The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	1316228	1343312	4703534	transposase,tRNA	Shigella_phage(28.57%)	28	NA	NA
WP_153248167.1|1316228_1317335_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_153248168.1|1317921_1318212_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	53.8	4.2e-18
WP_153248169.1|1319270_1319588_+|transposase	transposase	transposase	Q716C1	Shigella_phage	32.3	2.4e-06
WP_153248170.1|1319626_1320073_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_153248171.1|1319873_1320455_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	44.3	1.1e-36
WP_153248172.1|1322336_1322630_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	58.3	1.2e-20
WP_153248173.1|1322967_1323300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153248174.1|1323296_1323518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248175.1|1323526_1323808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153248176.1|1323813_1324005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248177.1|1324297_1325497_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_153250920.1|1325800_1326331_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	45.9	1.7e-28
WP_153248178.1|1326702_1327233_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_153248179.1|1327237_1327819_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_153250921.1|1327818_1328619_-|tRNA	methionine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_153248180.1|1331201_1332113_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_153248181.1|1332244_1333462_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_153248182.1|1333541_1333988_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_153248183.1|1334144_1334534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248184.1|1334587_1334953_-	signal peptidase I	NA	NA	NA	NA	NA
WP_153248185.1|1335136_1335964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248186.1|1336237_1336444_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.3	1.1e-15
WP_153248187.1|1336896_1337739_+	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_153248188.1|1338025_1339240_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_153248189.1|1339416_1339845_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_153248190.1|1339862_1340255_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_153248191.1|1340992_1341799_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.9	5.8e-33
WP_153250922.1|1341788_1343312_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	1576882	1618058	4703534	protease,transposase,tRNA	Paenibacillus_phage(40.0%)	36	NA	NA
WP_153248370.1|1576882_1578292_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_153250943.1|1578306_1578774_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153248371.1|1578779_1580165_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	35.0	9.0e-42
WP_153248372.1|1580278_1580953_+	DUF2959 family protein	NA	NA	NA	NA	NA
WP_153248373.1|1582141_1582471_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_153248374.1|1582558_1582717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248375.1|1582710_1583871_-	aminotransferase	NA	NA	NA	NA	NA
WP_153248376.1|1584054_1585014_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_153248377.1|1585180_1585885_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153248378.1|1586001_1587279_+	sulfite dehydrogenase	NA	NA	NA	NA	NA
WP_153250944.1|1587316_1587790_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_153248379.1|1587808_1589125_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_153248380.1|1589121_1590141_+	response regulator	NA	NA	NA	NA	NA
WP_153248381.1|1590173_1591469_-	quorum-sensing autoinducer synthase	NA	NA	NA	NA	NA
WP_153248382.1|1591696_1591990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153248383.1|1592126_1592273_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_153248384.1|1592440_1592812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248386.1|1593475_1594426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248387.1|1594827_1596225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248389.1|1596662_1598309_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_153250945.1|1598425_1599208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250946.1|1599399_1600176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250947.1|1600235_1602263_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_153248390.1|1602578_1604057_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	37.2	3.1e-80
WP_153248391.1|1604155_1605115_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_153248393.1|1605645_1606410_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	42.1	1.4e-20
WP_153248394.1|1607163_1607448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248396.1|1607955_1608324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248397.1|1608571_1608763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248399.1|1608759_1608906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248401.1|1608997_1609585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248402.1|1610060_1611284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248404.1|1611313_1613575_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153248406.1|1613624_1615457_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153248408.1|1615847_1616612_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.3	1.2e-19
WP_153248410.1|1616843_1618058_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.9e-51
>prophage 3
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2036892	2161126	4703534	protease,transposase,tRNA,integrase	Bacillus_phage(14.29%)	115	2038140:2038199	2140693:2140916
WP_153247699.1|2036892_2037762_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	1.7e-54
WP_153247700.1|2037758_2038076_-|transposase	transposase	transposase	Q716C1	Shigella_phage	33.3	8.2e-07
2038140:2038199	attL	AGGTTGGCAAAAAACGGCAGCAATTGCGCACGTTTCAGCTGTTTTTTCAAACTCGCCTTA	NA	NA	NA	NA
WP_153248725.1|2038767_2039508_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_153248726.1|2039578_2040088_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153248727.1|2040140_2041220_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_153248728.1|2041471_2043325_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.2	3.4e-12
WP_153248729.1|2043435_2045226_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.2	1.6e-30
WP_153248730.1|2045228_2046092_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.7	2.1e-28
WP_153248731.1|2046123_2046918_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153248732.1|2046928_2047711_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153248733.1|2048326_2049403_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153248734.1|2049535_2050630_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153248735.1|2050744_2052091_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_153248736.1|2052321_2052825_+	DUF1993 family protein	NA	NA	NA	NA	NA
