The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	152826	233510	5449111	capsid,integrase,portal,head,holin,terminase,tRNA,protease,lysis,plate,tail	Escherichia_phage(46.67%)	88	185545:185591	216039:216085
WP_000560983.1|152826_153264_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|153308_154250_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000226329.1|154660_155554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304016.1|155560_156475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|157168_157387_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086384.1|157603_157846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|158175_159105_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|159101_159737_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331376.1|159733_160636_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077626213.1|160648_163699_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|163892_164726_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001301617.1|164878_165934_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931343.1|165983_167732_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001019475.1|167731_168802_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446027.1|168791_170231_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729611.1|170241_170688_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000749921.1|171165_172560_+	glycoporin	NA	NA	NA	NA	NA
WP_000619508.1|172600_172915_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179721.1|172924_173749_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001301857.1|173923_175183_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144081.1|175179_176649_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217135.1|176936_177773_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001301668.1|177756_178695_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_001297064.1|180010_180631_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166037.1|180890_181874_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270249.1|182022_182697_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|182802_184176_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|184172_184871_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|185020_185521_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
185545:185591	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_153021268.1|185707_186688_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.8e-185
WP_000777029.1|186757_187051_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|187187_187460_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|187629_188130_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|188193_188418_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277903.1|188417_188720_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	2.5e-45
WP_001113264.1|188719_188944_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|188940_189216_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000423599.1|191819_194027_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038188.1|194457_195492_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000156861.1|195491_197264_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|197437_198292_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248539.1|198350_199424_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	4.3e-201
WP_000203462.1|199427_200171_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_000988636.1|200270_200780_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846399.1|200779_200983_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|200986_201268_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|201267_201765_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736576.1|201779_202205_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	7.2e-59
WP_000040680.1|202192_202618_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	94.3	1.7e-63
WP_001440152.1|202589_202763_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917162.1|202725_203193_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001001780.1|203185_203638_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093730.1|203704_204340_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
WP_000127163.1|204336_204684_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121488.1|204688_205597_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	3.7e-161
WP_001285307.1|205589_206201_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_001691087.1|206197_207391_+|tail	phage tail-collar fiber family protein	tail	A0A0F7LBW5	Escherichia_phage	87.5	6.0e-159
WP_000639074.1|207399_207795_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001008235.1|207766_208210_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_001127579.1|208230_208641_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	95.2	3.2e-64
WP_001690910.1|208671_209265_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.4	1.6e-101
WP_001690909.1|209324_210515_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
WP_001251408.1|210527_211046_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|211102_211378_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|211410_211530_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069918.1|211522_213970_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000978907.1|213984_214464_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882927.1|214463_215627_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	96.9	5.0e-203
WP_000468308.1|215708_215927_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|216163_217066_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
216039:216085	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|217246_218209_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045681.1|218527_219517_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708998.1|219623_220379_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|220433_221201_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|221308_221908_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|222008_222449_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|222660_222960_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|222986_223415_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796310.1|223419_224166_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250658.1|224262_225273_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|225502_227011_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|227033_227879_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|228304_228550_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000232687.1|228588_229215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872908.1|230067_230553_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001308187.1|230645_231572_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|231638_232970_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|232979_233510_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	386054	400719	5449111	integrase,tRNA,tail	Enterobacteria_phage(40.0%)	18	387335:387350	404864:404879
WP_000956557.1|386054_386588_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|387005_387287_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
387335:387350	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|387631_387829_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|388164_388449_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|388445_388796_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|388786_389323_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|390644_391244_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_153021269.1|391308_392622_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	5.5e-81
WP_001023355.1|392623_392893_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|393004_393577_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|393649_394279_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|394360_395002_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|395162_395411_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|395472_396570_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|396658_397696_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|397829_398072_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|398237_399221_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|399303_400719_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
404864:404879	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 3
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	537599	596626	5449111	protease,transposase	Pectobacterium_phage(11.11%)	59	NA	NA
WP_000312488.1|537599_538859_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|538861_539866_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|539947_540145_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|540248_541547_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|541751_542177_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|542215_544657_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|544837_545569_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|545695_546097_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|546115_546814_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|546864_547524_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|547541_547940_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|547949_548588_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|548590_549754_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|549837_551463_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|551579_551855_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|552003_552333_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000133631.1|553259_554015_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|555541_556939_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|556954_557260_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|557269_557734_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|557747_558398_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|558407_559262_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|559261_559948_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|560076_560352_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|560678_561074_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|561080_561395_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|561399_561627_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|561668_562118_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|562188_562983_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|563605_564037_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|564044_565253_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|565387_566026_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|566243_566864_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|567172_568585_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|568629_569292_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|569399_570365_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|570472_571333_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|571421_571802_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|571919_573863_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|574052_574793_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|575004_575943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|576005_576560_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|576884_577091_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|577186_578530_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|578852_579491_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_021501242.1|579696_581430_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|581426_585206_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|585208_585550_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|585761_586013_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|586006_586357_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|586436_586967_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|587276_588233_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|588372_589875_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|589888_590911_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|590897_591893_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|591925_592924_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|593099_594473_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|594628_595180_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|595273_596626_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 4
