The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	849996	890269	4764173	lysis,coat,tail,integrase,protease,portal	Salmonella_phage(46.77%)	64	849909:849931	892256:892278
849909:849931	attL	GCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
WP_000533679.1|849996_851067_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
WP_001556007.1|851044_851263_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_024143053.1|851372_852002_-	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	94.3	4.0e-114
WP_000002103.1|852072_852357_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	2.7e-49
WP_000662459.1|852349_852910_-	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	96.7	8.5e-100
WP_000208144.1|852906_853299_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	59.5	1.0e-38
WP_000161224.1|853302_853521_-	DUF4014 domain-containing protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_020899488.1|853522_854173_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	68.4	4.5e-52
WP_020899487.1|854339_854930_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	73.9	1.7e-74
WP_001214777.1|854926_855097_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|855107_855401_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|855447_855732_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|855731_856439_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000156731.1|856568_856757_-	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|856737_856896_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|856980_857295_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_020899485.1|857570_857849_-	hypothetical protein	NA	C6ZR42	Salmonella_phage	98.9	2.3e-45
WP_000843522.1|858471_858915_-	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_024143050.1|858931_859294_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_020899482.1|859661_859865_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	7.7e-27
WP_020899481.1|859900_860824_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_000250476.1|860909_861620_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_001180316.1|861697_861925_+	transcriptional regulator	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000424167.1|862060_862339_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|862373_862520_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|862512_863328_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_021293879.1|863324_864701_+	AAA family ATPase	NA	A0A075B8G2	Enterobacteria_phage	99.8	5.7e-254
WP_020899478.1|864774_865212_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	1.4e-78
WP_000113765.1|865348_865525_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_001532927.1|865527_865869_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950941.1|865861_866038_+	protein ninF	NA	E7C9S2	Salmonella_phage	100.0	6.7e-27
WP_001107939.1|866030_866636_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_000036320.1|866632_866857_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|866853_867057_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|867037_867217_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|867213_867987_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|868417_868621_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|868598_869096_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|869092_869560_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_015995148.1|869772_870303_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_000808099.1|870525_870768_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|870771_871161_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|871160_871565_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|871568_872057_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_022630929.1|872034_873534_+	DNA packaging protein	NA	Q76H24	Enterobacteria_phage	99.8	8.2e-307
WP_054088298.1|873533_875711_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	99.9	0.0e+00
WP_006831698.1|875724_876636_+	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_001196937.1|876635_877928_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_021293880.1|877966_878176_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	98.6	6.3e-32
WP_001166098.1|878159_878660_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|878619_880038_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|880041_880743_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_070800723.1|880742_881198_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	98.0	5.7e-86
WP_060635073.1|881200_881890_+	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.7	2.9e-89
WP_153260627.1|881932_883270_+	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.5	2.7e-237
WP_048943228.1|883266_885099_+	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	97.3	2.2e-290
WP_050068189.1|885120_885759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151196.1|886030_886216_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_001036007.1|886190_886400_-	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_001283827.1|886396_886648_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_001386205.1|886753_886894_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_040079796.1|886890_887133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001659087.1|887195_888125_+	putative antirepressor	NA	A5VW58	Enterobacteria_phage	90.9	2.9e-161
WP_153260622.1|888304_890269_+|tail	phage tail protein	tail	A0A088F834	Salmonella_phage	80.0	2.3e-240
892256:892278	attR	GCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
>prophage 2
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	1017206	1025938	4764173	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1017206_1018325_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1018321_1020268_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1020397_1020619_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020942_1021263_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1021293_1023570_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1023761_1024220_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1024682_1025938_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	1075962	1166879	4764173	lysis,tail,integrase,protease,terminase,holin,tRNA	Salmonella_phage(60.0%)	90	1078871:1078890	1142767:1142786
WP_001154025.1|1075962_1076766_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1076758_1078081_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1078061_1078766_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022630856.1|1078765_1083232_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1078871:1078890	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1083576_1085418_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085677_1086226_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1086253_1086901_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1086962_1088153_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1088337_1089429_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1090035_1091436_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091636_1092098_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1092414_1093629_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1093873_1095310_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1095387_1096590_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1096784_1098077_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1098121_1098370_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1098410_1098650_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1098692_1099850_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1099812_1103013_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1103139_1103490_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1103538_1103670_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1103966_1104401_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1104506_1104734_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1104768_1105089_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1105173_1106157_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1106159_1106909_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1106919_1107267_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1107263_1107722_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1107725_1108034_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1108037_1108682_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1108681_1108939