WP_153248737.1|2053141_2053819_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_153248738.1|2053910_2055323_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_153248739.1|2055444_2055945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248740.1|2056049_2056454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248741.1|2056446_2056953_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153248742.1|2056964_2057399_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153248743.1|2057654_2058533_+	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_153248744.1|2058557_2059100_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_153248745.1|2059434_2059836_-	FosX/FosE/FosI family fosfomycin resistance thiol transferase	NA	NA	NA	NA	NA
WP_153248746.1|2059964_2061329_-	cytochrome B6	NA	NA	NA	NA	NA
WP_153248747.1|2061764_2062964_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_153248748.1|2063723_2064257_+	cytochrome b	NA	NA	NA	NA	NA
WP_153248749.1|2064320_2064917_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_153248750.1|2065283_2066951_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_153248751.1|2068080_2068413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248752.1|2068740_2069919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248753.1|2070665_2070926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248754.1|2071371_2071527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248755.1|2071779_2071938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248756.1|2072057_2072558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248757.1|2072568_2072832_-	hypothetical protein	NA	A0A2H4N801	Lake_Baikal_phage	52.3	2.2e-10
WP_153248758.1|2072831_2073350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248759.1|2073350_2074247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248760.1|2074243_2074618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248761.1|2074626_2075130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248762.1|2075023_2075767_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	41.4	3.0e-15
WP_153248763.1|2075777_2076038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248764.1|2076049_2076478_-	glycoside hydrolase family protein	NA	A0A0M5M782	Salmonella_phage	47.4	7.6e-24
WP_153248765.1|2076829_2077684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248766.1|2077981_2080153_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_153248767.1|2080565_2080733_+	hypothetical protein	NA	K4NZS9	Burkholderia_phage	66.0	4.9e-11
WP_153250858.1|2080839_2081883_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.3	2.9e-77
WP_153247439.1|2081879_2082677_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.3	2.2e-80
WP_153250982.1|2083290_2084004_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	41.0	3.9e-41
WP_153248768.1|2084597_2084984_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153248769.1|2084964_2085282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153250983.1|2085761_2086676_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_153248770.1|2086937_2087207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248771.1|2087749_2088487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248772.1|2088483_2089401_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_153250984.1|2089631_2091155_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_153248773.1|2091144_2091951_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.3	7.6e-33
WP_153248774.1|2093352_2093886_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_153248775.1|2094205_2095288_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_153248776.1|2095284_2095479_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153248777.1|2095451_2096192_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153248778.1|2098529_2099024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153250985.1|2099487_2100831_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_153248779.1|2100963_2101197_+	addiction module protein	NA	NA	NA	NA	NA
WP_153248780.1|2101181_2101478_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153248781.1|2103094_2103283_+	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	52.5	9.4e-11
WP_153248782.1|2103293_2103506_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.1	2.1e-06
WP_153248775.1|2103934_2105017_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_153248776.1|2105013_2105208_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153248777.1|2105180_2105921_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153248783.1|2106550_2107435_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153248784.1|2107550_2108492_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_153248785.1|2109104_2109596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248786.1|2110133_2111045_-	recombination-associated protein RdgC	NA	A0A2I7RNT5	Vibrio_phage	41.6	2.3e-62
WP_153248787.1|2111193_2111397_+	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_153248788.1|2111400_2112849_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_153248789.1|2112932_2113463_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_153248790.1|2113466_2114444_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_153248791.1|2114883_2115306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248792.1|2116183_2117725_+	membrane-bound lytic murein transglycosylase MltF	NA	Q3T526	Enterobacteria_phage	33.9	2.8e-07
WP_153248793.1|2117736_2118165_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_153248794.1|2118240_2119083_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_153248795.1|2119392_2119875_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_153248796.1|2119968_2120535_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	33.9	1.1e-09
WP_153248797.1|2120830_2121751_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_153248798.1|2121887_2122136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250986.1|2122254_2123952_+	MCE family protein	NA	NA	NA	NA	NA
WP_153248799.1|2123948_2124545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248800.1|2124602_2126087_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_153248801.1|2126475_2126835_+	competence protein ComE	NA	NA	NA	NA	NA
WP_153248802.1|2126930_2127809_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.8	4.4e-66
WP_153248803.1|2127846_2128227_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_153250987.1|2128422_2133324_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
WP_153248804.1|2133444_2133867_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_153248805.1|2133881_2134481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248806.1|2134565_2135462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248807.1|2135463_2136345_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_153248808.1|2136420_2137164_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_153248809.1|2137165_2138533_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_153248810.1|2138547_2139804_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_153248811.1|2140096_2140522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248812.1|2140621_2141659_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2140693:2140916	attR	TAAGGCGAGTTTGAAAAAACAGCTGAAACGTGCGCAATTGCTGCCGTTTTTTGCCAACCTTCCGTCGTGTTTAATCGGAATGGAAGCCTGCGGAAGTGCACATTACTGGGCCAGAAAGCTCAAGGAGCATGGACACACGGTCAAGTTAATGGCTCCACAATTCATCAAGCCTTATGTGAAGACGAACAAAAATGATGTTGCGGATGCCGAGGCGATTTGTGAGG	NA	NA	NA	NA
WP_153250988.1|2142012_2142612_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153248813.1|2143543_2144980_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
