The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	3172711	3234152	10929570	transposase,integrase	Gordonia_phage(40.0%)	42	3192558:3192575	3245693:3245710
WP_153278087.1|3172711_3173335_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153278905.1|3174965_3176045_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1U9WS15	Gordonia_phage	32.6	4.9e-11
WP_153278088.1|3176127_3176406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278089.1|3176461_3176692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278090.1|3176999_3177683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033435356.1|3178999_3179854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278091.1|3180037_3181369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435354.1|3181500_3181767_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_153278092.1|3181779_3182028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278093.1|3182080_3184354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435352.1|3184350_3185628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051766949.1|3185816_3186569_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_084717137.1|3186600_3187872_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_033435351.1|3187868_3188546_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_153278094.1|3188637_3188802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278095.1|3188735_3188924_-	DUF3040 domain-containing protein	NA	NA	NA	NA	NA
WP_153278096.1|3190070_3190988_+	hypothetical protein	NA	NA	NA	NA	NA
3192558:3192575	attL	AGGGCGGCGAACGCGGCG	NA	NA	NA	NA
WP_153278097.1|3193440_3193800_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033435349.1|3193891_3194995_+|integrase	site-specific integrase	integrase	A0A159B6J3	Gordonia_phage	29.4	3.5e-20
WP_033435348.1|3195234_3195681_-	TIGR02611 family protein	NA	NA	NA	NA	NA
WP_084717134.1|3195688_3196519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051766945.1|3196461_3197133_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033435346.1|3197354_3197780_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_033435343.1|3202213_3203425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717133.1|3203421_3204366_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033435342.1|3204598_3204862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278098.1|3205304_3206957_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_153278099.1|3207217_3210577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278100.1|3210609_3217455_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_033435340.1|3217451_3217808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278906.1|3217939_3218395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051766938.1|3219362_3222680_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_051766937.1|3222923_3223403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278101.1|3223645_3223786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435339.1|3223795_3224203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278102.1|3224202_3224688_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033435337.1|3225136_3225952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063741534.1|3227408_3228224_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_033435361.1|3228562_3230272_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	21.5	2.2e-05
WP_033435360.1|3230271_3232032_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.7	7.2e-28
WP_153278103.1|3232169_3232964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717135.1|3233855_3234152_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	43.9	3.8e-06
3245693:3245710	attR	AGGGCGGCGAACGCGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	3418320	3447501	10929570	tail,plate,transposase	Bacillus_phage(33.33%)	25	NA	NA
WP_033433189.1|3418320_3419883_+|tail	phage tail sheath family protein	tail	A0A127AW39	Bacillus_phage	31.0	6.9e-22
WP_033433188.1|3419921_3420368_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_033433187.1|3420377_3422024_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_033433186.1|3422025_3422457_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_033433185.1|3422462_3422666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033433184.1|3422670_3423327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033433183.1|3423323_3424397_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_051766416.1|3424406_3425060_+	hypothetical protein	NA	H6WFY4	Cyanophage	34.2	7.1e-05
WP_033433182.1|3425076_3425460_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_033433181.1|3425463_3425880_+	GPW/gp25 family protein	NA	A0A1D8KJJ7	Synechococcus_phage	33.8	2.0e-05
WP_033433180.1|3425876_3427847_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_033433179.1|3427843_3429118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033433178.1|3429128_3430055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033433177.1|3430051_3430807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033433176.1|3430803_3431754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278133.1|3431761_3433087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033433174.1|3433083_3434931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278134.1|3434977_3435334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278135.1|3435357_3436188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084716798.1|3436269_3438396_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_033433170.1|3438398_3442112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278136.1|3442168_3443587_-	actin cross-linking domain-containing toxin	NA	NA	NA	NA	NA
WP_153278137.1|3443642_3444734_-	chlorophyllase	NA	NA	NA	NA	NA
WP_033433168.1|3445922_3446729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278138.1|3446844_3447501_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	6169362	6248985	10929570	transposase,integrase	Pseudomonas_phage(33.33%)	55	6159980:6160001	6247001:6247022
6159980:6160001	attL	GACTTACTGATCTTCAATTCGT	NA	NA	NA	NA