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1108993_1109971_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1109982_1110579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1111170_1111404_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1111513_1111735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1111819_1112422_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1112630_1113242_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1113238_1113379_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1113375_1114065_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1114259_1114385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1114520_1114970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1115330_1116017_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1116292_1116622_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1116605_1117058_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1117075_1117522_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1117990_1118536_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1119656_1119989_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1120088_1120586_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1120702_1121236_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1121325_1122021_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1122030_1122768_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1122665_1123370_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000178849.1|1126830_1127073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1127126_1129565_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1129564_1130146_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1130621_1131590_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1132237_1132864_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1132932_1133232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1133216_1133903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1134173_1134365_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1134791_1137404_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1137611_1138622_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1138787_1139330_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1139326_1140436_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1140534_1142643_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1142655_1144563_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1142767:1142786	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1144577_1145831_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1145835_1147476_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1147472_1148036_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1148291_1148459_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1148558_1149077_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1149145_1150906_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1151091_1151544_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1151615_1152668_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1153024_1153534_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1153750_1154356_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1154342_1156496_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1156514_1156961_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_022630854.1|1157084_1159139_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	23.8	1.1e-08
WP_000424187.1|1159174_1159633_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1159727_1160390_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1160560_1160977_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1161021_1161339_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1161396_1162608_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1162822_1163371_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1163396_1164176_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1164224_1164506_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1164502_1164832_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1164918_1165578_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1166198_1166879_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	1954653	1961462	4764173	integrase,tail	Salmonella_phage(33.33%)	11	1949516:1949538	1959231:1959253
1949516:1949538	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_031247788.1|1954653_1955535_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1956007_1956196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1956260_1956428_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1956684_1957218_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1957271_1957502_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1957691_1958186_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1958245_1959100_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1959473_1959827_-	YebY family protein	NA	NA	NA	NA	NA
1959231:1959253	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1959843_1960719_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1960719_1961094_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1961231_1961462_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	2065506	2076109	4764173		Morganella_phage(25.0%)	12	NA	NA
WP_001157322.1|2065506_2066937_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2067010_2067706_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2067797_2068097_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2068746_2069943_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2070203_2070392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2070402_2070615_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2071069_2072338_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2072340_2072760_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2072886_2073048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598920.1|2073528_2074326_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2074697_2074988_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2075635_2076109_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 6
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	2162103	2172609	4764173		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2162103_2163417_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2163443_2164523_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2164527_2165301_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2165297_2166290_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2166295_2166847_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2166847_2167726_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2167773_2168673_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2168672_2169758_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2170134_2171028_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2171205_2172609_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	2240917	2250088	4764173	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_022631044.1|2240917_2242951_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2243191_2243650_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2243821_2244352_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2244408_2244876_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2244922_2245642_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2245638_2247324_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2247546_2248278_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2248337_2248445_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2248425_2249157_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2249140_2250088_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	2269495	2335891	4764173	