The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026023	Klebsiella pneumoniae strain 11420 chromosome, complete genome	5438591	1297576	1342910	5438591	tail,holin,integrase,terminase	Salmonella_phage(42.22%)	51	1291601:1291615	1309909:1309923
1291601:1291615	attL	ATGCGGCGCTGAAAA	NA	NA	NA	NA
WP_004151980.1|1297576_1299043_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1299110_1300688_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_060184358.1|1300879_1302130_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	8.9e-206
WP_004200579.1|1302146_1302338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336803.1|1302334_1302928_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.9	3.3e-110
WP_004144296.1|1302924_1303083_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	2.5e-17
WP_023339275.1|1303075_1303369_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004144294.1|1303478_1303727_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_048336802.1|1303773_1304655_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.6	1.4e-136
WP_048336801.1|1304651_1305473_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	2.8e-131
WP_048336848.1|1305472_1305664_-	hypothetical protein	NA	A0A1L2C975	Pseudomonas_phage	52.6	2.1e-05
WP_004164029.1|1305723_1306023_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_048336800.1|1306389_1306971_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	4.2e-65
WP_004152538.1|1307124_1307358_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_048336799.1|1307704_1308367_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	61.4	1.5e-82
WP_032415344.1|1308366_1309128_+	DNA replication domain protein	NA	T1SA92	Salmonella_phage	57.4	3.4e-67
WP_048336798.1|1309253_1309598_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.9e-52
WP_053065703.1|1309790_1310252_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.5	2.7e-06
1309909:1309923	attR	ATGCGGCGCTGAAAA	NA	NA	NA	NA
WP_071888830.1|1310244_1310925_+	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	58.3	9.2e-72
WP_004141386.1|1311395_1311608_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_048336795.1|1312215_1312500_+	hypothetical protein	NA	A0A0N7KZ94	Stx2-converting_phage	75.5	2.5e-15
WP_048336845.1|1312499_1312688_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	9.4e-19
WP_023339258.1|1312680_1313019_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1313115_1314600_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_048336844.1|1315003_1315333_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	1.9e-27
WP_048336794.1|1315390_1315975_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	8.4e-90
WP_048336793.1|1315971_1317447_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.7	1.5e-281
WP_077274498.1|1317443_1318235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336792.1|1318412_1318658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|1319255_1319459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|1319462_1321142_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|1321138_1321444_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1321725_1322124_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|1322136_1323144_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1323154_1323547_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|1323539_1323818_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|1323866_1324478_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_048336791.1|1324477_1326955_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.8	7.3e-268
WP_048336790.1|1326956_1327427_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	6.6e-45
WP_004197440.1|1327419_1327917_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
WP_048336789.1|1327929_1330428_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	61.3	1.5e-289
WP_048336788.1|1330424_1332230_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.7e-237
WP_048336787.1|1332233_1334708_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	85.7	0.0e+00
WP_048336786.1|1334903_1335200_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	93.8	1.7e-46
WP_004141317.1|1335486_1336032_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_009485391.1|1336419_1336716_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
WP_048336784.1|1339208_1339616_+	membrane protein	NA	T1SA79	Salmonella_phage	82.7	1.4e-54
WP_048336783.1|1339602_1339899_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	77.6	2.1e-33
WP_071888828.1|1339895_1340375_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	2.1e-62
WP_048336782.1|1340371_1340872_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	78.8	5.9e-60
WP_009309501.1|1341041_1342910_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 2
NZ_CP026023	Klebsiella pneumoniae strain 11420 chromosome, complete genome	5438591	1446718	1491045	5438591	coat,holin,terminase,head	Cronobacter_phage(22.45%)	68	NA	NA
WP_009486224.1|1446718_1447177_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
WP_048336780.1|1447309_1448218_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	6.0e-10
WP_004149226.1|1448227_1449109_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|1449476_1449959_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023301637.1|1450295_1450496_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_077270000.1|1450536_1451025_-	AP2/ERF family transcription factor	NA	A0A2I7R856	Vibrio_phage	57.6	7.6e-28
WP_065892239.1|1451197_1451416_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.7	1.1e-13
WP_004146321.1|1451417_1451636_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_068987124.1|1451632_1452802_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.8	7.4e-146
WP_102010071.1|1452798_1453455_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	85.6	1.9e-111
WP_087794457.1|1453451_1453757_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009483857.1|1453753_1454044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064175274.1|1454027_1454681_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	4.0e-64
WP_004135670.1|1454832_1455030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094953265.1|1455037_1455550_-	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	45.3	9.7e-34
WP_008807814.1|1455608_1455815_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_080784311.1|1456278_1456968_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	2.3e-62
WP_072650040.1|1457095_1457329_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	2.5e-13
WP_020958158.1|1457369_1457654_+	bacteriophage CII family protein	NA	K7PHN8	Enterobacterial_phage	57.4	8.1e-22
WP_064147858.1|1457827_1458727_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	55.2	2.4e-88
WP_102010070.1|1458716_1460147_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.5	2.0e-185
WP_102010069.1|1460146_1460449_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102010068.1|1460445_1460880_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.7	6.4e-10
WP_060578950.1|1460876_1461083_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	95.6	9.0e-31
WP_102010067.1|1461079_1461643_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_102010066.1|1461642_1461813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102010065.1|1461805_1462312_+	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	51.6	1.3e-14
WP_020804648.1|1462304_1462526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178856.1|1462896_1463469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074384880.1|1463470_1463887_+	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
WP_102010064.1|1464053_1464650_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	2.1e-56
WP_004146340.1|1464858_1465149_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.8e-45
