The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045649	Nocardioides sp. dk884 chromosome, complete genome	4278786	83158	128191	4278786	tRNA,integrase,transposase	Gordonia_phage(25.0%)	44	111577:111621	131700:131744
WP_153321539.1|83158_83902_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_153321540.1|84825_85224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321541.1|85344_85557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321542.1|85749_86121_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_153325547.1|86293_86908_+	DUF4396 domain-containing protein	NA	NA	NA	NA	NA
WP_153321543.1|86900_87767_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_153321544.1|87946_89140_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153321545.1|89164_89944_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_153321546.1|89955_90888_+	topoisomerase II	NA	NA	NA	NA	NA
WP_153321547.1|91050_92307_-	arginine deiminase	NA	NA	NA	NA	NA
WP_153321548.1|92356_93595_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_153321549.1|93591_94275_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A096XTB6	Enterococcus_phage	44.0	2.6e-18
WP_153321550.1|94308_95148_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_153321551.1|95171_95582_+	DUF4446 family protein	NA	NA	NA	NA	NA
WP_153321552.1|95744_96527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153325548.1|96624_98301_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.5	1.8e-07
WP_153321553.1|98299_99595_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	33.3	6.4e-58
WP_153325549.1|99648_100455_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_153321554.1|100451_100937_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153321555.1|100933_101785_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_153321556.1|101802_102435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321557.1|102458_103103_-	DUF2587 domain-containing protein	NA	NA	NA	NA	NA
WP_153321558.1|103351_104329_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_153321559.1|104358_104685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153325550.1|104732_105302_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_153325551.1|105399_106179_+	hydrolase	NA	NA	NA	NA	NA
WP_153321560.1|106190_107315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321561.1|107354_107582_+	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_153321562.1|107808_108282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321563.1|108662_108809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321564.1|109038_110286_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.5	2.5e-30
WP_153321565.1|110391_111411_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
111577:111621	attL	CTACGGATCAGAAGGTTTGGGGTTCGAATCCCTACAGGCGCACAG	NA	NA	NA	NA
WP_153321566.1|111635_112070_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153321567.1|112062_113307_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K956	Gordonia_phage	30.1	6.4e-31
WP_153321568.1|115061_116138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153321569.1|116555_117398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321570.1|117467_118247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321571.1|118411_118879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153321572.1|121266_121665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153321573.1|121904_122471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153325552.1|124465_125730_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.6	2.0e-24
WP_153321574.1|125763_126075_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153321575.1|126077_126926_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	41.5	2.5e-42
WP_153325553.1|126859_128191_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	75.8	1.4e-193
131700:131744	attR	CTACGGATCAGAAGGTTTGGGGTTCGAATCCCTACAGGCGCACAG	NA	NA	NA	NA
