The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	198457	267671	2084408	transposase,tRNA,protease	Lactobacillus_virus(11.11%)	58	NA	NA
WP_020829427.1|198457_199120_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003630784.1|199280_199880_-	DUF159 family protein	NA	NA	NA	NA	NA
WP_046813814.1|200008_201031_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003625568.1|201056_201536_+	hypothetical protein	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
WP_046813815.1|201516_202134_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_046813816.1|202433_205097_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.7	3.1e-38
WP_046813817.1|205190_207167_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.4	4.7e-100
WP_153245647.1|207167_207956_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_153245648.1|207982_208489_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_046813818.1|208478_209363_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003625575.1|209424_209682_+	Veg protein	NA	NA	NA	NA	NA
WP_025283232.1|209783_210614_+	pur operon repressor	NA	NA	NA	NA	NA
WP_003625577.1|210660_212046_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.0	7.9e-30
WP_153245649.1|212226_212901_+	S-layer protein	NA	NA	NA	NA	NA
WP_153245650.1|212846_213269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813820.1|213363_214326_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	49.5	4.9e-95
WP_046813821.1|214644_215670_+	cell separation protein	NA	NA	NA	NA	NA
WP_046813822.1|215804_217199_+	cell division protein	NA	NA	NA	NA	NA
WP_046813823.1|217440_218415_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	3.8e-47
WP_003630873.1|219443_219719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245651.1|219750_221130_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.1	1.4e-31
WP_014562952.1|221225_221627_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003625588.1|221674_222232_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003625589.1|222349_223969_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
WP_025283238.1|224098_225394_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_023191958.1|225518_225740_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_080553148.1|225746_226136_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_046813824.1|226191_227616_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_025283240.1|227696_228521_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_046813825.1|228620_229895_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	6.2e-29
WP_046814578.1|229898_230477_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_080948185.1|231629_232841_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	54.4	2.1e-111
WP_153245652.1|233230_234811_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.3e-23
WP_023190992.1|235001_235154_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046814579.1|235196_235490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813827.1|237974_239210_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	3.4e-101
WP_003625728.1|241761_242007_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003625729.1|242133_243501_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_046813828.1|243514_245026_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	8.6e-70
WP_046813829.1|245109_245466_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_025283252.1|245468_246599_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	1.2e-28
WP_025283253.1|246845_247331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245653.1|247479_249201_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.1e-87
WP_153245654.1|249190_249940_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_025283255.1|250072_251044_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_025283256.1|251178_251736_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_046813830.1|251738_255236_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003625749.1|255248_255491_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003631236.1|255556_255934_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003625754.1|255934_256297_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003625756.1|256337_257594_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_046813831.1|257688_259854_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	48.0	6.0e-109
WP_046813832.1|259907_260798_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_103658229.1|260873_261902_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_046813833.1|261918_263469_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	2.0e-82
WP_025283264.1|263780_264263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625767.1|264629_265085_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_046813834.1|265190_267671_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.4	1.6e-118
>prophage 2
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	372870	382544	2084408	integrase	uncultured_virus(50.0%)	7	366600:366628	374094:374122
366600:366628	attL	ATAAAATTAGCACTATTTGTAAAAAAGTG	NA	NA	NA	NA
WP_046813870.1|372870_374022_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.8	7.0e-56
WP_153245665.1|374271_374544_+	co-chaperone GroES	NA	A0A221S465	uncultured_virus	37.8	2.7e-11
374094:374122	attR	ATAAAATTAGCACTATTTGTAAAAAAGTG	NA	NA	NA	NA
WP_003627769.1|374598_376221_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	53.8	2.9e-156
WP_153245832.1|376403_378980_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.1	2.1e-39
WP_046813872.1|378979_380890_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.5	9.8e-55
WP_153245666.1|380891_381479_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003627765.1|381527_382544_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
>prophage 3
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	388335	475653	2084408	transposase,tRNA	Staphylococcus_phage(16.67%)	58	NA	NA
WP_003627754.1|388335_390975_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	3.6e-63
WP_003627753.1|391035_391293_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003627752.1|391292_391721_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003627751.1|391723_392035_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_046813877.1|392099_394457_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_003627748.1|396157_396469_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.8	1.3e-17
WP_046813879.1|396512_396884_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_014563094.1|398259_398673_-	YslB family protein	NA	NA	NA	NA	NA
WP_003627745.1|398749_399553_+	glutamate racemase	NA	NA	NA	NA	NA
WP_046813880.1|399552_400173_+	XTP/dITP diphosphatase	NA	A0A2P1DNN4	Cassava_brown_streak_virus	34.2	1.5e-12
WP_038525310.1|401615_402467_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003627742.1|402599_403025_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_003632094.1|403042_403414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245669.1|403483_404593_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_046813881.1|404733_405735_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	4.9e-21