WP_033434951.1|6169362_6170793_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033434919.1|6171197_6171866_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_033434920.1|6172046_6172496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717066.1|6173337_6173751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153278412.1|6174363_6176274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278413.1|6176636_6177233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278414.1|6177256_6177925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434924.1|6178203_6178476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717075.1|6178658_6178838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278415.1|6180070_6180208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717068.1|6180206_6181760_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_153278416.1|6183027_6185331_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_033434925.1|6185568_6185868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717070.1|6186330_6187680_-	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	34.2	1.8e-26
WP_153278417.1|6188069_6188504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434927.1|6188496_6188748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434928.1|6188757_6191802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717076.1|6193052_6194405_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033434929.1|6195637_6196831_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033434930.1|6199223_6199613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278418.1|6200142_6203253_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_033434931.1|6203678_6204206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434932.1|6204340_6205042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434933.1|6205522_6206503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278419.1|6206532_6207477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051766854.1|6207568_6208246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278420.1|6208691_6209216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278421.1|6210012_6210903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278422.1|6211511_6212042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278423.1|6212725_6213976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033434939.1|6214113_6214812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278424.1|6215352_6216618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434941.1|6217138_6218332_+	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_084717072.1|6218328_6218826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033434960.1|6218822_6219947_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_084717073.1|6220009_6221068_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_153278425.1|6221064_6222084_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	37.8	6.8e-55
WP_051766857.1|6222134_6222713_-	dTDP-4-keto-6-deoxy-D-glucose epimerase	NA	I7HJC4	Enterobacteria_phage	33.3	3.3e-06
WP_051766855.1|6223077_6224337_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153278426.1|6224580_6224973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435936.1|6227297_6228137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717218.1|6229901_6230693_+	radical SAM protein	NA	NA	NA	NA	NA
WP_033435938.1|6230720_6231593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717216.1|6231848_6232298_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033435939.1|6233009_6235193_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153278427.1|6237348_6237837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435941.1|6237871_6238435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278428.1|6238529_6238823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435943.1|6239572_6240091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278429.1|6240106_6242230_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_051767101.1|6242352_6243210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717227.1|6244080_6246798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278430.1|6247036_6247633_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
6247001:6247022	attR	GACTTACTGATCTTCAATTCGT	NA	NA	NA	NA
WP_033436072.1|6247557_6248097_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153278431.1|6248158_6248985_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	6255951	6309906	10929570	transposase,integrase	Vibrio_phage(50.0%)	47	6259754:6259771	6315083:6315100
WP_051766960.1|6255951_6256320_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033435424.1|6256654_6257338_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_153278433.1|6257818_6259501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435422.1|6259497_6260616_+	hypothetical protein	NA	NA	NA	NA	NA
6259754:6259771	attL	ACATCGCCCACCACACCG	NA	NA	NA	NA
WP_153278434.1|6260738_6262463_+	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_033435421.1|6262528_6263476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278435.1|6263613_6263883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278436.1|6265195_6266191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435418.1|6266340_6267120_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_051766957.1|6267187_6268558_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_084717139.1|6268738_6269308_+	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_033435416.1|6269313_6269622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051766956.1|6269614_6269965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435415.1|6270326_6271592_+	methyltransferase, FxLD system	NA	A0A1J0MC37	Streptomyces_phage	37.5	1.0e-15
WP_033435432.1|6271607_6271808_+	FxLD family lantipeptide	NA	NA	NA	NA	NA
WP_153278957.1|6272014_6274945_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_033435413.1|6274941_6276165_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_063741544.1|6276146_6278321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435412.1|6278692_6279199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051766955.1|6279824_6280199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278437.1|6280332_6281211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435411.1|6281404_6282256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278438.1|6282252_6282723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435410.1|6282638_6283457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278439.1|6283458_6283755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278440.1|6284594_6285236_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153278441.1|6286866_6287979_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1U9WS15	Gordonia_phage	32.6	5.1e-11