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	629028	641604	5449111		Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772662.1|629028_630303_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|630470_630776_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|630852_631587_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|631624_632869_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|633194_633767_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|633840_634341_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|634337_635072_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|635623_635890_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|635886_636477_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|636469_636757_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|636749_637205_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|637340_637661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|637675_640009_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|640364_640559_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|640776_641604_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
>prophage 5
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	997379	1061610	5449111	plate,tRNA,transposase	uncultured_Caudovirales_phage(40.0%)	53	NA	NA
WP_000176537.1|997379_998675_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|998727_998988_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|998974_999175_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|999340_999886_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|999882_1000293_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|1000306_1001017_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|1001216_1002041_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|1002093_1003812_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|1003922_1004630_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|1004626_1005031_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|1005148_1005964_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|1006003_1006657_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1006649_1007681_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|1007868_1008444_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|1014203_1015007_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|1015003_1015918_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1016158_1016959_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|1017036_1017807_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|1017854_1019213_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|1019284_1020040_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|1020073_1020796_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1020792_1021260_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|1021324_1022056_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|1022593_1023394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|1023871_1024321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|1024323_1024920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414527.1|1025067_1025220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|1025240_1025720_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|1025685_1027095_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|1027105_1030540_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|1030676_1032089_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|1032093_1032837_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|1032833_1035611_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|1035619_1036381_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246414.1|1036385_1037717_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1037719_1038244_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348794.1|1039531_1040614_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1040577_1042428_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1042431_1042845_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1042935_1044327_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1044377_1044602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1044636_1045137_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1045833_1046352_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1046561_1048703_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_115245597.1|1048778_1053011_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|1053150_1053867_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000339420.1|1054048_1055557_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_001475373.1|1055625_1056147_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|1056892_1058029_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|1058031_1059792_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|1059993_1060257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1060171_1060357_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|1060437_1061610_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	1080396	1160915	5449111	capsid,integrase,portal,head,holin,transposase,terminase,protease,lysis,plate,tail	Shigella_phage(42.62%)	97	1082935:1082951	1167743:1167759
WP_000749881.1|1080396_1081452_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1081739_1082843_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1082854_1084108_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
1082935:1082951	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|1084312_1085476_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|1085352_1085787_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|1085702_1086008_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1086007_1086370_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1086360_1086897_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000141753.1|1087410_1087656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115333674.1|1087694_1087829_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	77.4	8.4e-06
WP_085952403.1|1087794_1089008_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001020634.1|1089460_1090153_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1090250_1090511_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1090503_1091055_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1091230_1091410_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1091399_1092341_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072131649.1|1092337_1092832_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_001303054.1|1092831_1093485_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1093481_1093808_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1093804_1094194_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1094213_1095023_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1095030_1096020_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1096033_1096786_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|1097000_1097540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1097683_1097917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1098195_1098489_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1098625_1098961_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1098964_1099441_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1099657_1099840_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1099930_1100224_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_149008237.1|1100720_1102100_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.6	4.1e-252
WP_000923141.1|1102247_1103474_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|1103466_1104069_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|1104079_1105309_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|1105387_1105711_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_085948178.1|1105791_1107005_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_050579203.1|1107059_1107431_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	91.9	2.3e-61
WP_000224836.1|1107405_1107912_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|1107908_1108469_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|1108477_1108648_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|1108631_1110128_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|1110127_1110484_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|1110483_1110753_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|1110894_1112730_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|1112790_1114119_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|1114115_1115195_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|1115194_1115743_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|1115742_1116168_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1116154_1117213_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1117203_1117788_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000554706.1|1117791_1118562_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000368084.1|1118561_1119164_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|1119135_1119579_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_001145350.1|1119599_1120010_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_000905124.1|1120040_1120595_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1120655_1121429_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|1122253_1122997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1123959_1125141_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|1125144_1125561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|1125533_1126151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|1126150_1126609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|1126601_1127234_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|1127264_1127855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|1127854_1128421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|1128830_1129103_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|1129108_1129660_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|1129656_1130409_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|1131342_1131603_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|1131599_1132157_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|1132153_1132375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|1132374_1132698_+	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_000016225.1|1132711_1135045_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|1135177_1136134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|1136809_1137709_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|1137807_1138530_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|1138696_1138975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|1139677_1140580_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|1140825_1141884_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|1142025_1143153_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|1143331_1144288_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|1144297_1146496_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|1146492_1147449_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070685.1|1147445_1148135_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1148552_1149167_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1149414_1149744_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|1150056_1150767_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265657.1|1150735_1152379_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|1152368_1154894_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|1154919_1155588_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|1155645_1156233_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|1156307_1156850_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|1157674_1157866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1157935_1158076_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|1158075_1158339_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|1158602_1158983_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1158979_1159327_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998084.1|1159376_1160915_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	2.2e-299