lysis,holin,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2269495_2270191_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2270344_2271229_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2271405_2272125_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2272121_2272367_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2272571_2273813_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2273806_2275042_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2275116_2276127_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2276142_2277663_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2277796_2278795_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2279293_2280316_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2280465_2281608_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2281622_2282291_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2282620_2283478_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2283466_2283856_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2283860_2285228_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2285444_2286332_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2286364_2287687_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2287730_2289722_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2290067_2291537_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2291726_2292590_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2292710_2293760_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2293838_2294696_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2294760_2296449_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2296465_2297404_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2297403_2298534_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2298902_2300084_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2300148_2300814_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2300815_2300938_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2301325_2301580_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2301903_2302476_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2302688_2303675_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2303704_2304424_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2304837_2305410_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2305735_2307292_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2307398_2309204_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2309213_2310308_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2310307_2311333_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2311334_2312924_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2312927_2313272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2313662_2314853_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2314880_2315576_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2315727_2317488_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2317612_2317897_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2318005_2318626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2318653_2319661_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2319840_2320068_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2320099_2321860_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2322140_2322644_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2322671_2322962_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2323309_2325139_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2325192_2325636_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2326013_2326541_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2326543_2327785_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2328377_2328707_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2329003_2330335_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2330363_2330732_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2330746_2331736_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2332064_2334431_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2334599_2334803_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2335099_2335891_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP032494	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 chromosome, complete genome	4764173	4324317	4344737	4764173	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4324317_4325046_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4325242_4325533_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4325781_4326237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4326233_4326839_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4326843_4328589_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4328591_4329224_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4329216_4330332_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4330322_4330682_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4330845_4332393_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4332392_4333322_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4333318_4333681_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4334008_4334731_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4334740_4335784_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4335771_4335981_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4335980_4336934_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_022630954.1|4336933_4339288_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	1.2e-65
WP_001185654.1|4339384_4339513_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4339472_4339790_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4339841_4340366_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4340365_4341793_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4341782_4341980_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4341976_4342432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4342591_4342906_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4342918_4343524_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4343526_4343814_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4344389_4344737_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP032497	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_75, complete sequence	74729	167	68449	74729	integrase,portal,transposase,tail,tRNA	Escherichia_phage(97.56%)	84	122:134	20028:20040
122:134	attL	ATATTTTTCGCGT	NA	NA	NA	NA
WP_001292231.1|167_1196_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
WP_000349257.1|1305_1614_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_001557738.1|1610_2087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557737.1|2083_2578_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	100.0	3.4e-92
WP_001557736.1|2592_3033_+	DUF2829 domain-containing protein	NA	A0A222YXY1	Escherichia_phage	100.0	2.8e-82
WP_022630895.1|3039_3816_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	99.6	1.6e-141
WP_000113017.1|3848_4046_-	hypothetical protein	NA	A0A222YWI9	Escherichia_phage	100.0	2.9e-26
WP_001216038.1|4050_4431_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	100.0	2.5e-63
WP_001190712.1|4430_4652_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000098854.1|4760_5183_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	100.0	1.8e-70
WP_022630896.1|5317_5707_-	DNA repair protein	NA	A0A222YZE2	Escherichia_phage	100.0	2.4e-69
WP_001443773.1|5718_5865_-	hypothetical protein	NA	A0A222YXH0	Escherichia_phage	100.0	1.7e-20
WP_001344848.1|6038_6248_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001142594.1|7579_8035_-	DUF4014 domain-containing protein	NA	A0A222YXP4	Escherichia_phage	100.0	8.8e-79
WP_001557731.1|8036_8252_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	100.0	1.3e-37
WP_001557730.1|8253_8445_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	100.0	4.6e-29
WP_000034256.1|8431_9079_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	100.0	2.9e-115
WP_046891370.1|9065_9365_-	hypothetical protein	NA	A0A222YY12	Escherichia_phage	100.0	1.3e-51
WP_046891371.1|9378_10374_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	100.0	1.9e-198
WP_000616788.1|10472_11165_-	hypothetical protein	NA	A0A222YWF0	Escherichia_phage	100.0	5.7e-138
WP_000022451.1|11161_11473_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	3.4e-58
WP_000139729.1|11469_11694_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	93.2	5.5e-34
WP_001018053.1|11656_11965_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	83.1	3.4e-34
WP_000072161.1|11961_12210_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.1	7.0e-30
WP_000834211.1|12206_12695_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	64.8	6.0e-41
WP_024133811.1|12998_13595_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	99.5	1.1e-108
WP_022630898.1|13882_14461_+	recombinase	NA	A0A222YXV2	Escherichia_phage	100.0	2.5e-78
WP_071526433.1|15134_15254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022630900.1|15272_15488_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
WP_022630901.1|15487_16414_+	DNA-binding protein	NA	A0A222YWG0	Escherichia_phage	82.1	5.7e-141
WP_022630902.1|16473_16758_+	hypothetical protein	NA	A0A222YY28	Escherichia_phage	100.0	1.4e-45
WP_000201621.1|16903_17254_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
