The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	653776	661979	3980182		uncultured_Caudovirales_phage(71.43%)	10	NA	NA
WP_000213577.1|653776_654211_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.0	5.3e-41
WP_000373080.1|654266_654590_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.0	1.2e-21
WP_000670223.1|654596_655070_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	5.6e-36
WP_000068658.1|655077_656118_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_001052988.1|656122_656827_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	1.3e-92
WP_001191832.1|656845_657799_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	1.2e-61
WP_000080827.1|657903_658971_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.5	4.2e-95
WP_000835370.1|659267_660086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770669.1|660493_660766_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000394712.1|660755_661979_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A222YXG1	Escherichia_phage	47.1	4.1e-22
>prophage 2
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	700831	801828	3980182	holin,tail,head,tRNA,plate,transposase,portal,capsid,terminase,integrase	uncultured_Caudovirales_phage(22.22%)	104	763641:763700	802106:802216
WP_002054518.1|700831_703213_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000126166.1|703209_703506_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
WP_002054565.1|703681_703945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017393480.1|704038_704173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054522.1|704357_705626_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002054512.1|705945_706272_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.1	3.4e-16
WP_002054555.1|706551_708072_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002054564.1|708090_708912_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_079377113.1|708848_710249_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_079377114.1|710223_711060_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002054582.1|711081_711651_+	YggT family protein	NA	NA	NA	NA	NA
WP_017393479.1|711710_714482_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.0	4.3e-67
WP_153518242.1|714791_716000_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_050456384.1|715989_718770_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_004883114.1|718759_719677_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_153518244.1|719686_720508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016805398.1|720604_722095_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_000051124.1|722150_722582_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004710519.1|722669_723107_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002054542.1|723265_723643_-	DUF4951 domain-containing protein	NA	NA	NA	NA	NA
WP_004710517.1|723657_724482_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000103065.1|724508_725030_-	anti-anti-sigma factor GigB	NA	NA	NA	NA	NA
WP_153518246.1|725132_726101_-	RsbU family protein phosphatase GigA	NA	NA	NA	NA	NA
WP_079377188.1|726216_726966_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_171057473.1|733281_734757_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001167461.1|734926_735265_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002050455.1|735403_735655_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_004710509.1|735661_736918_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017393195.1|736917_737601_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017393196.1|737706_738996_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_153518248.1|739065_740151_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_031944633.1|740154_741510_-	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	37.8	1.0e-26
WP_086610772.1|741806_742739_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080754118.1|742915_743758_+	protein FilA	NA	NA	NA	NA	NA
WP_081106503.1|743862_744891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017393200.1|745162_745996_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_080754117.1|746040_746241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393204.1|747272_747821_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006581515.1|747935_748562_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_079377068.1|748584_749112_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017393205.1|749244_749910_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_153518250.1|749921_750713_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017393207.1|750849_752301_+	peptidase C13	NA	NA	NA	NA	NA
WP_017393208.1|752269_753115_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000843452.1|753118_753391_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	1.1e-07
WP_004710471.1|753575_754262_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017393209.1|754617_755439_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017393210.1|755540_755936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393211.1|755976_757911_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_079378147.1|757924_758653_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_079378148.1|758885_759677_+	cation transporter	NA	NA	NA	NA	NA
WP_002115842.1|759825_760146_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017393214.1|760157_760637_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.2	1.0e-24
WP_017393215.1|760773_761994_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_017393216.1|762140_763205_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
763641:763700	attL	GGGTTCGAATCCCGTCATTCACCCCAATTTCGGAGCATAGCACAGCCTGGTAGTGCACCT	NA	NA	NA	NA
WP_153518252.1|764357_764867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856120.1|765126_766185_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	61.0	1.7e-117
WP_004842392.1|766184_767963_-	hypothetical protein	NA	Q9ZXM5	Pseudomonas_virus	65.7	1.4e-228