WP_153248814.1|2145011_2149646_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_153248815.1|2150085_2151303_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_153248816.1|2151371_2151737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248817.1|2151757_2152138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248818.1|2152368_2154843_-	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.1	1.5e-71
WP_153248819.1|2154941_2156090_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_153248820.1|2156484_2157426_+	EamA family transporter	NA	NA	NA	NA	NA
WP_153250989.1|2157612_2158005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248821.1|2158236_2158704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248822.1|2158717_2158942_+	DUF2970 domain-containing protein	NA	NA	NA	NA	NA
WP_153250990.1|2159043_2160381_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_153250991.1|2160793_2161126_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	60.4	4.4e-11
>prophage 4
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2207125	2270850	4703534	protease,transposase,tRNA,integrase	uncultured_Mediterranean_phage(25.0%)	57	2205897:2205956	2209704:2209941
2205897:2205956	attL	TGTAACGACCCGCAATCGAAAACACATGAACCCGCAATCAGCGCATCGGCAAACCCAGAT	NA	NA	NA	NA
WP_153247652.1|2207125_2208808_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_153247653.1|2208782_2209358_-	helix-turn-helix domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	55.3	8.1e-45
WP_153250858.1|2210524_2211568_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.3	2.9e-77
2209704:2209941	attR	ATCTGGGTTTGCCGATGCGCTGATTGCGGGTTCATGTGTTTTCGATTGCGGGTCGTTACATTTAGCCTTGACCATACCGGCTGCCCGTTGATGTTTTAACCGGTAACTGTCGCCGGCAATCGGCACGATATGGGCGTGATGAAGCAAGCGATCCAGCAGAGCGGCAGTCAGCGTTGCGTCCTGAGCAAAGGTCGCGTCCCACTGTCCGAACGGCAAGTTGCTGGTTACAATCAGGCTG	NA	NA	NA	NA
WP_153250999.1|2211652_2213176_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_153248860.1|2213551_2214349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248861.1|2214345_2214597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248862.1|2214584_2214872_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153248863.1|2214947_2215634_-	hypothetical protein	NA	Q6UAZ2	Ralstonia_phage	27.9	3.6e-07
WP_153248864.1|2215664_2216657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248865.1|2217229_2217379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248866.1|2217420_2219724_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_153248867.1|2219773_2220265_-	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_153248868.1|2220556_2220775_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_153248869.1|2220913_2221645_-	arginyltransferase	NA	NA	NA	NA	NA
WP_153248870.1|2221641_2222343_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_153248871.1|2222347_2222971_-	methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_153248872.1|2223244_2224111_+	methylenetetrahydrofolate dehydrogenase	NA	NA	NA	NA	NA
WP_153248873.1|2224211_2226113_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	8.1e-118
WP_153248874.1|2227155_2228028_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_153248875.1|2228287_2229016_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_153248876.1|2229012_2229786_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_153248877.1|2229875_2230763_-	GTPase Era	NA	NA	NA	NA	NA
WP_153248878.1|2230762_2231452_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	32.9	4.2e-24
WP_153248879.1|2231448_2231799_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_153248880.1|2231829_2232606_-	signal peptidase I	NA	NA	NA	NA	NA
WP_153248881.1|2232615_2234427_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.8	8.8e-21
WP_153248882.1|2235243_2237154_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	7.1e-13
WP_153248883.1|2237181_2238744_+	chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	24.7	6.9e-06
WP_153248884.1|2238871_2239933_+	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	NA	NA	NA	NA
WP_153248885.1|2239949_2240573_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153248886.1|2240562_2241426_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_153248887.1|2241422_2241794_+	response regulator	NA	A0A2K9L1Q0	Tupanvirus	33.3	9.0e-05
WP_153248888.1|2241790_2244196_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_153248889.1|2244192_2244447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248890.1|2244443_2244818_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	1.7e-11
WP_153251000.1|2245526_2246963_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	4.0e-24
WP_153248891.1|2247076_2247514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248892.1|2247510_2248524_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_153248893.1|2248492_2249050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153251001.1|2249046_2249601_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	25.7	2.1e-05
WP_153248894.1|2250200_2251835_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_153248895.1|2251880_2252237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248896.1|2252474_2253230_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	61.2	4.7e-85
WP_153251002.1|2253253_2253886_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.5	1.5e-36
WP_153248897.1|2254006_2254492_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_153251003.1|2255173_2257369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153251004.1|2257818_2258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248898.1|2259216_2259816_-	alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_153248899.1|2259812_2260865_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_153248900.1|2260901_2262197_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	34.2	3.6e-69
WP_153248901.1|2262275_2263469_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_153251005.1|2263574_2264435_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_153248902.1|2264434_2265655_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_153248903.1|2265769_2267053_-	GTPase HflX	NA	NA	NA	NA	NA
WP_153248904.1|2267101_2267347_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_153248905.1|2267446_2268805_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_153248906.1|2268924_2270850_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	43.1	4.8e-118
>prophage 5
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2323858	2333598	4703534		Pseudomonas_phage(30.0%)	13	NA	NA
WP_153248957.1|2323858_2325067_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	47.3	1.7e-84
WP_153248958.1|2325063_2325543_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	42.9	1.1e-26
WP_153248959.1|2325539_2326502_+	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	46.5	1.4e-73
WP_153248960.1|2326498_2327362_+	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	44.3	4.9e-62
WP_153248961.1|2327428_2327644_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_153248962.1|2327673_2329104_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	56.9	1.8e-24
WP_153248963.1|2329081_2329327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248964.1|2329323_2330223_+	DUF1376 domain-containing protein	NA	A0A2I7QS92	Vibrio_phage	46.2	7.2e-16