WP_003627737.1|407278_407599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918341.1|407613_409005_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	22.9	2.5e-07
WP_025283315.1|408988_409612_+	YutD family protein	NA	NA	NA	NA	NA
WP_046813883.1|410389_410998_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_153245670.1|411015_411675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245833.1|411735_412581_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2K9L162	Tupanvirus	27.6	5.9e-12
WP_003627915.1|422382_423546_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_153245671.1|423575_424604_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_046813886.1|424604_425630_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003627918.1|425702_427760_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	7.9e-143
WP_003632304.1|427826_428060_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_025283863.1|428134_430474_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.6	1.2e-83
WP_046813887.1|430486_430945_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	1.6e-43
WP_014918044.1|433118_433304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814445.1|436663_437587_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003629925.1|438003_439203_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.0	1.8e-139
WP_046814444.1|439221_440682_+	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
WP_079227881.1|441524_442790_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_046814443.1|444836_445499_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_020829371.1|445786_448201_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.9	0.0e+00
WP_046814442.1|448294_449941_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046814441.1|450141_451170_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.9	3.1e-47
WP_153245672.1|451684_452377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814439.1|452395_452851_+	pullulanase	NA	NA	NA	NA	NA
WP_046814437.1|455110_455734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629914.1|456807_457140_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_003629913.1|457129_457780_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_080948229.1|457870_458818_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.9	2.2e-79
WP_046814654.1|458956_459070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023062153.1|459125_459425_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023190432.1|459545_459839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629897.1|460450_460759_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_046814435.1|461059_462355_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.7	5.0e-18
WP_046814434.1|462357_463206_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003627252.1|463332_464007_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_080948228.1|464405_464789_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046814653.1|465841_466891_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.6	1.8e-50
WP_003617037.1|468319_468955_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_046814433.1|469208_470006_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_052747919.1|471605_472331_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_080948228.1|472612_472996_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025283839.1|474428_474956_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_046814432.1|475050_475653_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	740375	824833	2084408	integrase,head,capsid,transposase,holin,tail,portal,tRNA,terminase,protease	Lactobacillus_phage(59.09%)	95	741891:741907	788088:788104
WP_080948225.1|740375_741320_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.2e-10
WP_153245685.1|741316_742636_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
741891:741907	attL	TTGATCAATTAAAAAAA	NA	NA	NA	NA
WP_153245686.1|742640_743390_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_153245687.1|743386_745393_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8QNG7	Ectocarpus_siliculosus_virus	29.2	1.8e-19
WP_025283689.1|745402_746293_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003627579.1|746305_746956_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003627578.1|746955_747642_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_046814338.1|747683_747989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814337.1|748143_749361_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	42.9	1.1e-78
WP_046814336.1|749515_750043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814335.1|750073_750499_-	hypothetical protein	NA	F8J1D9	Lactobacillus_phage	38.0	2.0e-16
WP_046814334.1|750499_750865_-	helix-turn-helix domain-containing protein	NA	A0A1B0Y3N1	Lactobacillus_phage	34.9	7.2e-07
WP_046814333.1|751123_751312_+	antirepressor	NA	Q9T1I7	Lactobacillus_phage	59.7	3.1e-14
WP_153245688.1|751320_751629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814639.1|751612_751915_+	hypothetical protein	NA	Q37943	Lactococcus_phage	41.6	1.5e-13
WP_046814331.1|752158_752494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814330.1|752480_752762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814329.1|752754_753003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814328.1|753127_754405_+	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	58.3	2.9e-135
WP_153245689.1|754408_755401_+|integrase	tyrosine-type recombinase/integrase	integrase	A8ATD6	Listeria_phage	35.4	1.6e-53
WP_046814326.1|755400_756072_+	N-6 DNA methylase	NA	A0A2D1GPI7	Lactobacillus_phage	45.9	6.7e-51
WP_046814325.1|756071_756335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814324.1|756312_756759_+	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	39.6	3.2e-17
WP_046814323.1|756761_757268_+	hypothetical protein	NA	J3IZ07	Acanthamoeba_polyphaga_lentillevirus	42.9	2.5e-26
WP_046814322.1|757268_758033_+	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	59.2	1.2e-72
WP_046814321.1|758035_758611_+	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	51.3	3.2e-49
WP_046814320.1|758701_759499_+	DNA primase	NA	U3PBE3	Lactobacillus_phage	66.2	5.1e-90
WP_046814319.1|759491_760814_+	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	47.6	1.9e-105
WP_046814318.1|761107_761293_+	hypothetical protein	NA	Q20DE7	Lactobacillus_phage	64.6	2.4e-11
WP_080948264.1|761462_761828_+	DUF1599 domain-containing protein	NA	F8J1G5	Lactobacillus_phage	48.8	6.1e-14
WP_046814317.1|761820_762003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245690.1|761977_762148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814316.1|762159_762501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814315.1|762828_763407_+	hypothetical protein	NA	A0A172JIG4	Bacillus_phage	45.3	3.3e-30
WP_046814314.1|763396_763756_+	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	80.0	1.4e-50
WP_046814313.1|763752_764361_+	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	44.9	1.8e-39
WP_046814312.1|764380_764830_+	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	40.3	8.6e-18