WP_024144056.1|17293_18205_-	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	99.7	2.2e-169
WP_001557715.1|18472_19126_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.1	1.4e-114
WP_000542383.1|19454_19784_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_022630904.1|19776_20973_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	96.5	8.5e-198
20028:20040	attR	ACGCGAAAAATAT	NA	NA	NA	NA
WP_022630906.1|21805_22165_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	97.5	2.9e-61
WP_000806445.1|22221_22560_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_000162415.1|22630_22933_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_001557712.1|23095_23887_+	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	100.0	3.6e-152
WP_000203293.1|23883_24651_+	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_000046500.1|24654_25635_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000828868.1|25631_26285_+	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	100.0	1.9e-103
WP_001258018.1|26344_27250_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	100.0	2.2e-166
WP_000812238.1|27233_27914_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_000045489.1|27906_28812_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	100.0	1.0e-174
WP_001287145.1|28860_30522_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.8	0.0e+00
WP_000595051.1|30790_31078_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_000585023.1|31070_31712_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	100.0	7.5e-116
WP_000076908.1|31999_32338_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	100.0	2.3e-52
WP_022630907.1|32350_33307_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	2.9e-180
WP_001272820.1|33573_33858_+	hypothetical protein	NA	A0A222YXW1	Escherichia_phage	100.0	4.7e-38
WP_000887293.1|33857_34664_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	100.0	7.7e-118
WP_000243176.1|34734_35193_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
WP_000020025.1|35346_35805_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_001427915.1|35821_36127_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.0	3.4e-50
WP_001038834.1|36372_38070_+	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
WP_001396841.1|38217_38496_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001033848.1|38563_40222_+|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	99.8	3.7e-311
WP_000801017.1|40265_41000_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001112722.1|41067_41640_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	100.0	6.0e-101
WP_000012433.1|41648_42140_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_000187859.1|42194_42746_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	100.0	1.6e-98
WP_000021878.1|42761_43469_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_001077897.1|43850_44606_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_001025043.1|44994_45816_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	7.7e-158
WP_001067858.1|46232_46937_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001043715.1|47031_48396_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	98.5	3.1e-244
WP_000094097.1|48521_49079_+	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	99.5	2.3e-97
WP_001244352.1|49123_49456_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	99.1	2.6e-56
WP_071802339.1|49954_51223_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	1.7e-244
WP_001557744.1|51236_52235_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	100.0	1.4e-182
WP_022630891.1|52435_53398_+	hypothetical protein	NA	A0A222YXV1	Escherichia_phage	100.0	3.5e-178
WP_000245715.1|53811_54036_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_000350312.1|54035_54743_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	99.1	1.3e-129
WP_001548248.1|54742_54940_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	96.9	7.0e-33
WP_001273800.1|54971_55457_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_022630892.1|55608_62445_+	helicase	NA	A0A222YYH3	Escherichia_phage	99.0	0.0e+00
WP_000209223.1|62481_62916_+	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_001230915.1|62918_63179_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_099145002.1|63432_63810_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	99.2	1.1e-69
WP_000077921.1|64434_65643_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.0	2.9e-230
WP_000467090.1|67850_68285_+	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_000579539.1|68284_68449_+	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
>prophage 1
NZ_CP032496	Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence	90607	18006	62360	90607	transposase	Escherichia_phage(25.0%)	54	NA	NA
WP_001067855.1|18006_18711_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|19261_19966_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|19971_20112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|20597_21335_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|21331_21556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|21766_23260_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|23290_24175_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214123.1|24391_25606_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001255015.1|25633_25939_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|26205_27405_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|27483_28161_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|28192_28435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|28740_29577_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|29576_30380_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|30440_31256_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|31562_31874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|32047_32833_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|32836_34018_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|34066_34339_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|34391_35027_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|35118_35262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|35588_35966_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000044823.1|35958_36240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|36214_36889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|36956_37388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348668.1|37372_37705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647188.1|37713_38214_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000936897.1|38217_39645_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268552.1|39644_40301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464630.1|40356_40974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|41185_41485_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000467110.1|41575_42064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|42078_44271_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_001191890.1|44270_44504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249395.1|44485_45103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326173.1|45270_48243_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_000178857.1|48239_50105_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000332868.1|50115_50700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743449.1|50656_51286_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000122507.1|51295_51742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869297.1|51751_52129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231464.1|52128_52791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326174.1|53114_53492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|53636_53918_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001049717.1|53914_54541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|55537_56242_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001087810.1|56988_57225_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995361.1|57221_57587_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|57698_58337_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_054088333.1|58351_60037_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000732290.1|60108_60384_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|60399_60750_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|60821_61256_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427623.1|61355_62360_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