WP_153248965.1|2330086_2330890_+	AAA family ATPase	NA	A0A1Y0T033	Pseudomonas_phage	35.0	9.0e-26
WP_153248966.1|2330889_2331357_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	37.0	5.4e-23
WP_153248967.1|2331356_2331665_+	hypothetical protein	NA	A0A0H5ARP9	Pseudomonas_phage	49.4	1.1e-13
WP_153248968.1|2332039_2332771_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153251008.1|2333076_2333598_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	56.4	3.5e-31
>prophage 6
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2382344	2400276	4703534	transposase,integrase	Staphylococcus_prophage(20.0%)	20	2386505:2386518	2401110:2401123
WP_153247527.1|2382344_2383388_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.3e-52
WP_153249014.1|2383443_2383911_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_153249015.1|2384005_2384455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249016.1|2384644_2384932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249017.1|2384931_2386431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249018.1|2386427_2387876_+	hypothetical protein	NA	NA	NA	NA	NA
2386505:2386518	attL	GCGACAGCTTTTTC	NA	NA	NA	NA
WP_153249019.1|2387878_2388640_+	hypothetical protein	NA	K4I002	Acidithiobacillus_phage	34.5	1.4e-31
WP_153249020.1|2388647_2388839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249021.1|2388851_2390120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249022.1|2390123_2390831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249023.1|2390843_2391404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249024.1|2391420_2393127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249025.1|2393167_2393584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249026.1|2394000_2394363_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	36.5	1.7e-16
WP_153249027.1|2394569_2395175_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	54.3	6.7e-50
WP_153251013.1|2395295_2395874_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	35.8	1.8e-12
WP_153249028.1|2396148_2397387_-	porin	NA	NA	NA	NA	NA
WP_153249029.1|2398289_2399372_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_153249030.1|2399368_2399563_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153249031.1|2399535_2400276_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2401110:2401123	attR	GCGACAGCTTTTTC	NA	NA	NA	NA
>prophage 7
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2508766	2541975	4703534	transposase,integrase	Acinetobacter_phage(28.57%)	32	2528307:2528322	2551140:2551155
WP_153249115.1|2508766_2509528_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	32.0	3.6e-16
WP_153249031.1|2509567_2510308_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153249030.1|2510280_2510475_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153249029.1|2510471_2511554_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_153249116.1|2512076_2512244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249117.1|2512334_2512562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249118.1|2512667_2513591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249119.1|2514166_2515387_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_153249120.1|2515399_2516008_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_153249121.1|2516007_2516670_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_153249122.1|2516674_2517586_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_153249123.1|2517578_2518781_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_153249124.1|2518786_2520145_-	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_153251021.1|2520424_2521249_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_153249125.1|2521310_2521925_-	chorismate lyase	NA	NA	NA	NA	NA
WP_153251022.1|2522030_2524097_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_153249126.1|2524122_2524524_-	RidA family protein	NA	NA	NA	NA	NA
WP_153251023.1|2524520_2526716_-	RelA/SpoT family protein	NA	NA	NA	NA	NA
WP_153249127.1|2526817_2527102_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_153249128.1|2527368_2528550_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
2528307:2528322	attL	CGATGCTGTCGACCAC	NA	NA	NA	NA
WP_153249129.1|2528581_2529139_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_153249130.1|2529492_2534934_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153251024.1|2535266_2535491_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	48.6	1.2e-12
WP_153249131.1|2535503_2536145_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.9	7.2e-26
WP_153249132.1|2536051_2536219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249133.1|2536407_2536713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249134.1|2536757_2537813_-	Na+-dependent transporter	NA	NA	NA	NA	NA
WP_153249135.1|2537840_2538095_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.0e-20
WP_153249136.1|2538106_2538604_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.8	8.0e-33
WP_153249137.1|2538652_2539282_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_153249138.1|2539271_2540600_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	21.2	8.2e-16
WP_153249139.1|2540589_2541975_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	24.9	1.9e-23
2551140:2551155	attR	GTGGTCGACAGCATCG	NA	NA	NA	NA
>prophage 8
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2577400	2643169	4703534	transposase,bacteriocin	Bacillus_phage(23.08%)	56	NA	NA
WP_153247527.1|2577400_2578444_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.3e-52
WP_153251031.1|2578472_2580011_+	serine hydrolase	NA	NA	NA	NA	NA
WP_153251032.1|2580149_2580971_+	alpha/beta fold hydrolase	NA	A0A2R4AP45	Mycobacterium_phage	31.7	2.9e-19
WP_153249165.1|2581225_2581723_+	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	35.8	4.9e-14
WP_153249166.1|2581825_2583868_-	cellulose-binding protein	NA	M1HTM3	Paramecium_bursaria_Chlorella_virus	29.1	2.5e-08
WP_153249167.1|2584085_2585087_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153249168.1|2585083_2585389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249169.1|2585539_2586040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249170.1|2586186_2586849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249171.1|2586899_2588132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153251033.1|2588122_2589646_+	GTP-binding protein HSR1	NA	NA	NA	NA	NA
WP_153249172.1|2589853_2592454_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_153249173.1|2592923_2595572_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_153249174.1|2595632_2596259_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_153249175.1|2596342_2596990_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_153249176.1|2597016_2597667_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_153251034.1|2598029_2598650_+	DedA family protein	NA	NA	NA	NA	NA
WP_153249177.1|2598784_2601478_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153249178.1|2601477_2603331_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_153249179.1|2603327_2603882_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_153249180.1|2603903_2604377_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_153249181.1|2604518_2606315_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.3	3.7e-11