WP_046814311.1|765379_765910_+	HNH endonuclease	NA	Q9T1G1	Lactobacillus_phage	54.4	6.3e-52
WP_046814310.1|766066_766519_+|terminase	phage terminase small subunit P27 family	terminase	Q9T1G0	Lactobacillus_phage	69.9	1.0e-55
WP_153245691.1|766515_766659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814309.1|766778_768677_+|terminase	terminase large subunit	terminase	Q9T1F9	Lactobacillus_phage	58.3	4.8e-211
WP_046814637.1|768666_768849_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_046814308.1|768865_770020_+|portal	phage portal protein	portal	Q9T1F8	Lactobacillus_phage	53.7	3.4e-111
WP_046814307.1|769994_770705_+|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	67.0	2.1e-79
WP_046814306.1|770725_771967_+|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	63.4	6.5e-132
WP_046814305.1|771987_772347_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9T1F5	Lactobacillus_phage	44.0	2.4e-15
WP_080948222.1|772306_772663_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_046814303.1|772655_773096_+	hypothetical protein	NA	Q9T1F3	Lactobacillus_phage	40.4	1.4e-25
WP_046814302.1|773092_773482_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_046814301.1|773463_774168_+|tail	tail protein	tail	Q9T1F1	Lactobacillus_phage	41.1	9.3e-27
WP_046814300.1|774271_774616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814299.1|774647_774830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814298.1|774834_780996_+	tape measure protein	NA	B8R657	Lactobacillus_phage	29.0	1.1e-09
WP_046814297.1|780979_781759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814296.1|781758_785091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814295.1|785100_785286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814294.1|785251_786880_+	DUF2479 domain-containing protein	NA	B8R660	Lactobacillus_phage	38.1	1.7e-18
WP_046814293.1|786899_787364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814292.1|787522_788107_+	hypothetical protein	NA	NA	NA	NA	NA
788088:788104	attR	TTGATCAATTAAAAAAA	NA	NA	NA	NA
WP_046814291.1|788276_788729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080948221.1|788728_788878_+	XkdX family protein	NA	NA	NA	NA	NA
WP_046814290.1|788849_789266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814289.1|789281_789509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814288.1|789498_789894_+|holin	phage holin	holin	Q6SEB6	Lactobacillus_prophage	54.5	4.3e-29
WP_046814287.1|789886_790741_+	glycoside hydrolase family 25	NA	Q9AZ81	Lactobacillus_prophage	53.8	1.2e-84
WP_046814286.1|791249_791435_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003547910.1|791590_791953_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003627574.1|791975_793637_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_046814636.1|793639_795670_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_025283686.1|795691_796693_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003627571.1|796724_796967_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
WP_046814285.1|797088_798123_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	6.0e-14
WP_003629095.1|798127_799114_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.7e-13
WP_012212411.1|799116_800076_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_046814284.1|800091_801021_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_153245692.1|801234_802986_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003627561.1|805059_805746_+	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.6	8.2e-20
WP_046814282.1|805761_809331_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_046814281.1|810668_812090_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003627557.1|812289_812577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629078.1|812643_814071_-	amino acid permease	NA	NA	NA	NA	NA
WP_153245836.1|814196_814406_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080948220.1|814357_815152_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	6.4e-24
WP_003627552.1|815266_815608_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_046814280.1|815612_817043_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003627549.1|817133_817406_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_153245693.1|817475_818000_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003629071.1|818810_819158_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_046814146.1|819608_820466_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814278.1|820516_821176_+	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.9	2.8e-09
WP_046814277.1|821168_821954_+	SGNH/GDSL hydrolase family protein	NA	Q6SEC0	Lactobacillus_prophage	24.0	1.2e-06
WP_003627542.1|821982_822609_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_003627541.1|822760_823024_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003627540.1|823086_823305_+	YneF family protein	NA	NA	NA	NA	NA
WP_080948219.1|823603_824833_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	40.8	1.4e-75
>prophage 5
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	859859	917984	2084408	transposase,integrase,terminase	Lactobacillus_phage(50.0%)	70	874642:874658	888442:888458
WP_080948218.1|859859_860687_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814268.1|861054_862893_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	2.4e-21
WP_003627502.1|862895_863585_+	class A sortase	NA	NA	NA	NA	NA
WP_046814267.1|863705_865979_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.7	6.4e-77
WP_003628968.1|866084_866612_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_046814266.1|866756_867686_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.2	6.4e-100
WP_080948217.1|867701_868496_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_046813730.1|869746_870604_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003627493.1|871219_871720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245696.1|871880_873626_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.2e-87
WP_153245697.1|873601_875905_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.0	2.3e-42
874642:874658	attL	CTTAAAAGAAAACAATA	NA	NA	NA	NA
WP_025283661.1|876000_876855_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014918653.1|880156_880693_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_118953895.1|880814_881981_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046814263.1|882160_882766_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_052747906.1|884661_885876_-|integrase	site-specific integrase	integrase	F8J1D8	Lactobacillus_phage	32.4	1.0e-44
WP_046814262.1|886242_886530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227881.1|886621_887887_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_046814261.1|888289_888895_-	hypothetical protein	NA	NA	NA	NA	NA
888442:888458	attR	TATTGTTTTCTTTTAAG	NA	NA	NA	NA
WP_046814260.1|888929_889148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245698.1|889248_889398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052747905.1|889452_890103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245699.1|890153_890609_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	35.0	5.1e-10