WP_107319048.1|1465145_1465508_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	7.3e-52
WP_032428643.1|1465504_1465645_+	YlcG family protein	NA	NA	NA	NA	NA
WP_105433506.1|1465641_1466331_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	2.1e-63
WP_068987107.1|1466755_1467127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068987106.1|1467128_1467335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153244946.1|1467807_1468113_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	97.9	1.1e-45
WP_068987105.1|1468099_1468549_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	1.4e-57
WP_009483899.1|1468806_1469322_+	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
WP_068987104.1|1469321_1470794_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.3	2.0e-249
WP_069377237.1|1470806_1472276_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	4.8e-150
WP_069377238.1|1472202_1473204_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.9	7.6e-115
WP_023339708.1|1473196_1473397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069377239.1|1473474_1474830_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.5	4.6e-131
WP_069377240.1|1474829_1475291_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	3.8e-29
WP_069377241.1|1475287_1476343_+|coat	phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.8	4.5e-102
WP_069603327.1|1476374_1476641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040206659.1|1476643_1477024_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
WP_102010062.1|1477023_1477197_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_068987102.1|1477196_1477559_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	9.6e-20
WP_004151265.1|1477561_1477987_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_040229586.1|1477983_1478376_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	3.9e-35
WP_068987101.1|1478444_1479197_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.5	5.8e-43
WP_029884068.1|1479249_1479927_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
WP_050008822.1|1480105_1480861_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.1e-61
WP_019724823.1|1480863_1481118_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
WP_063443022.1|1481192_1481627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254637.1|1481667_1482021_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064484068.1|1482146_1482314_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_080883267.1|1482330_1483359_+	hypothetical protein	NA	A0A0P0ZBT0	Stx2-converting_phage	68.4	9.9e-86
WP_069377264.1|1483431_1486650_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	52.2	6.2e-219
WP_069377263.1|1486690_1486870_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_080883263.1|1486846_1487116_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_086074300.1|1487299_1487719_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	5.9e-29
WP_023301685.1|1487718_1488189_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
WP_068987094.1|1488185_1488581_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	52.8	3.0e-35
WP_068987093.1|1488567_1491045_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	9.4e-199
>prophage 3
NZ_CP026023	Klebsiella pneumoniae strain 11420 chromosome, complete genome	5438591	1724013	1730918	5438591	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1724013_1724877_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1724887_1725661_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1725901_1726795_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1727040_1728402_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1728720_1729443_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1729439_1730918_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP026023	Klebsiella pneumoniae strain 11420 chromosome, complete genome	5438591	2845649	2856536	5438591		Escherichia_phage(87.5%)	9	NA	NA
WP_014907638.1|2845649_2848757_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_014907639.1|2848811_2850077_+	MFS transporter	NA	NA	NA	NA	NA
WP_014907640.1|2850107_2851196_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_014907641.1|2851282_2851543_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	2.1e-40
WP_004176269.1|2851840_2852701_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2852721_2853483_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2853743_2854646_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2854657_2855923_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2855915_2856536_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP026023	Klebsiella pneumoniae strain 11420 chromosome, complete genome	5438591	3254817	3349538	5438591	capsid,portal,tRNA,tail,transposase,holin,terminase,integrase,head	Klebsiella_phage(46.51%)	100	3245442:3245459	3357687:3357704
3245442:3245459	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3254817_3255318_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3255435_3255882_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3255865_3256657_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015874675.1|3256758_3257943_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_014907799.1|3257974_3258667_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3258812_3259322_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3259308_3259665_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3259654_3259894_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3260194_3261208_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3261265_3261367_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3261366_3261441_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3261558_3261684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3261742_3262006_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3262136_3262775_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3262864_3263779_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_014907800.1|3264440_3265484_-	type II asparaginase	NA	NA	NA	NA	NA
WP_077274497.1|3265786_3266995_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014907801.1|3267068_3268853_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3268859_3269750_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3269870_3271379_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3271689_3272376_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153244925.1|3272825_3273014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3272992_3273625_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3274191_3274389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907802.1|3274504_3275515_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3275511_3276918_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3276973_3277861_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3277877_3278384_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3278410_3278905_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3278995_3279181_-	general stress protein	NA	NA	NA	NA	NA
WP_032421220.1|3279400_3279736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140529.1|3279803_3280997_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3281109_3281337_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_014907803.1|3281786_3282110_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3282102_3282495_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004213085.1|3282491_3283205_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3283477_3283630_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_014228923.1|3284278_3284971_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004224164.1|3285325_3286384_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
WP_014907806.1|3286806_3288234_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
WP_060184316.1|3288302_3301007_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.9	0.0e+00