WP_153249182.1|2606453_2607272_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_153249183.1|2607271_2607739_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	3.3e-36
WP_153249184.1|2607738_2608470_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	48.0	8.1e-42
WP_153249185.1|2609035_2610109_+	ribonuclease T	NA	NA	NA	NA	NA
WP_153249186.1|2610128_2611325_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_153250884.1|2611499_2612468_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	60.4	2.2e-103
WP_153249187.1|2612582_2612804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249188.1|2612923_2613478_+	FMN reductase	NA	NA	NA	NA	NA
WP_153249189.1|2613489_2614347_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_153249190.1|2614401_2615538_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_153249191.1|2615576_2616770_-	monooxygenase	NA	NA	NA	NA	NA
WP_153249192.1|2616766_2617882_-	dimethyl sulfone monooxygenase SfnG	NA	NA	NA	NA	NA
WP_153249193.1|2617897_2619082_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_153249194.1|2619129_2620494_-	long-chain fatty acid transport protein	NA	NA	NA	NA	NA
WP_153249195.1|2620806_2624508_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.8	1.8e-12
WP_153249196.1|2624811_2625540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249197.1|2625997_2626150_+	DUF3096 domain-containing protein	NA	NA	NA	NA	NA
WP_153251035.1|2626282_2627368_+	MlaE family lipid ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153249198.1|2627370_2628141_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_153249199.1|2628160_2629126_+	MCE family protein	NA	NA	NA	NA	NA
WP_153249200.1|2629215_2629599_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_153249201.1|2629737_2630715_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_153249202.1|2630716_2632168_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_153249203.1|2632696_2633428_+	peptidase	NA	NA	NA	NA	NA
WP_153249204.1|2633568_2633778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249205.1|2633850_2634024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249206.1|2634186_2634531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153247527.1|2634584_2635628_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.3e-52
WP_153249207.1|2635590_2635839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249208.1|2635877_2636258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249209.1|2636250_2636835_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153249210.1|2636863_2639749_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	23.0	4.1e-20
WP_153249211.1|2639748_2641902_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.1	6.1e-37
WP_153249212.1|2641906_2643169_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
>prophage 9
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2691837	2737159	4703534	protease,transposase	Shigella_phage(20.0%)	46	NA	NA
WP_153251041.1|2691837_2692413_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.3	1.9e-38
WP_153249246.1|2693501_2693831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249247.1|2694095_2694242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249248.1|2694312_2694708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249249.1|2694877_2696809_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	34.4	1.1e-98
WP_153249250.1|2696810_2697284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249251.1|2697270_2697525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153251042.1|2697529_2698294_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_153251043.1|2698328_2700116_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_153249252.1|2700126_2700720_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_153249253.1|2700520_2701072_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_153251044.1|2701077_2702730_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_153249254.1|2702993_2705354_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153249255.1|2705510_2705951_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.5	2.2e-18
WP_153249256.1|2705824_2706226_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153249257.1|2706714_2706894_+	cobalt transporter	NA	NA	NA	NA	NA
WP_153249258.1|2706908_2707586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249259.1|2707582_2708374_+	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_153249260.1|2708370_2709210_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_153249261.1|2709452_2710109_+	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_153249262.1|2710114_2711227_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_153249263.1|2711219_2712506_+	precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE	NA	NA	NA	NA	NA
WP_153249264.1|2712498_2713266_+	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_153249265.1|2713285_2713690_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_153249266.1|2713696_2714449_+	cobalamin biosynthesis protein CbiG	NA	NA	NA	NA	NA
WP_153249267.1|2714451_2714844_+	cobalamin biosynthesis protein CbiG	NA	NA	NA	NA	NA
WP_153251045.1|2714833_2716216_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_153249268.1|2716208_2716565_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_153249269.1|2716884_2717166_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_153249270.1|2717312_2717624_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_153249271.1|2717762_2718986_-	transporter	NA	NA	NA	NA	NA
WP_153249272.1|2719117_2719591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249273.1|2719652_2720138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249274.1|2720789_2722022_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_153249275.1|2722018_2722876_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_153249276.1|2722872_2723934_+	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	NA	NA	NA	NA
WP_153251046.1|2724053_2724515_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_153249277.1|2724545_2728706_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	2.4e-13
WP_153249278.1|2728935_2729349_+	response regulator	NA	NA	NA	NA	NA
WP_153249279.1|2729584_2733007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249280.1|2733187_2733517_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_153249281.1|2733800_2734082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249282.1|2734086_2734440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249283.1|2734445_2734799_-	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_153251047.1|2735035_2736412_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_153251048.1|2736766_2737159_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	8.8e-27
>prophage 10
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	2772947	2781455	4703534		Staphylococcus_phage(33.33%)	10	NA	NA
WP_153249315.1|2772947_2774336_-	replicative DNA helicase	NA	O80281	Escherichia_phage	56.5	7.2e-140
WP_153251055.1|2774328_2774820_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_153249316.1|2774840_2775809_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_153249317.1|2775805_2776258_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_153249318.1|2776254_2776734_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.3	7.5e-28
WP_153249319.1|2776734_2777874_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	M4QPK3	Synechococcus_phage	41.6	8.0e-36