WP_046814259.1|890595_890976_-	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	36.5	3.8e-11
WP_046814258.1|891140_891383_+	helix-turn-helix transcriptional regulator	NA	E9LUL5	Lactobacillus_phage	40.6	7.6e-05
WP_046814257.1|891385_892135_+	antirepressor	NA	Q6SE99	Lactobacillus_prophage	72.3	9.0e-105
WP_046814256.1|892146_892368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814255.1|892360_892603_+	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	37.1	1.3e-07
WP_046814254.1|892781_892997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245700.1|893052_893196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814253.1|893350_893530_+	hypothetical protein	NA	L0P6F4	Lactobacillus_phage	88.1	9.2e-24
WP_046814252.1|893760_894132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814251.1|894152_895034_+	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	29.2	1.6e-23
WP_046814250.1|895036_895834_+	replication protein	NA	Q6SE93	Lactobacillus_prophage	45.5	6.3e-56
WP_046814249.1|896657_897272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814248.1|897274_897598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814247.1|897587_897929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052747904.1|897925_898324_+	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	69.5	5.4e-16
WP_046814246.1|898316_898526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814245.1|898515_898809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814244.1|898905_899250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814242.1|899483_899672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814241.1|899664_899895_+	hypothetical protein	NA	X2CXN1	Lactobacillus_phage	42.9	4.2e-05
WP_046814629.1|899891_900437_+	methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	49.7	2.5e-43
WP_046814240.1|900421_900721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814239.1|901058_901241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814238.1|901237_901690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814237.1|901692_901875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245701.1|901861_902311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814235.1|902459_904136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814234.1|904135_904378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814233.1|904553_904802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814232.1|904849_905353_+	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	38.2	3.9e-11
WP_153245702.1|906538_906712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814231.1|906708_906927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052747903.1|906913_907246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245703.1|907232_907388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052747902.1|907547_908060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080948263.1|908139_909510_+|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	49.2	1.3e-117
WP_052747901.1|909522_911010_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	31.5	7.4e-50
WP_046814229.1|910987_911764_+	hypothetical protein	NA	A8ATG2	Listeria_phage	31.6	8.4e-29
WP_080948214.1|911776_912166_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046814228.1|912168_913317_+	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	41.7	3.6e-28
WP_052747900.1|913316_913865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120357349.1|913861_914845_+	DUF2184 domain-containing protein	NA	D6PSX7	Lactobacillus_phage	27.5	5.7e-14
WP_046814226.1|914844_915240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052747899.1|915236_915773_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	33.3	4.0e-22
WP_046814225.1|915785_916181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814224.1|916164_916728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814223.1|916727_917984_+	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	33.9	2.5e-43
>prophage 6
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1258726	1305741	2084408	plate,integrase,head,transposase,holin,terminase	Lactobacillus_phage(46.43%)	53	1267016:1267031	1314112:1314127
WP_046814082.1|1258726_1259146_-|holin	phage holin	holin	U3PBD0	Lactobacillus_phage	38.5	8.6e-12
WP_046814081.1|1259135_1259390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814080.1|1259445_1259694_-	hypothetical protein	NA	L0P7C5	Lactobacillus_phage	61.7	4.3e-11
WP_046814079.1|1259696_1260296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814078.1|1260332_1261007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814077.1|1261119_1261983_-	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	33.6	1.3e-25
WP_052747893.1|1262016_1263600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814076.1|1264208_1265390_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	34.9	3.9e-62
WP_046814075.1|1265382_1265763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814074.1|1265755_1266235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814073.1|1266247_1267219_-	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	26.5	4.3e-14
1267016:1267031	attL	TTTACTATAAAAATTT	NA	NA	NA	NA
WP_046814072.1|1267218_1267629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814071.1|1267638_1268670_-	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	33.3	4.9e-16
WP_052747892.1|1268684_1273532_-	tape measure protein	NA	Q9T1E7	Lactobacillus_phage	44.6	4.2e-94
WP_046814070.1|1273599_1273851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814069.1|1273801_1274254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814068.1|1274269_1274707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814067.1|1274722_1275850_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	33.5	1.6e-49
WP_046814066.1|1275849_1276416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814065.1|1276405_1276810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814064.1|1276806_1277439_-	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	35.9	2.1e-25
WP_046814063.1|1277438_1277840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814062.1|1277855_1278794_-	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_046814060.1|1279371_1280490_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	45.7	6.4e-38
WP_046814059.1|1280489_1280858_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046814058.1|1281423_1282221_-|head	phage head morphogenesis protein	head	L7TMD0	Rhizobium_phage	37.5	8.1e-19
WP_046814057.1|1282207_1283611_-	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	30.3	5.5e-47
WP_080948204.1|1283625_1285116_-|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	44.9	9.5e-114
WP_052747891.1|1285084_1285582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948203.1|1285606_1286077_-	GNAT family N-acetyltransferase	NA	B5SP24	Lactococcus_phage	39.4	1.0e-13
WP_046814055.1|1286022_1286700_-	ABC transporter ATPase	NA	B5SP23	Lactococcus_phage	55.8	1.2e-63
WP_046814054.1|1286684_1287212_-	chromosome partitioning protein ParB	NA	Q938L7	Temperate_phage	54.6	5.9e-42
WP_052747889.1|1288597_1289095_-	hypothetical protein	NA	Q6SE89	Lactobacillus_prophage	34.3	5.2e-08