WP_153518254.1|768141_768972_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.8	1.4e-58
WP_153518256.1|769028_770039_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	59.1	5.9e-107
WP_153518258.1|770045_770909_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	42.4	1.4e-40
WP_153518260.1|771010_771460_+|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	32.7	1.5e-14
WP_153518262.1|771456_771684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004842381.1|771687_771900_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	57.6	2.7e-14
WP_153518264.1|771902_772259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004842378.1|772255_772528_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	40.7	5.7e-09
WP_004842376.1|772527_773388_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	42.4	8.4e-46
WP_041114835.1|773384_773885_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	61.4	8.3e-38
WP_153518266.1|773885_774338_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	45.6	2.5e-25
WP_153518268.1|774410_774944_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	29.1	5.1e-09
WP_032031299.1|774940_775285_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	43.9	4.5e-19
WP_032031303.1|775281_776187_+|plate	baseplate J/gp47 family protein	plate	A0A0F7LCQ9	Escherichia_phage	54.5	4.0e-83
WP_004842364.1|776183_776714_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	34.5	3.4e-29
WP_094081255.1|779589_779976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094081256.1|780091_781264_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	69.2	2.6e-159
WP_004842357.1|781274_781793_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	56.7	1.1e-48
WP_004842355.1|781855_782191_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	40.0	4.4e-11
WP_025469641.1|782199_782319_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	52.8	3.7e-05
WP_153518270.1|782315_785258_+|tail	phage tail tape measure protein	tail	A4PE52	Ralstonia_virus	45.0	1.5e-131
WP_004842352.1|785263_785686_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	52.1	4.7e-34
WP_114201041.1|785682_787188_+	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	46.6	1.0e-91
WP_057063627.1|787171_787975_-	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	60.8	5.3e-87
WP_079270930.1|787940_788138_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_052210376.1|788251_788545_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_038342613.1|788541_788784_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	52.9	3.4e-13
WP_038342615.1|788780_789230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038342616.1|789232_789457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060429.1|789463_789661_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	68.2	1.5e-11
WP_038342617.1|789745_790507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171207165.1|790655_791630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024436888.1|792212_793019_+	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	60.8	3.7e-27
WP_153518272.1|793030_793591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004842324.1|793633_793978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004842322.1|794060_794270_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_004842321.1|794266_794500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004842319.1|794504_794687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518274.1|794702_797432_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	38.7	1.3e-177
WP_032007302.1|797448_798042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813214.1|798108_798651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024436893.1|798647_799166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024436894.1|799168_799438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057063614.1|799430_799763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057063612.1|799835_800576_+	3'-5' exonuclease	NA	A0A0S0NDC6	Pseudomonas_phage	33.2	1.1e-25
WP_114233434.1|800667_801828_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	41.9	6.1e-76
802106:802216	attR	GGGTTCGAATCCCGTCATTCACCCCAATTTCGGAGCATAGCACAGCCTGGTAGTGCACCTGGTTTGGGACCAGGGGGTCGTAGGTTCGAATCCTACTGCTCCGACCATATT	NA	NA	NA	NA
>prophage 3
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	988524	1056724	3980182	holin,transposase,integrase	Vibrio_phage(25.0%)	58	988473:988532	1056717:1057755
988473:988532	attL	GGCTTTGTTGCATAAAGCCTTTGACGGCAGAGTTTTCCTAAGTTGCTAAAATTTAGGTTA	NA	NA	NA	NA
WP_086610772.1|988524_989457_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_004710227.1|989630_990698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393294.1|990697_991021_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001170994.1|991076_991475_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002052029.1|991586_992024_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_002052019.1|992093_993212_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_002052078.1|993239_994307_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_017393295.1|994403_995096_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017393296.1|995203_996046_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_153518300.1|996166_999763_-	AAA family ATPase	NA	Q5ULP4	Lactobacillus_virus	27.4	5.8e-08
WP_031944638.1|999772_1001041_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_080593966.1|1001166_1001679_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001091952.1|1001753_1002131_-	VOC family protein	NA	NA	NA	NA	NA