WP_153249320.1|2777883_2778540_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.1	5.3e-24
WP_153249321.1|2778547_2779657_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	7.7e-44
WP_153249322.1|2779680_2780181_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_153249323.1|2780198_2781455_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A240F3L3	Aeromonas_phage	52.5	9.5e-99
>prophage 11
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	3002889	3081587	4703534	protease,transposase,tRNA	Leptospira_phage(18.18%)	60	NA	NA
WP_153250884.1|3002889_3003858_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	60.4	2.2e-103
WP_153249508.1|3003963_3004167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249509.1|3004159_3007162_-	histidine kinase	NA	A0A1B5FPD5	Escherichia_phage	32.1	9.0e-79
WP_153249510.1|3007154_3008324_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	3.0e-38
WP_153249511.1|3008572_3008890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249512.1|3008997_3010113_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_153251069.1|3010109_3011075_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_153249513.1|3011074_3012943_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.1	1.0e-88
WP_153249514.1|3013363_3014086_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153251070.1|3014368_3014890_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_153249515.1|3015154_3015634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249516.1|3015903_3018759_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_153249517.1|3018841_3019522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249518.1|3019596_3023094_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_153249519.1|3023153_3024914_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_153249520.1|3024972_3025572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153251071.1|3025568_3027263_-	MCE family protein	NA	NA	NA	NA	NA
WP_153251072.1|3027301_3027949_-	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
WP_153249521.1|3027948_3028572_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_153249522.1|3028564_3030907_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_153249523.1|3031294_3032101_-	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_153249524.1|3032300_3033224_-	DUF2092 domain-containing protein	NA	NA	NA	NA	NA
WP_153249525.1|3033290_3034025_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_153249526.1|3034311_3034809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249527.1|3034973_3035804_-	DUF3313 family protein	NA	NA	NA	NA	NA
WP_153249528.1|3036309_3037902_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_153249529.1|3037895_3039119_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153249530.1|3039115_3042259_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.4	3.6e-46
WP_153249531.1|3042311_3042806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249532.1|3043331_3044078_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_153249533.1|3044552_3045353_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_153249534.1|3045868_3047455_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_153249535.1|3047487_3048714_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153249536.1|3048713_3051938_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.5	6.5e-51
WP_153249537.1|3052152_3054123_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	7.6e-18
WP_153249538.1|3054402_3054600_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_153249539.1|3054709_3054871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249540.1|3055164_3056256_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_153249541.1|3056599_3057904_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_153249542.1|3058004_3058451_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_153249543.1|3058507_3059407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249544.1|3059529_3059760_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_153249545.1|3059786_3060203_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_153249546.1|3060459_3060888_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_153249547.1|3061045_3061783_+	elongation factor-1 alpha	NA	NA	NA	NA	NA
WP_153249548.1|3062063_3062747_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_153249549.1|3062743_3063880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249550.1|3063882_3064284_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_153249551.1|3064287_3065676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249552.1|3065688_3067548_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_153249553.1|3067675_3070021_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_153249554.1|3070623_3072525_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153251073.1|3072531_3073512_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_153249555.1|3073731_3075351_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_153249556.1|3075741_3076464_+	elongation factor-1 alpha	NA	NA	NA	NA	NA
WP_153249557.1|3076541_3076862_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.5	1.5e-11
WP_153249558.1|3076908_3079194_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.2e-171
WP_153249559.1|3079397_3080483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153248169.1|3080403_3080721_+|transposase	transposase	transposase	Q716C1	Shigella_phage	32.3	2.4e-06
WP_153249058.1|3080717_3081587_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	5.3e-56
>prophage 12
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	3454731	3508023	4703534	transposase,tRNA	Staphylococcus_phage(14.29%)	53	NA	NA
WP_153249863.1|3454731_3455676_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_153249864.1|3456077_3456530_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_153249865.1|3456526_3457873_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	A0A1V0SAH6	Catovirus	25.4	2.3e-05
WP_153251099.1|3457872_3459723_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_153249866.1|3459866_3460994_-	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_153249867.1|3461000_3462794_-	oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_153249868.1|3462821_3463085_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_153249869.1|3463253_3463517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249870.1|3463709_3464306_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	31.7	9.7e-09
WP_153249871.1|3464438_3464807_+	cytochrome C555	NA	NA	NA	NA	NA
WP_153249872.1|3464892_3466152_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.5	2.4e-25
WP_153249873.1|3466210_3466687_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	43.0	1.0e-24
WP_153249874.1|3466774_3468133_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_153249875.1|3468132_3468588_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_153249876.1|3468577_3468853_+	RnfH family protein	NA	NA	NA	NA	NA
WP_153249877.1|3469004_3469346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249878.1|3469411_3469903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249879.1|3469968_3470184_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	5.3e-10