WP_052747888.1|1289288_1289618_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	72.1	1.3e-18
WP_046814053.1|1289635_1290064_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	72.5	6.8e-49
WP_046814052.1|1290260_1290701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814051.1|1290780_1291533_-	hypothetical protein	NA	X2CYF1	Lactobacillus_phage	49.4	5.4e-33
WP_046814049.1|1291816_1292674_-	replication protein	NA	Q6SE93	Lactobacillus_prophage	43.1	1.6e-49
WP_046814048.1|1292676_1293555_-	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	27.1	4.7e-20
WP_046814047.1|1293547_1293922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814045.1|1294147_1294384_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	47.6	7.2e-08
WP_046814044.1|1294373_1294619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814043.1|1294615_1294933_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046814042.1|1294942_1295713_-	antirepressor	NA	L0P8P6	Lactobacillus_phage	77.1	1.0e-111
WP_046814041.1|1295756_1295966_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046814599.1|1296143_1296515_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	46.3	8.9e-13
WP_046814040.1|1296522_1296963_+	hypothetical protein	NA	Q6SEA2	Lactobacillus_prophage	39.4	1.7e-18
WP_046814039.1|1297102_1298209_+|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	42.3	5.1e-80
WP_014563771.1|1299529_1300105_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003626683.1|1301209_1302496_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_046814038.1|1302559_1303150_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_025283496.1|1303301_1303790_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_046814037.1|1304883_1305741_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1314112:1314127	attR	AAATTTTTATAGTAAA	NA	NA	NA	NA
>prophage 7
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1552862	1619159	2084408	transposase,tRNA,protease,bacteriocin	Streptococcus_phage(25.0%)	52	NA	NA
WP_025005493.1|1552862_1553423_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003625987.1|1553473_1554673_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003625978.1|1558052_1559081_+	lactonase family protein	NA	NA	NA	NA	NA
WP_003625976.1|1559187_1559880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060705.1|1561810_1562707_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	2.3e-06
WP_046813962.1|1562690_1563503_-	NAD kinase	NA	NA	NA	NA	NA
WP_003627775.1|1563499_1564132_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003633400.1|1564255_1564870_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003627777.1|1564948_1565566_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_153245797.1|1565574_1566438_-	competence protein	NA	NA	NA	NA	NA
WP_003633395.1|1566500_1567241_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_153245798.1|1567341_1567782_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_003627783.1|1570083_1570278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627785.1|1572050_1574240_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.6	2.3e-124
WP_003627786.1|1574392_1574674_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_003633365.1|1574741_1576313_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.0	7.1e-35
WP_153245799.1|1576316_1577222_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003627789.1|1577293_1577755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627790.1|1577756_1578239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245800.1|1578252_1579122_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_046813959.1|1579187_1580570_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	6.6e-69
WP_025283390.1|1582647_1582872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813958.1|1582953_1583238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245801.1|1583280_1584483_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_153245802.1|1584425_1585652_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_153245803.1|1585655_1586849_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_046813956.1|1587045_1588374_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	40.8	3.5e-59
WP_153245804.1|1588580_1589510_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.8	2.5e-72
WP_012211577.1|1589529_1590453_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_023192259.1|1590461_1591289_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003626773.1|1591432_1591879_+	flavodoxin	NA	NA	NA	NA	NA
WP_025283388.1|1591871_1592411_+	GtrA family protein	NA	NA	NA	NA	NA
WP_153245805.1|1592438_1593605_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	4.3e-29
WP_023192258.1|1593685_1593874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245806.1|1594045_1595389_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_153245807.1|1596603_1597335_+	lysozyme	NA	NA	NA	NA	NA
WP_046813952.1|1597407_1598718_+	amino acid permease	NA	NA	NA	NA	NA
WP_153245808.1|1598739_1599363_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	4.1e-10
WP_046813951.1|1599414_1600776_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_080948196.1|1603478_1604708_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	40.8	2.2e-76
WP_046813949.1|1604974_1605823_-	patatin family protein	NA	NA	NA	NA	NA
WP_153245809.1|1605894_1608351_+	phosphoketolase	NA	NA	NA	NA	NA
WP_046813948.1|1610195_1610960_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025283381.1|1610965_1611331_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_025283380.1|1611417_1611741_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003626806.1|1611740_1613144_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_046813947.1|1613136_1613598_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003626808.1|1613584_1614823_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	1.0e-97
WP_003626809.1|1614797_1616075_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003626810.1|1616086_1616881_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_080948195.1|1616966_1617794_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_079227881.1|1617893_1619159_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
>prophage 8
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1635491	1710127	2084408	transposase,tRNA,integrase	Bacillus_virus(15.79%)	48	1706643:1706702	1714640:1714714
WP_153245812.1|1635491_1636721_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.9	3.8e-124
WP_153245844.1|1638544_1639336_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003626847.1|1641191_1641770_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_046813938.1|1641932_1643702_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.3e-55
WP_153245813.1|1645393_1645873_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_046813936.1|1646015_1646834_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046813935.1|1647556_1648228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245814.1|1648508_1650176_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.8	8.6e-55
WP_153245815.1|1650248_1651337_+	M42 family peptidase	NA	NA	NA	NA	NA