WP_017393300.1|1002509_1002962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393301.1|1003045_1003951_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017393302.1|1003942_1005058_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153518738.1|1005083_1006097_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014205992.1|1006203_1006737_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_000128703.1|1007004_1008156_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000857095.1|1008162_1009686_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_086610919.1|1010011_1011976_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_153518302.1|1012683_1014030_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	39.0	5.6e-73
WP_002033903.1|1014037_1014970_+|transposase	IS5-like element ISAba40 family transposase	transposase	NA	NA	NA	NA
WP_034120268.1|1015873_1016764_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034120306.1|1016968_1017676_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_080754100.1|1017860_1019738_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_034120264.1|1019793_1021128_-	amino acid permease	NA	NA	NA	NA	NA
WP_000696107.1|1021133_1022012_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_034120262.1|1022226_1022697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034120260.1|1022788_1024429_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004888295.1|1024939_1026598_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_034120258.1|1026693_1028166_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_079377073.1|1028158_1028794_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_034120256.1|1029046_1030669_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	2.5e-19
WP_002054451.1|1030786_1032853_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
WP_002054351.1|1032864_1033479_+	MarC family protein	NA	NA	NA	NA	NA
WP_002054353.1|1033740_1034256_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002054416.1|1034387_1034585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017393329.1|1035087_1036086_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_017393330.1|1036128_1037391_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_017393331.1|1037581_1038112_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_004703189.1|1038199_1038541_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017393332.1|1038776_1040771_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_004888283.1|1040784_1042041_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_079377456.1|1042142_1042547_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_017393333.1|1042655_1043444_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017393334.1|1043691_1044282_+	nicotinamide mononucleotide transporter	NA	G3BLP7	Salmonella_phage	28.0	2.8e-08
WP_017393335.1|1044328_1044928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393336.1|1044949_1045417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393337.1|1045439_1045739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735778.1|1046399_1047191_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_017393340.1|1047204_1048671_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_153518305.1|1048709_1050350_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.8	4.1e-25
WP_153518740.1|1050526_1051702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393342.1|1051763_1053062_-	MFS transporter	NA	NA	NA	NA	NA
WP_004710118.1|1053296_1053779_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.2	2.9e-19
WP_153518307.1|1053957_1055280_+	glutaminase	NA	NA	NA	NA	NA
WP_086610772.1|1055791_1056724_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1056717:1057755	attR	TAACCTAAATTTTAGCAACTTAGGAAAACTCTGCCGTCAAAGGCTTTATGCAACAAAGCCATTAAGTACTATTTTTTTAATTGGTTGTGGGGAGGAGTCCAAAAGAGAAGAAAATGAGTATGAAAAAAATATGCTTACAATCGAAGCTGAAAATTTTAATGATAAAGTTAACTTGAATGTAAAAGAAGAGGAATATAGCTTAATAGCCCAAGGAAATAGCTCAGATGTAACTCTCTATTTTAACAAGCCCGATAAAACGGACCTTCCTATTTATGGTGAATTACAGCTTTTGGCTGAAAGTAATAAGGCACGTTTTGCCTCACTTGCTTGGATAAATAAATATAATGATATGAGTGTTTTATTTTGTATAAATTATGAAGACTGTTCAGATAATACGGAATATAGTTTTGATAATGATAGTAGACAATTAAATATAAGATTTAAAAATAATTTTAATAAATTATGGAAAAATTATTTAGTTGATTGGATAGAAAAAAGAGATTTAACGGCAAAAATTACAGGTAACTTAGAATTAAAAATACCCTCTAACTGGGTGGGTTTTAATAAAGATAGATTTCCAAGAAAAAGTGGGATAGGTATCCTCGAATTAGATAATCAAGTATATAAATTATCTGATATGAATTCAGATATTATTATTTATAAAGATGGAAATAATAAAAATATTGGTAGTGTAGATGAACTTGTTTTTAAAAAAGATGATGATATTGTGAATATTGAAATATTTAAAGAAAGTAATAATAATCAATATTCTAAAGATATACAACTTAAAGTTCGAAATTATAATTTAACAAATTATGAACCAGGTTTTTCCTTTTATGGCTTAGTTCCTGCTTCGTCGATCTCGTGGGGAGATAATGAAAAGATACTATCTATTAATATACAGAACTTGAATTTATTTGATAAAGAATGAAATAAATTTAGAGTGTTAGATTTGGAATATAATATTCCTAGGAATACTTCTAATATTTTAATTAATAAAGAAATATATCCTATATTGCGCCAAAATTATGGTTTCGCT	NA	NA	NA	NA
>prophage 4
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	1253954	1287552	3980182	tail,capsid,terminase	Acinetobacter_phage(75.0%)	42	NA	NA
WP_004834507.1|1253954_1254281_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	32.9	9.3e-06
WP_000861102.1|1254252_1254507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004841834.1|1254984_1255329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152659.1|1255537_1255774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123090744.1|1256437_1256893_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	97.4	1.1e-81
WP_153518335.1|1256953_1257388_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	95.8	1.8e-76
WP_153518337.1|1257356_1257998_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	95.8	6.3e-123
WP_000212566.1|1258056_1258527_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_153518339.1|1258516_1259944_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	96.0	1.3e-269
WP_049065129.1|1259940_1261392_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	1.5e-284
WP_086610764.1|1261393_1262497_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	96.2	9.9e-201
WP_001139861.1|1262647_1262839_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_086610765.1|1262952_1263720_+	hypothetical protein	NA	A0A0D4DCP5	Acinetobacter_phage	96.5	1.9e-113
WP_032041496.1|1263747_1264701_+	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	6.2e-167
WP_086610766.1|1264765_1265431_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	71.0	3.8e-78