1167743:1167759	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	1704072	1743481	5449111	integrase,portal,holin,transposase,terminase,protease,lysis,tail	Enterobacteria_phage(50.0%)	49	1693493:1693507	1727117:1727131
1693493:1693507	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|1704072_1704954_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|1705116_1705335_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1705374_1705542_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1705784_1706387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1706597_1706819_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1706917_1707199_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1707209_1707401_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1707373_1707556_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1707552_1708233_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1708930_1709113_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1709109_1709280_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1709272_1709893_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1709889_1710555_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1710766_1711726_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1712063_1712186_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1712200_1712890_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1713073_1713817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1713902_1714061_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1714141_1714540_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1714682_1714898_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1714897_1715395_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1715391_1715859_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1715846_1715999_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_085948178.1|1717018_1718231_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_021501094.1|1718477_1720580_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|1720576_1720789_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1720716_1721841_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1721962_1722298_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|1722242_1724270_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|1724356_1724680_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1724672_1724948_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1724959_1725538_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1725534_1725936_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1725946_1726690_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1726750_1727137_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1727117:1727131	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1727145_1727475_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1727446_1730512_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1730511_1730841_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1730850_1731549_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1731554_1732298_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|1732234_1732843_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|1736387_1736987_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1737046_1738363_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1738364_1738634_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1738810_1739791_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1739824_1740844_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1741340_1741502_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1741670_1742552_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|1742782_1743481_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 8
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	1865613	1876721	5449111	integrase,terminase,capsid	uncultured_Caudovirales_phage(25.0%)	14	1860075:1860089	1872816:1872830
1860075:1860089	attL	AATAACTTTTAACGC	NA	NA	NA	NA
WP_000188174.1|1865613_1867560_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1867632_1867857_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085207.1|1868261_1869485_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000775337.1|1869481_1870255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|1870346_1870571_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_072141637.1|1870580_1871279_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000659213.1|1871457_1871649_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000770140.1|1871886_1872186_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761784.1|1872182_1873931_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	8.6e-90
1872816:1872830	attR	GCGTTAAAAGTTATT	NA	NA	NA	NA
WP_000164427.1|1874281_1874527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|1874657_1874852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1874855_1875017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1875146_1875635_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000562896.1|1875797_1876721_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
>prophage 9
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	1969721	2039274	5449111	integrase,portal,head,holin,transposase,protease,tail	Escherichia_phage(26.67%)	79	1978209:1978224	1999575:1999590
WP_000156526.1|1969721_1971482_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1971667_1972120_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1972195_1973236_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1973592_1974102_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1974320_1974950_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1974912_1977075_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1977084_1977531_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1977653_1979708_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1978209:1978224	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1979739_1980198_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1980293_1980956_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1981128_1981542_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1981586_1981904_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1981961_1983152_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1983246_1983525_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1983521_1983851_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1983941_1984601_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1985008_1986028_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1986005_1986248_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1986315_1988787_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1988880_1989072_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1989068_1989257_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1989830_1990016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1990202_1990592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1990733_1990889_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1991166_1991454_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1991453_1991645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1991672_1992074_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1992182_1992455_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1992438_1992864_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1993070_1993526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1993604_1994696_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1994702_1995449_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1995470_1996241_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1996256_1996670_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1997021_1997795_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1998160_1998298_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1998342_1998555_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1998722_1999001_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1999002_2000052_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1999575:1999590	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|2000064_2000436_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|2000425_2000797_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|2000948_2001767_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|2002053_2002293_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|2002387_2003101_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|2003867_2005718_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|2005893_2007106_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|2007311_2007626_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2008153_2008339_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2008560_2008674_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|2008894_2009428_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|2009587_2009860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|2010115_2010322_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|2011072_2011348_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|2011423_2011804_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2011800_2012148_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2012197_2013736_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|2013785_2014028_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|2015900_2016107_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831795.1|2016103_2017696_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
WP_001254002.1|2017685_2019191_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2019227_2019575_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2019632_2019899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2019880_2020621_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2020634_2021066_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2021092_2021506_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|2021486_2024066_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2024062_2024392_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|2024391_2025090_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|2025100_2025844_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|2025789_2026422_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|2026612_2027140_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_115245580.1|2027273_2030747_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_001230444.1|2030814_2031414_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|2031478_2032792_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2032793_2033063_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|2035055_2036174_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|2036170_2037964_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2037982_2038690_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2038686_2039274_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	2282092	2402621	5449111	capsid,integrase,portal,head,holin,transposase,terminase,tRNA,protease,lysis,tail	Enterobacteria_phage(37.61%)	154	2347982:2347997	2376236:2376251
WP_000952736.1|2282092_2282914_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2283069_2284116_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2284112_2284907_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2285073_2286192_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2286160_2286430_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2286491_2286881_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2287013_2287529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2287643_2287796_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2288111_2288588_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2288712_2289036_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2289019_2289445_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2289513_2290551_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|2290582_2291005_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451014.1|2291038_2291755_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	6.9e-70