WP_046813933.1|1651442_1652648_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_046813932.1|1652793_1654530_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_046813931.1|1654483_1655953_-	MFS transporter	NA	NA	NA	NA	NA
WP_020829065.1|1656243_1656774_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_046813930.1|1656787_1658116_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.9	1.5e-62
WP_046813929.1|1661909_1663226_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.2	1.0e-55
WP_003627960.1|1663255_1663864_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_046813928.1|1663966_1664467_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046813927.1|1665808_1666255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626883.1|1666613_1666817_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.9	1.6e-19
WP_003626886.1|1668865_1669657_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_046813926.1|1669677_1670856_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_046813925.1|1670874_1671837_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_153245816.1|1673278_1674682_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
WP_046813923.1|1674993_1676370_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003626893.1|1676406_1676748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813922.1|1676929_1677634_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003626897.1|1677677_1678370_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003633052.1|1678436_1679357_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
WP_153245817.1|1679385_1680873_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003626902.1|1680817_1682257_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003633051.1|1682256_1682565_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_020829042.1|1682578_1683727_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_046813921.1|1683739_1685746_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	7.1e-104
WP_012211515.1|1685786_1688033_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	6.9e-132
WP_003633047.1|1688118_1688766_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_003626912.1|1689003_1689474_-	SprT family protein	NA	NA	NA	NA	NA
WP_046813920.1|1689461_1690160_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
WP_003633045.1|1690162_1691593_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046813919.1|1691597_1692752_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_012211508.1|1697184_1698015_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.4	5.7e-68
WP_046813918.1|1698011_1699490_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.5	4.5e-116
WP_046813917.1|1699643_1700672_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	6.9e-47
WP_046813916.1|1700779_1701880_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_020829039.1|1701887_1702616_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003633007.1|1704161_1704548_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
WP_003633005.1|1704611_1705313_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046813915.1|1705401_1706517_-	hypothetical protein	NA	NA	NA	NA	NA
1706643:1706702	attL	CTATTGGGTTAGCTGGATTCGAACCAGCGCATGATGGTACCAAAAACCATTGCCTTACCA	NA	NA	NA	NA
WP_046813914.1|1708957_1710127_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.3	2.1e-55
WP_046813914.1|1708957_1710127_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.3	2.1e-55
1714640:1714714	attR	CTATTGGGTTAGCTGGATTCGAACCAGCGCATGATGGTACCAAAAACCATTGCCTTACCACTTGGCTATAACCCA	NA	NA	NA	NA
>prophage 9
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1716226	1786364	2084408	transposase,tRNA,holin	Lactococcus_phage(14.29%)	56	NA	NA
WP_079227881.1|1716226_1717492_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_003626944.1|1717631_1718327_-	glycerophosphoryl diester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	1.4e-14
WP_080948191.1|1718377_1719595_-	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	1.4e-14
WP_023190837.1|1719595_1720174_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	2.5e-22
WP_003626948.1|1720243_1721302_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_046813906.1|1721439_1722141_-	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	51.4	3.8e-12
WP_003632978.1|1722523_1722640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813905.1|1723839_1724232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564083.1|1724333_1724543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813904.1|1724641_1725040_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_046813903.1|1725345_1726587_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.7	2.2e-119
WP_046813902.1|1726852_1728007_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_046813901.1|1728618_1729797_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.5	3.2e-120
WP_046813899.1|1733311_1734061_+	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_025283334.1|1734078_1734450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245819.1|1734718_1735702_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.0	2.6e-91
WP_046814585.1|1737541_1737961_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003632732.1|1738106_1738334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813898.1|1739138_1740323_-	acetate kinase	NA	NA	NA	NA	NA
WP_046814584.1|1740654_1741134_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_046813897.1|1741180_1741786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813896.1|1741739_1742207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061029.1|1743003_1743117_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046813895.1|1743300_1743594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813894.1|1743667_1745479_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.4	1.6e-91
WP_046813893.1|1745675_1748300_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_046813892.1|1748613_1749987_+	amino acid permease	NA	NA	NA	NA	NA
WP_025283323.1|1751568_1751937_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_025283322.1|1751940_1752861_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_046813891.1|1752889_1753702_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_046813890.1|1753738_1754749_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_080948256.1|1754811_1755147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813888.1|1755475_1756327_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014918044.1|1759604_1759790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629932.1|1761923_1763231_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	1.1e-92
WP_025283867.1|1763454_1764006_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025283868.1|1764005_1764614_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.1	2.1e-35
WP_012212195.1|1764744_1765542_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046814446.1|1765697_1766399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814447.1|1766482_1767865_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046814448.1|1767911_1768946_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_046814449.1|1769102_1772471_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_046814450.1|1772475_1773048_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814451.1|1773183_1774134_-	serine hydrolase	NA	NA	NA	NA	NA