WP_014228919.1|3301069_3301681_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|3301696_3302047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228918.1|3302078_3302789_-	NlpC/P60 family protein	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
WP_153244926.1|3302790_3303546_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	3.6e-125
WP_014228916.1|3303542_3303881_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_041169041.1|3303880_3307216_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.6	0.0e+00
WP_014228914.1|3307448_3307814_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3307871_3308333_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|3308364_3308766_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014907812.1|3308762_3309152_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	1.1e-56
WP_014228910.1|3309132_3309471_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_041168975.1|3309467_3309785_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	2.6e-45
WP_014907814.1|3309765_3310026_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|3310084_3311371_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_014907815.1|3311448_3312369_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_012542166.1|3312405_3313665_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
WP_032418045.1|3313664_3313844_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_012542167.1|3313837_3315559_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|3315558_3315993_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3316241_3316673_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_014907819.1|3316669_3316993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168976.1|3316944_3317307_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	82.5	1.3e-56
WP_032749552.1|3317633_3317858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065888617.1|3317896_3318334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168977.1|3319282_3319633_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	37.7	6.0e-11
WP_023159886.1|3319629_3320127_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	4.3e-79
WP_021462597.1|3320126_3320342_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	1.0e-29
WP_077260858.1|3321353_3321794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317678.1|3321798_3322668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228895.1|3322696_3323041_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
WP_014907821.1|3323053_3324085_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	1.8e-95
WP_051017642.1|3324284_3324677_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_077260856.1|3324717_3325008_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_012542186.1|3325019_3325253_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_048333319.1|3325907_3327269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907823.1|3327612_3329376_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462584.1|3329688_3330129_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041169042.1|3330142_3330607_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.9e-60
WP_021462582.1|3330599_3331583_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.3e-46
WP_014907826.1|3331634_3332189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3332191_3332407_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3332508_3332898_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_021462581.1|3333740_3333935_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021462580.1|3333977_3334322_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014907830.1|3334463_3336602_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	3.3e-99
WP_012542206.1|3336654_3336900_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|3336880_3338008_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3338125_3339376_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3339616_3340267_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3340283_3340742_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3340798_3341905_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|3341959_3342601_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|3342604_3343975_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_004213084.1|3344029_3344392_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|3344475_3345282_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3345564_3346236_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_015874641.1|3346235_3347702_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004176560.1|3347787_3348909_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190938.1|3349046_3349538_-|transposase	transposase	transposase	NA	NA	NA	NA
3357687:3357704	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 6
NZ_CP026023	Klebsiella pneumoniae strain 11420 chromosome, complete genome	5438591	3598592	3608056	5438591	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_012737718.1|3598592_3600314_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3600358_3601060_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3601413_3601632_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3601752_3604032_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3604062_3604380_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3604705_3604927_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3605003_3606944_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3606940_3608056_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP026024	Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence	229796	65694	187947	229796	integrase,transposase,protease	Bacillus_phage(12.5%)	99	115104:115154	186918:186968
WP_004225018.1|65694_66690_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|66895_67909_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|68021_68549_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077274495.1|68562_71526_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.7	5.1e-50
WP_004144375.1|72367_73228_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|74959_75595_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|75931_77173_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|77257_77833_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|77919_78498_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|78536_79577_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|79600_80056_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_001067855.1|80550_81255_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004196925.1|82054_82639_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|82949_84008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|84019_85162_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|85154_85928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|85929_87009_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_011251315.1|87008_87965_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_011251314.1|87975_89199_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004196888.1|89201_89660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251313.1|90139_90778_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|90802_91444_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004210266.1|91444_92083_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|92175_93216_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011251311.1|93215_94949_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004196935.1|94976_96476_+	kinase	NA	NA	NA	NA	NA
WP_032720951.1|96854_97337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118061.1|97612_98017_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004118062.1|98564_98843_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|98936_99149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251307.1|100179_101679_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.1	1.8e-35