WP_000017339.1|2291751_2292069_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2292065_2292368_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2292357_2292675_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2292628_2292946_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2292932_2293370_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2293371_2293563_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2293565_2294153_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2294268_2294373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2294561_2294774_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2294941_2295220_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_153021279.1|2295221_2296271_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.7e-109
WP_001217410.1|2296283_2296658_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2296654_2297476_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2298072_2298240_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|2298554_2300492_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2300639_2300822_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2300859_2301129_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284517.1|2301204_2301420_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2301424_2301769_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2301819_2302353_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2302623_2303193_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2303192_2303339_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2303566_2303773_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2303837_2304062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2304418_2304559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2304688_2304874_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2304915_2305281_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2305572_2306136_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2306132_2307794_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2309810_2310032_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2309977_2312557_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125988.1|2312559_2312886_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2312895_2313246_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2313242_2313689_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2313685_2314030_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2314095_2314812_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2314826_2315201_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2315296_2315506_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2315553_2318796_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2318788_2319130_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2319129_2319828_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2319844_2320099_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2320208_2320319_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2320621_2321500_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2321553_2322291_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2322236_2322473_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2322485_2322575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2322594_2324943_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2325533_2328935_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2331038_2331164_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2331243_2331519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2331579_2332941_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2333304_2334168_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2334151_2335288_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2335537_2336764_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2336812_2337934_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|2338295_2339509_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|2339507_2340725_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2341089_2341278_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2341327_2341654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|2341778_2341952_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|2342082_2342280_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2342272_2342485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2342474_2342939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2342931_2343165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2343170_2343470_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2343466_2344867_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2345067_2345319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2345315_2345726_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2345736_2346009_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2346135_2346360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2346611_2346818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2346817_2347873_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2347885_2348221_+|head	head decoration protein	head	NA	NA	NA	NA
2347982:2347997	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2348233_2348647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2348852_2349395_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2349650_2349932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2350532_2351993_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2351992_2352664_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2352832_2354203_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2354206_2354848_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2354883_2355990_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2356043_2356505_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2356514_2357168_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2357339_2358590_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2358703_2359846_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2359835_2360072_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2360175_2361000_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2360996_2361698_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2361694_2361997_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2362064_2362397_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2362461_2362584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2362641_2364168_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2364669_2365125_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2365124_2365295_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2365287_2365578_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2365574_2365937_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2365933_2366074_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2366070_2366760_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2367081_2367387_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2367373_2367850_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2368066_2368249_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2368339_2368633_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2368924_2369335_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2369620_2369827_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2369991_2370186_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2370574_2371120_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2371094_2373020_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2373016_2373223_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2373219_2374821_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2374801_2376121_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2376130_2376463_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2376236:2376251	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2376517_2377543_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2377584_2377983_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2377994_2378348_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2378359_2378938_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2378934_2379330_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2379337_2380078_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2380093_2380516_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2380497_2380932_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2380924_2383474_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2383470_2383800_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2383799_2384498_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2384503_2385247_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2385183_2385816_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2385876_2389275_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2389341_2389941_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2390005_2392921_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2392920_2393502_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2393621_2394512_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2394530_2395037_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2395073_2395574_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2395652_2395835_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2396332_2397001_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021501130.1|2397057_2397306_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2397381_2397762_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2397758_2398106_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2398155_2399694_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2399996_2401481_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2401667_2402621_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 11
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	2420976	2530143	5449111	integrase,head,transposase,tRNA,protease,plate,tail	Shigella_phage(40.74%)	117	2479921:2479935	2527868:2527882
WP_085949318.1|2420976_2422189_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_064717263.1|2422155_2422245_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_000340206.1|2422347_2424084_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000051572.1|2424179_2425094_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_001295616.1|2425193_2425805_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_001310261.1|2426511_2428431_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001303183.1|2428530_2431416_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000505866.1|2432259_2433351_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000152933.1|2433467_2434052_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823885.1|2434329_2434608_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033352.1|2434662_2436342_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|2436466_2437414_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001260332.1|2437564_2438416_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001130692.1|2438415_2439039_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001299679.1|2439252_2440509_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000804726.1|2440550_2441633_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456466.1|2441632_2442466_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200379.1|2442462_2442855_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|2442858_2443668_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811067.1|2443703_2444558_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	1.1e-45
WP_077827457.1|2444705_2444813_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_000170963.1|2445241_2445349_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_001301956.1|2445747_2446848_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|2447117_2447348_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001301489.1|2447508_2448204_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001169669.1|2448247_2448601_-	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_000086192.1|2448786_2450181_+	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_000070491.1|2450181_2450832_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_000918073.1|2450824_2452621_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_000019827.1|2452959_2454351_+	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000032935.1|2454743_2458487_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000702660.1|2458483_2460022_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571681.1|2460018_2460729_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|2460728_2461406_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555853.1|2462376_2463219_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001362540.1|2463268_2463727_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|2463839_2464745_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|2464836_2465850_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|2466051_2466960_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|2467103_2467517_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|2468120_2468738_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_000301651.1|2469038_2471714_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|2472190_2472838_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001297114.1|2473575_2475207_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911112.1|2475292_2476213_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979661.1|2476227_2477136_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110954.1|2477147_2478161_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000528252.1|2479095_2479833_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.5	3.4e-104