WP_012212201.1|1774146_1775064_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_046814452.1|1775202_1776504_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_025283878.1|1776555_1777851_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_046814453.1|1777834_1778659_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003627844.1|1778662_1779529_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_046814454.1|1779528_1780614_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_003629948.1|1780867_1782295_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003627841.1|1782334_1783189_-	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_025283881.1|1783279_1784233_-	DNA polymerase III subunit epsilon	NA	U5PXE0	Bacillus_virus	40.2	1.1e-11
WP_003627839.1|1784241_1785063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245820.1|1785077_1785236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948266.1|1785329_1786364_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	58.6	4.3e-105
>prophage 10
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1801082	1864924	2084408	transposase,protease,bacteriocin	Bacillus_phage(15.38%)	51	NA	NA
WP_046814458.1|1801082_1801769_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003627817.1|1801829_1802480_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_046814459.1|1802696_1804496_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012212224.1|1804508_1805258_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
WP_046814460.1|1805404_1806676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814461.1|1806764_1807436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814462.1|1808813_1809818_-	asparaginase	NA	NA	NA	NA	NA
WP_153245821.1|1810157_1810523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245845.1|1810588_1810864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814463.1|1811286_1812081_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012212228.1|1812303_1812810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814464.1|1813033_1813909_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	5.5e-77
WP_046814465.1|1814073_1816179_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003630048.1|1816403_1817855_+	APC family permease	NA	NA	NA	NA	NA
WP_052747912.1|1820971_1821766_-	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_080948232.1|1823299_1824529_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.3e-63
WP_080948233.1|1824793_1826641_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_046814468.1|1826847_1828311_-	flippase	NA	NA	NA	NA	NA
WP_046814471.1|1831718_1832657_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	44.6	2.1e-10
WP_046814472.1|1832945_1833803_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814473.1|1833924_1835031_-	hypothetical protein	NA	Q6EVM4	Oenoccocus_phage	43.7	1.4e-64
WP_046814474.1|1835976_1836699_-	glycosyl transferase	NA	A0A1V0SL98	Klosneuvirus	25.7	2.9e-07
WP_046814475.1|1836695_1837193_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_046814476.1|1837205_1837655_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_153245822.1|1837669_1838326_-	sugar transferase	NA	NA	NA	NA	NA
WP_046814478.1|1838442_1839213_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046814479.1|1839212_1839983_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_046814480.1|1839993_1840878_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046814481.1|1840890_1841952_-	transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	30.6	6.5e-16
WP_046814482.1|1842425_1843691_+	GTPase HflX	NA	NA	NA	NA	NA
WP_046814483.1|1844616_1845420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630115.1|1845557_1846490_-	hydrolase	NA	M9MUG9	Rhodococcus_phage	38.5	9.1e-14
WP_046814484.1|1846644_1847370_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	47.2	5.6e-19
WP_046814661.1|1847542_1847926_-	ATPase	NA	NA	NA	NA	NA
WP_023192037.1|1847967_1848240_-	ATPase	NA	NA	NA	NA	NA
WP_025283921.1|1848332_1848884_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	35.9	3.6e-18
WP_046814485.1|1849073_1849619_-	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	32.2	2.5e-11
WP_003630136.1|1849713_1850013_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_023192036.1|1850105_1851611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630140.1|1851625_1852267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283925.1|1853063_1853408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283926.1|1853671_1854208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814486.1|1854383_1855568_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.6	3.9e-126
WP_020828971.1|1855914_1856400_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_046814487.1|1856402_1857173_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_046814488.1|1857183_1858725_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
WP_014919445.1|1858733_1859111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038525510.1|1859275_1859800_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025283934.1|1860554_1861796_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814489.1|1861957_1863754_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_046814490.1|1864675_1864924_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 11
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1922019	1984851	2084408	transposase,holin,bacteriocin	Lactococcus_phage(18.18%)	49	NA	NA
WP_012212302.1|1922019_1923729_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	3.9e-87
WP_046814512.1|1923725_1925894_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.6	3.8e-172
WP_046814668.1|1925886_1926309_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_023190550.1|1926292_1927300_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_003586333.1|1928225_1928783_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_046814513.1|1928748_1929933_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_046814514.1|1929954_1930866_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.8	1.7e-60
WP_046814516.1|1932390_1932948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052747914.1|1933125_1933998_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814518.1|1934109_1935384_-	MFS transporter	NA	NA	NA	NA	NA
WP_080948242.1|1935514_1936330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080948267.1|1937098_1937401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625268.1|1937885_1938359_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_046814520.1|1938512_1940798_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_080948243.1|1940775_1941681_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_046814523.1|1942917_1943994_+	guanine permease	NA	NA	NA	NA	NA