WP_051767105.1|6288089_6289160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033436046.1|6289189_6289474_+	hypothetical protein	NA	A0A2I7RIS9	Vibrio_phage	30.0	4.7e-06
WP_033436045.1|6289954_6291790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033436044.1|6291955_6292201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033436051.1|6292708_6292984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717234.1|6293114_6294263_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033436050.1|6294684_6295656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278442.1|6295830_6296592_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033435689.1|6297721_6298267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278443.1|6298719_6299106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435687.1|6299205_6299553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051767031.1|6299618_6300275_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_051767030.1|6300512_6301994_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_033435686.1|6301993_6302551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435685.1|6302812_6303271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278444.1|6303395_6303968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051767029.1|6303964_6304603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717171.1|6304796_6305222_+	DUF4326 domain-containing protein	NA	A0A2I7QWU1	Vibrio_phage	47.7	1.2e-16
WP_153278445.1|6306355_6308410_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153278446.1|6308670_6309906_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6315083:6315100	attR	ACATCGCCCACCACACCG	NA	NA	NA	NA
>prophage 5
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	6368818	6392598	10929570	transposase,integrase	Escherichia_phage(33.33%)	21	6365726:6365742	6401065:6401081
6365726:6365742	attL	CGCGGCGGCCGAGCAGG	NA	NA	NA	NA
WP_153278960.1|6368818_6369823_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033435558.1|6369833_6370250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033435559.1|6371151_6371463_+|transposase	transposase	transposase	A0A0N7C1Z2	Escherichia_phage	39.8	8.0e-07
WP_153278465.1|6371518_6372349_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.4	3.8e-35
WP_153278466.1|6372489_6373599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278467.1|6373740_6374331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033435561.1|6374540_6375272_-	TIGR02391 family protein	NA	C7BGE5	Burkholderia_phage	36.1	1.1e-22
WP_153278468.1|6375947_6376749_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153278469.1|6376866_6378141_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_033435564.1|6378149_6378470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717158.1|6378514_6379093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033435567.1|6380674_6381256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278470.1|6381453_6383226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084717159.1|6383880_6384129_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051766999.1|6384250_6385639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033435574.1|6386003_6387707_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_051766997.1|6387706_6389593_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153278471.1|6389926_6390838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084717160.1|6390815_6391367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033436072.1|6391537_6392077_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153278430.1|6392001_6392598_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
6401065:6401081	attR	CGCGGCGGCCGAGCAGG	NA	NA	NA	NA
>prophage 6
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	7527231	7586907	10929570	plate,tRNA,tail,transposase,integrase	Mycobacterium_phage(18.18%)	43	7528374:7528392	7558929:7558947
WP_033429242.1|7527231_7527711_-|tRNA	arginine--tRNA ligase	tRNA	A0A1S5V1P6	Saudi_moumouvirus	32.6	1.8e-13
WP_033429341.1|7528101_7529829_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.7	9.1e-84
7528374:7528392	attL	CGACCCGCGGCTGGGCGTG	NA	NA	NA	NA
WP_051764982.1|7530712_7531975_-	MFS transporter	NA	NA	NA	NA	NA
WP_153278580.1|7531971_7533135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033429240.1|7533897_7535337_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033429238.1|7535649_7536108_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033429237.1|7536152_7536929_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_033429236.1|7536983_7538147_-	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_084716156.1|7538244_7539285_-	peptide synthase	NA	NA	NA	NA	NA
WP_033429235.1|7539343_7540261_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051764980.1|7540299_7541724_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_033429337.1|7541824_7543201_-	aminotransferase	NA	NA	NA	NA	NA
WP_033429234.1|7543294_7544275_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_051764978.1|7544306_7546130_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153278581.1|7546183_7547455_-	kinase-like protein	NA	NA	NA	NA	NA
WP_063741267.1|7547423_7555085_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.0	8.8e-46
WP_033429232.1|7555489_7555978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033429231.1|7556132_7557398_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	1.1e-51
WP_153278979.1|7557900_7558563_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	38.1	6.5e-14
WP_033429230.1|7558604_7559207_-|tRNA	arginine--tRNA ligase	tRNA	A0A0G2Y627	Acanthamoeba_polyphaga_mimivirus	41.7	2.2e-16
7558929:7558947	attR	CACGCCCAGCCGCGGGTCG	NA	NA	NA	NA
WP_033429229.1|7559286_7560984_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_033429333.1|7561352_7562309_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_033429228.1|7562578_7563577_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_033429227.1|7563579_7564560_+	hypothetical protein	NA	T2FJV2	Mycobacterium_phage	42.2	1.7e-63
WP_084716169.1|7564571_7565774_+	adenylosuccinate synthetase	NA	G1FIX2	Mycobacterium_phage	44.2	4.6e-58