WP_004210292.1|101659_102925_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011154627.1|102942_103233_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210297.1|103244_104207_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_004210298.1|104203_104767_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004210300.1|104777_105887_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_004902273.1|105846_106848_-	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_004210304.1|106861_107344_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210305.1|107710_109111_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004186895.1|109719_110034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|110276_110729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884537.1|114043_115120_-	hypothetical protein	NA	NA	NA	NA	NA
115104:115154	attL	CGTCGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATC	NA	NA	NA	NA
WP_004213836.1|116262_116517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|116694_117831_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|117896_118214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|118365_118689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251302.1|119440_120400_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|120442_120850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|120859_121303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|122566_123535_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|123862_125455_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|125485_125836_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|125832_126273_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|126469_126652_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|127857_128829_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|128828_129995_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004211839.1|130724_131735_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211835.1|134054_134591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|137343_138126_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004902343.1|140472_140910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902347.1|140909_141941_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_011251296.1|141940_142807_-	ParA family protein	NA	NA	NA	NA	NA
WP_011251294.1|143330_143576_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_077250517.1|145491_145650_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_004213558.1|145962_146892_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|147036_147816_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_077250520.1|147812_148625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213565.1|149557_150532_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_023302803.1|151168_152077_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213569.1|152463_152814_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302802.1|152957_153389_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|153639_155115_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004213574.1|155107_155788_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_004213577.1|155977_157363_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213578.1|157391_157754_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213579.1|157867_159160_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|159170_162317_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|162403_162844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153244949.1|162970_165418_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|165458_165656_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|165689_166427_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_048336866.1|166693_167161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213580.1|167394_169212_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_011251290.1|169211_170108_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|170147_170528_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004213583.1|170532_171462_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|171516_172197_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|172193_173594_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_000405672.1|173889_174324_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004213585.1|174409_176815_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|176811_177888_+	signal peptidase II	NA	NA	NA	NA	NA
WP_004213590.1|178017_178575_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_004213592.1|178577_181547_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_004213594.1|181588_182083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213850.1|182316_183240_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_048333570.1|183306_183777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333569.1|185320_185764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153244950.1|185784_186573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035897911.1|187023_187947_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	6.6e-166
186918:186968	attR	CGTCGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATC	NA	NA	NA	NA
>prophage 1
NZ_CP026025	Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence	81180	38905	71513	81180	transposase	Escherichia_phage(21.05%)	32	NA	NA
WP_001067855.1|38905_39610_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_008324180.1|39735_40110_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_015493069.1|40735_41095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324185.1|41476_42205_-	recombinase	NA	NA	NA	NA	NA
WP_008324186.1|42201_42633_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015493071.1|44755_44986_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032072906.1|45963_46224_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
WP_015493073.1|46410_46602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|46644_47151_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|47555_48335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|48388_48808_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|48818_49040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|49039_49717_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|50075_50747_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_015493080.1|50926_51349_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_016479949.1|53531_54503_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|54499_55705_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_022652286.1|56067_56700_+	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_040219232.1|56753_56954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493085.1|57100_58051_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_015493086.1|58047_58659_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493087.1|58655_59051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|59564_60545_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_042934582.1|61196_61754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|62222_62927_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001161490.1|63258_63819_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_013213990.1|65361_65640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|65750_66176_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_004199234.1|68035_68917_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|69192_70173_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|70295_70769_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|70808_71513_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