WP_012212314.1|1943996_1944554_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_153245823.1|1946356_1946746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630367.1|1946691_1947234_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_025283970.1|1947307_1948297_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_046814524.1|1948344_1949103_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_012212318.1|1949162_1949933_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_003630373.1|1949925_1950768_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_046814525.1|1950748_1952128_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_046814526.1|1952141_1952558_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_012212320.1|1952562_1953033_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_046814527.1|1953036_1954266_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_025283971.1|1954287_1955019_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.6e-13
WP_003625242.1|1955018_1955936_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003625239.1|1955945_1956188_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003625237.1|1956246_1957230_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_025283973.1|1957226_1957694_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625233.1|1957723_1958170_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002831196.1|1959872_1960121_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_080948244.1|1960660_1961062_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.1	6.3e-20
WP_046814528.1|1962716_1963604_+	EamA family transporter	NA	NA	NA	NA	NA
WP_046814530.1|1964056_1965295_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.0	5.8e-40
WP_046814531.1|1966954_1968304_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	1.9e-124
WP_107504371.1|1968713_1968803_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046814532.1|1970500_1971340_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_046814533.1|1971363_1972527_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	4.4e-05
WP_046814534.1|1974153_1975044_-	ribokinase	NA	NA	NA	NA	NA
WP_046814535.1|1975044_1976403_-	allantoin permease	NA	NA	NA	NA	NA
WP_046814536.1|1976408_1977419_-	ADP-ribosylglycohydrolase family protein	NA	A0A2K9L0L0	Tupanvirus	23.4	2.4e-07
WP_046814537.1|1978641_1979052_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023191696.1|1979154_1979253_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_101812836.1|1979632_1979776_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_046814538.1|1979893_1981135_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_080948246.1|1983660_1984851_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP045642	Lactobacillus helveticus strain LZ-R-5 chromosome, complete genome	2084408	1989230	2051397	2084408	transposase,holin,protease	Lactobacillus_virus(11.76%)	53	NA	NA
WP_080948268.1|1989230_1990496_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	6.7e-52
WP_046814543.1|1990710_1991193_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	41.7	2.7e-17
WP_020828933.1|1992242_1992887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630572.1|1992904_1993405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245824.1|1993790_1994720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814545.1|1995007_1995595_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	34.1	1.2e-16
WP_080948248.1|1995497_1996301_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.5	7.1e-07
WP_003625080.1|1996342_1996822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625077.1|1996919_1997282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025284006.1|1997350_1998649_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.7e-18
WP_046814547.1|1998652_1999942_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.5	1.8e-68
WP_046814548.1|2000152_2001145_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.0	6.3e-130
WP_046814549.1|2001582_2002638_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_046814550.1|2003085_2004099_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.7	9.5e-65
WP_153245825.1|2006133_2007513_+	amino acid permease	NA	NA	NA	NA	NA
WP_003630598.1|2007509_2008871_-	amino acid permease	NA	NA	NA	NA	NA
WP_025284011.1|2008961_2009726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625047.1|2009819_2010461_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003630601.1|2010568_2012692_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	1.1e-115
WP_003625045.1|2012976_2013900_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046814552.1|2013868_2015194_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_046814673.1|2015282_2015984_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-32
WP_003625040.1|2018539_2018776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080948250.1|2018814_2020431_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035513724.1|2023099_2023507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625029.1|2023511_2023901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814554.1|2023897_2024623_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023062095.1|2024607_2024871_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003625023.1|2025082_2026027_-	serine hydrolase	NA	NA	NA	NA	NA
WP_046814555.1|2026026_2027313_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003625019.1|2027305_2027545_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_023190737.1|2027603_2028842_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	2.0e-24
WP_046814556.1|2028841_2030356_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.4	4.4e-34
WP_003630630.1|2030371_2030524_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003630632.1|2030677_2030974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625010.1|2030993_2032130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245826.1|2032956_2034168_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	54.4	2.1e-111
WP_046814558.1|2034584_2036441_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.6	4.4e-68
WP_046814559.1|2036593_2037763_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003625002.1|2037891_2038200_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004561119.1|2038186_2038456_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_046814560.1|2038493_2040062_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	2.5e-11
WP_003624995.1|2040066_2040696_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_046814561.1|2040787_2041645_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023190505.1|2041641_2041923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245827.1|2042076_2042172_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_035513461.1|2042599_2042809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624988.1|2043015_2043672_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046814562.1|2043760_2044864_+	membrane protein	NA	NA	NA	NA	NA
WP_023190510.1|2047238_2047847_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_004561127.1|2047953_2048781_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.8	9.6e-23
WP_004561128.1|2048898_2049618_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_046814486.1|2050212_2051397_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.6	3.9e-126