WP_001310452.1|2479786_2479987_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
2479921:2479935	attL	CCAGATAACTGAAAC	NA	NA	NA	NA
WP_001114107.1|2480603_2480849_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2480884_2481067_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_073547372.1|2481213_2483253_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.6	1.5e-274
WP_000904930.1|2483352_2483913_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_001473653.1|2484468_2484990_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	6.0e-47
WP_000469162.1|2485024_2485936_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2485935_2486496_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2486486_2487569_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763328.1|2487568_2488006_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	54.2	1.1e-38
WP_000980532.1|2487998_2488613_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2488602_2489727_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146120.1|2489710_2491060_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|2491046_2493122_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|2493248_2493725_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015474.1|2493739_2494105_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	1.5e-25
WP_000606746.1|2494113_2495613_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	50.4	3.4e-135
WP_000848437.1|2495609_2495855_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_021499914.1|2495855_2496416_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	4.8e-42
WP_001104956.1|2496412_2496832_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_136766768.1|2496828_2497245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2497288_2498236_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850812.1|2498235_2499360_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	7.5e-79
WP_100005715.1|2499536_2500010_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.3	1.7e-37
WP_000046905.1|2500131_2501463_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.0	1.6e-152
WP_153021280.1|2501446_2503036_-	DUF935 family protein	NA	A0A0C4UQR8	Shigella_phage	57.5	1.9e-168
WP_001057665.1|2503035_2504700_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360582.1|2504699_2505281_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001279082.1|2505283_2505574_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|2505570_2505879_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342751.1|2505859_2506087_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|2506097_2506316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123006477.1|2506299_2506728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125304.1|2506762_2507263_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2507334_2507760_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042957516.1|2507829_2508339_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	43.4	1.5e-26
WP_000370521.1|2508335_2508632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|2508621_2508819_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_042957519.1|2508811_2509144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145588.1|2509159_2509528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633438.1|2509524_2509836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062886965.1|2509832_2510384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465555.1|2510387_2510903_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	1.2e-44
WP_000564274.1|2510902_2511436_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.4	3.1e-67
WP_000323225.1|2511439_2511982_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	8.4e-28
WP_001129553.1|2512079_2512610_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|2512621_2512915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2512919_2513192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153021281.1|2513188_2513470_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	44.9	4.1e-10
WP_001057199.1|2513471_2513726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|2513738_2513960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2513962_2514895_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_153021282.1|2514966_2517057_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.2	4.4e-165
WP_001310454.1|2517058_2517307_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|2517497_2518028_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000366959.1|2518529_2518859_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214510.1|2518893_2520354_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|2520496_2520670_+	YciY family protein	NA	NA	NA	NA	NA
WP_000020078.1|2520724_2521978_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|2522278_2522575_-	YciI family protein	NA	NA	NA	NA	NA
WP_001302286.1|2522798_2523518_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108158.1|2523557_2523956_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|2524060_2524600_-	septation protein A	NA	NA	NA	NA	NA
WP_000028544.1|2524629_2525373_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|2525729_2526368_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|2526413_2527544_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2527521_2527770_-	excisionase	NA	NA	NA	NA	NA
WP_086263722.1|2527834_2528893_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	6.2e-59
2527868:2527882	attR	CCAGATAACTGAAAC	NA	NA	NA	NA
WP_085948178.1|2528930_2530143_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 12
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	2534141	2627355	5449111	capsid,portal,head,holin,transposase,terminase,tail	Escherichia_phage(29.81%)	115	NA	NA
WP_000787428.1|2534141_2534549_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2534625_2534853_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2534836_2535388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2535359_2536400_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2536431_2536854_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2537040_2537622_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2537618_2537783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2538481_2539240_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2539518_2539731_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2539951_2540209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2540278_2540557_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2540558_2541605_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2541617_2541977_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2541985_2542516_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2542757_2542955_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2543105_2544164_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143071.1|2544960_2546811_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411805.1|2547259_2547466_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2547470_2547815_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2547865_2548399_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2548669_2549239_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2549238_2549385_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2549612_2549798_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2550222_2550450_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2550491_2550857_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2551146_2551710_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2551706_2553368_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2553431_2555369_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2555413_2555635_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_115245565.1|2555580_2558082_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.0	0.0e+00
WP_000126019.1|2558161_2558488_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2558497_2558848_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2558844_2559291_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2559287_2559632_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2559690_2560407_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2560412_2560787_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2560882_2561092_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2561144_2564387_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2564379_2564721_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2564720_2565158_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_085949318.1|2565279_2566493_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_105626756.1|2566658_2569919_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001304111.1|2569921_2570137_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2570204_2570804_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_153021284.1|2570868_2571903_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	85.1	6.0e-83
WP_001023362.1|2571904_2572174_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2572287_2572863_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2573572_2574223_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998084.1|2574805_2576344_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	2.2e-299
WP_000612591.1|2576393_2576741_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2576737_2577118_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2578080_2578395_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2579033_2580278_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2580370_2580559_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2580555_2580744_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2581308_2581518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2581518_2582157_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2582168_2582321_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2582613_2582952_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2583343_2583586_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2583569_2583995_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2584063_2585107_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2585138_2585561_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000603384.1|2586302_2586584_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2586580_2586808_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2586800_2587112_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2587239_2587458_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2587459_2588017_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2588250_2588463_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2588582_2588927_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2589048_2589321_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2589322_2590372_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2590384_2590690_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2590752_2591307_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2591531_2591729_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2591864_2592578_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2593028_2593460_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_064234946.1|2593937_2595788_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411805.1|2596236_2596443_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2596447_2596792_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2596842_2597376_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2597646_2598216_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2598215_2598362_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2598584_2598770_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2599295_2599610_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2599691_2599916_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2600302_2600848_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2600822_2602748_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2602744_2602951_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2602947_2604549_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2604529_2605849_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2605858_2606191_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2606246_2607272_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2607313_2607712_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2607723_2608077_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2608091_2608625_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2608621_2609017_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2609024_2609777_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2609790_2610213_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2610239_2610653_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2610633_2613246_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2613242_2613572_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032256908.1|2613571_2614270_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_050946666.1|2614280_2615024_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_143355417.1|2614969_2615599_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	1.0e-101