WP_153249880.1|3470389_3470785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249881.1|3471127_3472255_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	41.7	4.8e-17
WP_153249882.1|3472276_3472813_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_153251100.1|3472818_3473604_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_153249883.1|3473674_3475219_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	22.2	5.6e-08
WP_153249884.1|3475407_3476151_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_153249885.1|3476267_3477284_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_153249886.1|3477374_3477875_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_153249887.1|3477876_3479607_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.9	1.5e-57
WP_153249888.1|3479842_3480538_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153249889.1|3480546_3480996_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_153249890.1|3480992_3481229_-	DUF2191 domain-containing protein	NA	NA	NA	NA	NA
WP_153249891.1|3481393_3484501_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	26.8	2.3e-77
WP_153249892.1|3484532_3484961_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153248169.1|3485019_3485337_+|transposase	transposase	transposase	Q716C1	Shigella_phage	32.3	2.4e-06
WP_153249058.1|3485333_3486203_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	5.3e-56
WP_153249893.1|3486280_3486712_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_153249894.1|3487567_3488611_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_153249895.1|3488791_3490192_+	amino acid permease	NA	NA	NA	NA	NA
WP_153249896.1|3490297_3490585_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_153249897.1|3490584_3491229_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_153249898.1|3491447_3493154_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_153249899.1|3493150_3494074_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_153251101.1|3494119_3494965_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_153249900.1|3494965_3495829_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_153249901.1|3496316_3496826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249902.1|3496822_3497143_-	DUF5132 domain-containing protein	NA	NA	NA	NA	NA
WP_153249903.1|3497563_3498334_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_153249904.1|3498390_3499605_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	38.8	6.2e-71
WP_153249905.1|3499604_3502652_-	HAD-IC family P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	27.4	1.6e-62
WP_153249906.1|3503067_3504447_+	ribulose-bisphosphate carboxylase	NA	NA	NA	NA	NA
WP_153249907.1|3504520_3505114_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_153249229.1|3505638_3505965_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_153249364.1|3505952_3506303_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_153251037.1|3506430_3508023_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	40.4	1.7e-92
>prophage 13
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	3559821	3673395	4703534	transposase,tRNA,integrase	Escherichia_phage(14.29%)	99	3576193:3576220	3641323:3641350
WP_153249939.1|3559821_3561045_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	49.9	2.3e-105
WP_153249940.1|3561120_3561450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249941.1|3563380_3564187_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.9	2.2e-32
WP_153249942.1|3564313_3564586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249943.1|3564582_3564951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153251107.1|3565269_3565698_+	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_153249944.1|3565875_3567153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153249945.1|3567366_3569208_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153249946.1|3569444_3569762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153249947.1|3569719_3570628_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.0e-54
WP_153249948.1|3570887_3571490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249949.1|3571979_3572219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249950.1|3572601_3573102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249951.1|3573311_3573479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249952.1|3573952_3574351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249953.1|3575192_3576119_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.5	1.0e-28
3576193:3576220	attL	AATCGCGGGCTGAAGCCCGCTCCTACAG	NA	NA	NA	NA
WP_153249954.1|3576270_3577053_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_153249955.1|3577070_3578009_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_153249956.1|3578370_3579465_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2P1ELT3	Moumouvirus	31.8	1.8e-37
WP_153251108.1|3579514_3580639_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_153249957.1|3580671_3581181_+	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_153249958.1|3581177_3581909_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_153249959.1|3581912_3582419_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_153249960.1|3584886_3585693_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.9	5.8e-33
WP_153249961.1|3586316_3586631_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	2.6e-13
WP_153249962.1|3586645_3586939_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153249963.1|3587282_3587678_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	42.5	6.0e-07
WP_153249964.1|3587817_3588099_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_153249965.1|3588108_3588390_-	peptidase	NA	NA	NA	NA	NA
WP_153249966.1|3588805_3589300_-	cytochrome	NA	NA	NA	NA	NA
WP_153251109.1|3589460_3590789_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.3	3.6e-11
WP_153249967.1|3591708_3593952_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.6	5.7e-86
WP_153249968.1|3594393_3595587_-	bacteriohemerythrin	NA	G3MA91	Bacillus_virus	32.2	1.5e-13
WP_153251110.1|3595732_3597736_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	3.7e-137
WP_153249969.1|3597767_3598565_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_153249970.1|3598574_3602108_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_153249971.1|3602212_3602848_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_153249972.1|3602795_3603419_-	ribonuclease HII	NA	NA	NA	NA	NA
WP_153249973.1|3603469_3604240_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_153249974.1|3604236_3604677_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_153249975.1|3604878_3605460_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_153249976.1|3605684_3608198_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_153249977.1|3608426_3609146_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_153249978.1|3609334_3610531_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_153249979.1|3610546_3611362_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_153251111.1|3611461_3611866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249980.1|3612261_3614181_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_153249981.1|3614194_3615013_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_153249982.1|3615047_3619121_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	36.3	6.6e-24