WP_033429226.1|7565770_7566406_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033429225.1|7566466_7566871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037330888.1|7567672_7571257_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153278582.1|7571553_7571706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278583.1|7571796_7571967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033435992.1|7571968_7572589_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_084717222.1|7572811_7573912_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_033435983.1|7575479_7576034_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_033435984.1|7576030_7577965_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_033435985.1|7577964_7578375_-	GPW/gp25 family protein	NA	A0A0E3F3H3	Synechococcus_phage	36.4	1.9e-08
WP_033435986.1|7578371_7578686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033435987.1|7578700_7580398_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_051767090.1|7580394_7581066_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033435988.1|7581178_7581613_-|tail	phage tail protein	tail	T2KSM5	uncultured_phage	28.6	3.6e-05
WP_153278584.1|7581639_7581936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033435974.1|7584444_7584906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033435975.1|7584902_7585343_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_033435976.1|7585383_7586907_-|tail	phage tail sheath family protein	tail	H6WFT7	Cyanophage	28.9	1.1e-24
>prophage 7
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	9133235	9138638	10929570	transposase,integrase	Gordonia_phage(80.0%)	8	9120524:9120541	9144213:9144230
9120524:9120541	attL	CGGTCGCGGCCGGCGTGG	NA	NA	NA	NA
WP_153279007.1|9133235_9133712_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	54.5	1.2e-17
WP_153278704.1|9133573_9134059_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	43.3	7.8e-17
WP_033430605.1|9134146_9134380_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.7	2.6e-10
WP_084716330.1|9134595_9136971_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_033430606.1|9137125_9137326_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_153279008.1|9137431_9137602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153278705.1|9137562_9138324_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	49.8	1.9e-54
WP_153278706.1|9138179_9138638_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	64.2	9.3e-28
9144213:9144230	attR	CCACGCCGGCCGCGACCG	NA	NA	NA	NA
>prophage 8
NZ_CP034550	Saccharothrix syringae strain NRRL B-16468 chromosome, complete genome	10929570	9449826	9498056	10929570	protease,integrase	Bacillus_phage(40.0%)	46	9449073:9449089	9503419:9503435
9449073:9449089	attL	GTCGCCGATGCCCTGCC	NA	NA	NA	NA
WP_033436069.1|9449826_9451023_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_153278724.1|9451025_9452252_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_033431425.1|9452426_9452693_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033431426.1|9452831_9453482_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.3	2.4e-05
WP_033431427.1|9453485_9455129_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_033431428.1|9455169_9455994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033431429.1|9455990_9456833_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033431430.1|9456832_9457981_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033431586.1|9457973_9459089_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.8e-24
WP_084716459.1|9459288_9459591_+	DUF2631 domain-containing protein	NA	NA	NA	NA	NA
WP_033431432.1|9459747_9460239_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_033431433.1|9460631_9461738_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_033431434.1|9461844_9462480_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033431435.1|9462535_9463519_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_051765919.1|9463583_9464330_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033431588.1|9464385_9465201_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_033431436.1|9465214_9466180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033431437.1|9466250_9467018_+	VOC family protein	NA	NA	NA	NA	NA
WP_033431438.1|9467021_9467873_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_033431439.1|9467956_9468514_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_033431440.1|9468562_9469333_-	UMP kinase	NA	NA	NA	NA	NA
WP_033431441.1|9469400_9470216_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_033431442.1|9470310_9471141_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_033431590.1|9472541_9473312_-	FliA/WhiG family RNA polymerase sigma factor	NA	A0A1I9S6C3	Bacillus_phage	26.8	4.9e-05
WP_033431443.1|9473634_9474612_-	tyrosine recombinase XerC	NA	A0A1D8EVX7	Mycobacterium_phage	30.5	4.8e-13
WP_033431592.1|9475257_9476391_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_084716485.1|9477734_9478871_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_084716465.1|9478867_9479395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278725.1|9479960_9480479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084716466.1|9480640_9481762_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	28.4	4.3e-18
WP_033431445.1|9481739_9482369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084716468.1|9482460_9483096_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_084716470.1|9483011_9483896_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_051765931.1|9483873_9484638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033431446.1|9484985_9485210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084716487.1|9485499_9486384_-	AbiV family abortive infection protein	NA	NA	NA	NA	NA
WP_051765933.1|9486608_9487196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278726.1|9487192_9488083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278727.1|9488421_9489648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084716471.1|9489783_9490023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278728.1|9490323_9490611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084716489.1|9490595_9491771_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033431450.1|9492148_9492397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278729.1|9492483_9492804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153278730.1|9494517_9495702_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_051765941.1|9495698_9498056_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
9503419:9503435	attR	GTCGCCGATGCCCTGCC	NA	NA	NA	NA