WP_153021285.1|2615839_2619319_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_001230508.1|2619386_2619986_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748460.1|2620050_2621364_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2621365_2621635_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2621748_2622324_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2622396_2623026_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2623107_2623749_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|2623910_2624225_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2625655_2627116_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2627151_2627355_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 13
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	2893179	2965850	5449111	capsid,portal,head,transposase,holin,terminase,protease,tail	Stx2-converting_phage(36.21%)	81	NA	NA
WP_000422055.1|2893179_2894229_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2894448_2895207_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2895203_2895794_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2895833_2896706_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2896918_2898502_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2898529_2899150_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2899146_2900028_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2900165_2900210_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2900301_2901864_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_021501138.1|2901863_2903459_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2903462_2904821_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2904832_2906026_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2906025_2906832_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2907212_2907392_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2907477_2907978_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2908023_2908530_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|2909031_2909250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2909843_2910272_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2912000_2912591_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2912774_2913422_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2913558_2913705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2914132_2914411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2914750_2915131_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2915127_2915475_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2915524_2917063_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|2919727_2921053_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2922079_2922349_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2922350_2923664_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2923815_2924415_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2924482_2926828_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2926779_2927955_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2928297_2928930_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2928875_2929619_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_070080222.1|2929629_2930328_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2930327_2930669_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2930661_2933904_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2933956_2934166_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2934261_2934636_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2934641_2935358_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2935416_2935761_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2935757_2936204_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2936200_2936551_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2936560_2936887_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_115245565.1|2936966_2939468_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.0	0.0e+00
WP_001063099.1|2939413_2939635_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_153021286.1|2939679_2941617_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	99.7	0.0e+00
WP_001301491.1|2941680_2943342_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2943338_2943902_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|2944190_2944556_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2944597_2944822_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2944903_2945218_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2945745_2945931_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|2946147_2946645_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|2946644_2946851_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_024748518.1|2947298_2949149_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|2949640_2950699_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|2950849_2951047_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|2951273_2952095_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|2952091_2952466_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001302870.1|2952478_2953528_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_001304183.1|2953529_2953808_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000967408.1|2954319_2954532_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2954720_2954825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|2954940_2955303_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|2955299_2955671_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2955706_2955919_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2955967_2956324_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2956380_2956776_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|2956791_2957562_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|2957591_2958332_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|2958338_2959292_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|2959314_2959740_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2959723_2959999_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2960101_2960491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|2960660_2960813_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|2961300_2961489_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2961485_2961674_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102182.1|2961766_2964211_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	1.4e-175
WP_001296941.1|2964298_2964535_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000546375.1|2965225_2965351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302046.1|2965523_2965850_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 14
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	3271048	3322171	5449111	integrase,tRNA,tail,transposase	Enterobacteria_phage(63.33%)	59	3264272:3264287	3322250:3322265
3264272:3264287	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3271048_3272782_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3272958_3273447_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3273566_3273959_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3273958_3276037_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3276029_3277178_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3277379_3278024_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3278034_3278424_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3278438_3279488_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3279490_3280351_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3280369_3281971_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3282016_3283678_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3283820_3284324_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3284344_3286309_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3286313_3287240_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3287236_3288124_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3288250_3288829_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3288831_3289182_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3289961_3290390_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3290396_3291821_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3291795_3292596_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3292762_3293749_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3293763_3295278_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3295347_3296337_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3297133_3297637_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3297716_3297968_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3298082_3298169_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3298430_3298754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3298924_3299422_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3299458_3299698_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3299889_3301101_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3301162_3301828_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|3302184_3303186_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3303191_3303539_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3303568_3304219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3304234_3304639_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3304728_3304866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3304937_3305141_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3305162_3305513_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3305523_3305802_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3305813_3306056_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3306052_3306166_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3306258_3306675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3306698_3306902_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3306898_3307165_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3307161_3307461_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3307783_3308014_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3308086_3308452_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3308458_3311281_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3311357_3312317_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3312321_3312636_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3313841_3314258_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3314301_3314874_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3315030_3315519_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3318321_3318450_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3318485_3318851_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3318905_3319418_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3319417_3320602_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3320760_3321084_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3321034_3322171_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3322250:3322265	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 15