WP_153249983.1|3619532_3620171_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	38.3	2.0e-28
WP_153249984.1|3620202_3620340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249985.1|3620356_3621295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153249986.1|3621463_3622480_+	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.5	1.3e-08
WP_153249987.1|3622564_3623470_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_153249988.1|3623498_3624488_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	46.1	4.3e-70
WP_153249989.1|3624626_3625208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249990.1|3626388_3626706_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153249991.1|3626663_3627572_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.8e-54
WP_153249992.1|3627597_3628596_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	49.5	2.5e-78
WP_153249993.1|3628820_3629411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249994.1|3631357_3631669_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_153249995.1|3631661_3631943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153249996.1|3632056_3632380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153249997.1|3632421_3633186_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.3	4.1e-20
WP_153249998.1|3633298_3633580_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	53.9	1.4e-18
WP_153251112.1|3633536_3633674_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_153249999.1|3633991_3636340_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_153250000.1|3636543_3637866_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_153250001.1|3638431_3638566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250002.1|3639054_3639285_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_153250003.1|3639281_3640433_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_153250004.1|3640557_3641301_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_153250005.1|3641382_3642426_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
3641323:3641350	attR	CTGTAGGAGCGGGCTTCAGCCCGCGATT	NA	NA	NA	NA
WP_153250006.1|3642412_3642898_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_153250007.1|3642885_3643596_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_153250008.1|3643588_3644038_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_153250009.1|3644052_3645336_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	4.9e-143
WP_153250010.1|3645492_3646317_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.0	8.0e-54
WP_153250011.1|3646313_3647951_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	1.1e-155
WP_153250012.1|3648014_3648497_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_153250013.1|3648502_3649036_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_153250014.1|3649221_3650097_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_153250015.1|3650098_3651241_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_153250016.1|3651237_3655119_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	61.4	5.3e-124
WP_153250017.1|3655135_3655639_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_153250018.1|3656234_3656897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250019.1|3657093_3660573_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_153251113.1|3660589_3661387_-	FkbM family methyltransferase	NA	A0A218MM68	uncultured_virus	27.6	3.9e-05
WP_153250020.1|3661379_3662435_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	44.5	2.2e-80
WP_153250021.1|3662455_3663568_-	alkene reductase	NA	NA	NA	NA	NA
WP_153250022.1|3663903_3664125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250023.1|3664229_3665906_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_153250024.1|3666198_3668016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153250025.1|3668142_3668922_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_153250026.1|3669101_3669416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153250027.1|3669479_3671048_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153251114.1|3671298_3671481_-	addiction module toxin, HicA family	NA	A0A0U4KLG1	Pseudomonas_phage	50.8	5.5e-08
WP_153251115.1|3672017_3672230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250028.1|3672630_3673395_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	42.1	1.8e-20
>prophage 14
NZ_CP044205	Candidatus Methylospira mobilis strain Shm1 chromosome, complete genome	4703534	4120660	4154455	4703534	protease,transposase,integrase	Escherichia_phage(37.5%)	32	4137393:4137407	4153148:4153162
WP_153250385.1|4120660_4121470_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_153250386.1|4121802_4122735_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_153250387.1|4122731_4123436_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
WP_153251147.1|4123522_4123978_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153250388.1|4124003_4124567_-	flavodoxin	NA	NA	NA	NA	NA
WP_153250389.1|4124838_4126167_+	protein kinase	NA	NA	NA	NA	NA
WP_153250390.1|4126230_4129104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153250391.1|4129132_4129330_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_153250392.1|4129293_4129686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250393.1|4129773_4131885_-	N-6 DNA methylase	NA	A0A142K7G3	Mycobacterium_phage	25.0	1.3e-31
WP_153250394.1|4132082_4134779_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153250395.1|4135663_4137853_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
4137393:4137407	attL	AACGCAGCCAGATTG	NA	NA	NA	NA
WP_153251148.1|4137865_4138009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153251037.1|4138236_4139829_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	40.4	1.7e-92
WP_153249364.1|4139956_4140307_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_153249229.1|4140294_4140621_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_153250396.1|4140748_4142134_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_153250397.1|4142168_4142405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153250398.1|4142978_4143311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153250399.1|4143323_4144907_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153250400.1|4145269_4146286_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_153250401.1|4146602_4147106_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153250402.1|4147531_4147720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153250403.1|4147920_4148376_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.4	3.6e-40
WP_153250404.1|4148345_4148657_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	1.4e-06
WP_153250405.1|4148984_4150118_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	44.9	2.9e-78
WP_153250406.1|4150114_4150393_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_153250407.1|4150389_4150620_+	YgiT-type zinc finger protein	NA	NA	NA	NA	NA
WP_153250408.1|4151129_4151498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153248859.1|4151701_4152508_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.3	2.6e-33
WP_153247439.1|4152617_4153415_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.3	2.2e-80
4153148:4153162	attR	CAATCTGGCTGCGTT	NA	NA	NA	NA
WP_153250858.1|4153411_4154455_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.3	2.9e-77
