274_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4160775_4161366_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4161548_4162199_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4162277_4163336_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4163465_4163888_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4164048_4164318_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4164319_4164886_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4164935_4165283_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4165279_4165660_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4166016_4166361_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4166365_4166581_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|4166730_4168584_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4168991_4169159_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4169244_4169988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4170240_4170864_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4170860_4171526_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4171522_4172134_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|4172108_4172675_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|4173046_4173802_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4173837_4174140_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_064234917.1|4174215_4175502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4175897_4176311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4176408_4176807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|4178449_4179763_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4179764_4180970_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4185929:4185943	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 1
NZ_CP040310	Escherichia coli strain 21B8 plasmid pO157, complete sequence	93175	8201	58244	93175	protease,transposase,integrase	Macacine_betaherpesvirus(45.45%)	42	NA	NA
WP_001034097.1|8201_12104_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_071525077.1|13500_13680_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14281_15103_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15102_16209_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16298_18020_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18093_19092_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_072141201.1|19964_22661_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|22747_23623_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|23680_25591_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|25590_27096_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|27097_28321_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_000082929.1|28781_29336_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|29350_29698_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|29694_30294_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|30290_31268_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|31306_32479_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|32465_32978_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|33035_33869_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|33960_34362_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|36252_36768_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|36769_39766_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|39815_41936_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|41939_43379_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|43445_43640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|43669_43954_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010891288.1|44122_44353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|44473_45214_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|45498_46476_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|46883_47084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|47080_47701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|47697_48381_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|48839_49058_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|49059_49365_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|49365_50172_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|50848_50929_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|50894_52108_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|52183_52939_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|53526_54693_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|54692_55664_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|56272_57175_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|57178_57484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|57560_58244_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