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	3379693	3451149	5449111	integrase,portal,head,holin,transposase,terminase,tail	Enterobacteria_phage(31.11%)	68	3395348:3395363	3451629:3451644
WP_001023396.1|3379693_3379963_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_153021291.1|3379964_3381134_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|3381198_3381798_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_153021292.1|3381865_3385345_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_143355417.1|3385585_3386215_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	1.0e-101
WP_050946666.1|3386160_3386904_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_032256908.1|3386914_3387613_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|3387612_3387942_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3387938_3390518_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3390498_3390912_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3390938_3391370_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3391383_3392124_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3392105_3392372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3392429_3392777_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3392813_3394319_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831795.1|3394308_3395901_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
3395348:3395363	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3395897_3396104_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3397989_3398499_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3398893_3399118_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3399199_3399514_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3400040_3400226_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3400453_3400585_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3400597_3400780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3400935_3401469_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3401519_3401864_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3401868_3402075_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3402394_3403607_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|3403689_3405540_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3407079_3407769_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3407765_3408125_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3408137_3409187_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3409188_3409467_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3409634_3409847_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3410033_3410138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3410247_3410811_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3410937_3411249_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3411245_3411398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3411430_3411787_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3411783_3412008_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3412029_3412728_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3412762_3413185_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|3413216_3414254_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3414322_3414748_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3414744_3414972_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3415069_3415714_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3415988_3416141_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3416620_3416809_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3416805_3416994_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3417089_3419561_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3419619_3419823_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|3419822_3420845_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|3421080_3421878_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480501.1|3429812_3430865_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3431178_3432495_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3432596_3434051_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3434393_3435110_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3435735_3437379_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3437496_3438447_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3438548_3439466_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3439922_3440858_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3440919_3441999_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3442010_3442754_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3442750_3443296_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3443657_3444038_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3444034_3444382_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3444431_3445970_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000966626.1|3447417_3449565_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_085952406.1|3449936_3451149_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
3451629:3451644	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 16
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	3461949	3483858	5449111	integrase,tail,transposase	Stx2-converting_phage(85.0%)	20	3466244:3466258	3491001:3491015
WP_001303036.1|3461949_3463116_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|3464439_3465090_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|3465314_3466190_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
3466244:3466258	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023452.1|3466330_3466600_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|3466601_3467915_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001230314.1|3467979_3468579_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_151538896.1|3468645_3472125_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	99.9	0.0e+00
WP_050546863.1|3472384_3473017_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|3472962_3473700_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|3473753_3474677_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3474747_3474921_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3475028_3475349_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001179515.1|3475365_3476064_-|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_000807954.1|3476063_3476405_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_085948178.1|3478353_3479567_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001289930.1|3479738_3480686_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|3481547_3481898_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|3482085_3482430_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|3482507_3482699_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|3482679_3483858_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
3491001:3491015	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 17
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	3569875	3670808	5449111	integrase,portal,holin,terminase,tRNA,protease,tail	Enterobacteria_phage(51.39%)	110	3623364:3623384	3668314:3668334
WP_000476014.1|3569875_3571237_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3571566_3571884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3572289_3573189_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3573270_3574050_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3574149_3575190_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3575237_3576593_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3576596_3576881_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3576911_3577364_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3577373_3578636_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3578664_3579519_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3579817_3580870_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|3581126_3582404_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3582400_3583405_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3583401_3584367_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3584340_3585087_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3585138_3585957_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3586021_3586822_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3586818_3587607_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3587940_3588180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3589230_3589578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3589587_3589902_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3590011_3590284_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134631.1|3590404_3591244_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3591461_3591800_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3591881_3592916_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3592926_3595407_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3595422_3596097_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3596184_3596727_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3597018_3597300_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3597561_3598671_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3598802_3600836_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3604798_3606079_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3607792_3611422_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3611483_3611801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3613041_3614130_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3614140_3615670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3615688_3616420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3616412_3617549_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3617545_3619549_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3619673_3620135_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3620176_3620647_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3620693_3621413_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3621409_3623095_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3623364:3623384	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|3623609_3623858_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3624019_3624661_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3624742_3625159_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3625319_3625589_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072619025.1|3625590_3626760_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|3626824_3627424_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_153021292.1|3627491_3630971_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_143355417.1|3631211_3631841_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	1.0e-101
WP_050946666.1|3631786_3632530_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_032256908.1|3632540_3633239_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|3633238_3633568_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_046671471.1|3633564_3636210_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|3636253_3636562_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3636588_3637011_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3637024_3637777_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3637784_3638183_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3638195_3638819_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3638821_3639103_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3639095_3639422_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3639509_3641534_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974568.1|3641478_3642981_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3642980_3643193_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3643189_3645313_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|3645309_3645786_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|3646303_3646489_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3646716_3646863_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3646862_3647432_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3647702_3648236_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3648240_3648456_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3648533_3648779_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3648819_3648999_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_153021293.1|3649136_3651083_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|3651886_3652039_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3652287_3652722_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3652807_3652948_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3652944_3653307_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3653303_3653594_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3653586_3653757_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3653756_3654212_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3654208_3654310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3654400_3654682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3654725_3654923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3655150_3655435_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3655431_3656133_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|3656129_3657059_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|3657145_3657685_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3658048_3658741_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3658847_3660455_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3660958_3661249_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3661324_3661621_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3661626_3662412_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3662408_3663086_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3663085_3663268_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3663240_3663432_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3663442_3663724_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3663822_3664044_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3664040_3664988_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3664989_3665166_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000610375.1|3665852_3666215_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3666302_3666545_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3666548_3666683_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3666701_3666956_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3666989_3668276_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3668296_3668998_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3668314:3668334	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3669057_3669165_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3669145_3669877_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3669881_3670808_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 18
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	3915206	3920593	5449111	integrase	Enterobacteria_phage(50.0%)	6	3905657:3905673	3917621:3917637
3905657:3905673	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3915206_3916139_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3916450_3917608_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3917782_3918919_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3917621:3917637	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3918928_3919609_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3919595_3920063_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3920062_3920593_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 19
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	4160994	4220440	5449111	integrase,transposase,holin,tRNA,tail	Enterobacteria_phage(31.58%)	60	4178442:4178456	4225399:4225413
WP_000997403.1|4160994_4162032_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4162238_4162658_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4162726_4163425_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4163456_4166117_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4166230_4167586_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4167631_4167955_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4167951_4169250_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4175025_4177599_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4177728_4178460_-	polyphenol oxidase	NA	NA	NA	NA	NA
4178442:4178456	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4178456_4179437_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4179571_4180309_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4180579_4180921_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4181024_4181072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4181170_4182331_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4182373_4183495_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4183505_4184576_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4184785_4185151_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4185300_4185819_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4185808_4187035_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4187050_4187533_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4187609_4187957_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4187998_4188766_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4188796_4189345_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4189363_4189612_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4189748_4191110_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4191276_4192068_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4192089_4193376_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4193430_4194024_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4194146_4195025_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|4195110_4196772_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4196920_4197262_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4197323_4197614_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4197603_4198080_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4198211_4198694_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4199539_4199788_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4200289_4200880_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4201062_4201713_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4201791_4202850_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4202979_4203402_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4203562_4203832_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4203833_4204400_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4204449_4204797_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4204793_4205174_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4205530_4205875_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4205879_4206095_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|4206244_4208098_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4208505_4208673_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4208758_4209502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4209754_4210378_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4210374_4211040_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4211036_4211648_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|4211622_4212189_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|4212512_4213268_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4213303_4213606_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150570.1|4213681_4214986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4215381_4215795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4215892_4216291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|4216291_4217923_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|4217919_4219233_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4219234_4220440_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4225399:4225413	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 20
NZ_CP040316	Escherichia coli strain CV261 chromosome, complete genome	5449111	5304560	5318408	5449111	integrase,transposase	Enterobacteria_phage(72.73%)	15	5299776:5299789	5315390:5315403
5299776:5299789	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001392828.1|5304560_5305733_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	89.9	1.7e-203
WP_021501220.1|5305813_5307148_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_001393214.1|5307254_5308262_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_088545518.1|5308634_5309207_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.2	1.2e-93
WP_000638628.1|5309280_5309781_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283042.1|5309777_5310512_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
WP_153021301.1|5311065_5311332_+	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	96.6	1.7e-42
WP_074530521.1|5311328_5311928_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244670.1|5311920_5312208_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|5312200_5312656_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|5312791_5313112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|5313126_5315460_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
5315390:5315403	attR	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001171554.1|5316095_5316476_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5316472_5316820_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998051.1|5316869_5318408_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
>prophage 1
NZ_CP040317	Escherichia coli strain CV261 plasmid pO157, complete sequence	93331	8202	58362	93331	integrase,protease,transposase	Macacine_betaherpesvirus(45.45%)	43	NA	NA
WP_001034097.1|8202_12105_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_071525077.1|13501_13681_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14282_15104_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15103_16210_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16299_18021_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18094_19093_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_072141201.1|19963_22660_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|22746_23622_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|23679_25590_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|25589_27095_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|27096_28320_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|28350_28785_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|28781_29336_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|29350_29698_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|29694_30294_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|30290_31268_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|31306_32479_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|32465_32978_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|33035_33869_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|33960_34362_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|36252_36768_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|36769_39766_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_077827460.1|39815_41936_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|41939_43379_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|43445_43640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|43669_43954_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010891288.1|44122_44353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|44473_45214_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|45498_46476_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|46883_47084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|47080_47701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|47697_48381_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|48839_49058_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|49059_49365_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_024165790.1|49365_50172_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|50848_50929_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|50894_52108_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|52215_52971_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|53558_54725_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|54724_55696_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|56390_57293_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|57296_57602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|57678_58362_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