WP_020752393.1|1265435_1265825_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	99.2	2.5e-66
WP_153518340.1|1265781_1266195_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	75.9	7.3e-56
WP_001983390.1|1266581_1266950_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	81.1	5.1e-53
WP_153518342.1|1266951_1267350_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	78.8	1.8e-59
WP_002053072.1|1267351_1267564_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	76.8	7.8e-22
WP_002053038.1|1267670_1268600_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	41.3	3.7e-55
WP_001185621.1|1268647_1269181_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	61.2	2.6e-45
WP_000838147.1|1269512_1269695_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	98.3	1.8e-27
WP_002053018.1|1269759_1270164_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	94.0	2.0e-66
WP_074031683.1|1270262_1270439_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	57.7	8.2e-09
WP_000523929.1|1270447_1270771_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000719143.1|1270804_1271338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000758222.1|1271349_1271751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518344.1|1271809_1275976_+	tape measure protein	NA	A0A220VZA0	Acinetobacter_phage	66.6	0.0e+00
WP_000536302.1|1276063_1276336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086610945.1|1276392_1276722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518346.1|1276731_1277097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031975096.1|1277083_1277425_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	42.2	8.2e-13
WP_001204598.1|1277500_1277824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518348.1|1278150_1279311_+	hypothetical protein	NA	U5PW98	Acinetobacter_phage	57.9	1.5e-37
WP_031955723.1|1279297_1280104_+|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	64.6	3.5e-94
WP_032027178.1|1280110_1280866_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.4	4.4e-83
WP_017394010.1|1280849_1281503_+|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	49.5	1.0e-43
WP_153518350.1|1281555_1285974_+|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	63.5	0.0e+00
WP_017394008.1|1285970_1286510_+	DUF4376 domain-containing protein	NA	A0A172Q083	Acinetobacter_phage	37.1	8.4e-28
WP_002123210.1|1286575_1286965_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
WP_153518352.1|1287006_1287552_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	96.1	1.0e-97
>prophage 5
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	1354303	1399537	3980182	tail,head,transposase,capsid,terminase	Bordetella_phage(28.57%)	56	NA	NA
WP_153518360.1|1354303_1355458_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017393693.1|1355522_1355852_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	59.0	1.2e-29
WP_033917576.1|1356242_1357205_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017393694.1|1357381_1357975_+	LysE family transporter	NA	NA	NA	NA	NA
WP_004709788.1|1358022_1358241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004709785.1|1358484_1358679_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_017393696.1|1358668_1359934_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	24.5	2.0e-16
WP_025466156.1|1360447_1360678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017393698.1|1360829_1361501_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	4.1e-64
WP_002048752.1|1362067_1362457_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	72.8	4.8e-49
WP_017393699.1|1362493_1363039_+	glycosyl hydrolase 108	NA	A0A0B5L5G0	Acinetobacter_phage	70.9	2.3e-73
WP_016804779.1|1363109_1363727_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002048761.1|1364241_1364457_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	4.5e-17
WP_002048783.1|1364660_1364894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002048776.1|1365165_1365990_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002048755.1|1366055_1366175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017393700.1|1366662_1367121_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	9.3e-28
WP_153518362.1|1367412_1367769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086610772.1|1367796_1368729_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017393701.1|1368890_1369997_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	65.5	3.6e-142
WP_004709761.1|1370045_1370369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025466157.1|1370712_1371477_+	membrane protein	NA	NA	NA	NA	NA
WP_079378094.1|1371792_1371978_+	peptidoglycan-binding protein	NA	A0A0N7IRF5	Acinetobacter_phage	83.3	3.5e-18
WP_017393703.1|1372502_1373096_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_017393704.1|1373478_1374108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518364.1|1374881_1375196_+	hypothetical protein	NA	S6B1N1	Thermus_phage	35.4	3.9e-09
WP_153518366.1|1375221_1375518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518368.1|1375579_1376974_-	ATP-dependent helicase	NA	Q774Z8	Bordetella_phage	69.3	4.2e-196
WP_032014331.1|1376963_1377245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518370.1|1377241_1377502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023187926.1|1377498_1377762_-	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	70.9	1.0e-26
WP_153518372.1|1377764_1378343_-	DNA polymerase III subunit beta	NA	A0A2I7QLJ4	Vibrio_phage	27.3	4.8e-05
WP_153518374.1|1378347_1380411_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	66.1	1.6e-265
WP_049069583.1|1380509_1381358_-	DUF2303 family protein	NA	I3PUY7	Vibrio_phage	27.5	2.4e-21
WP_153518376.1|1381394_1381721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000702344.1|1381894_1382452_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	60.8	2.4e-62
WP_153518378.1|1382457_1383750_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	45.0	7.0e-97
WP_153518380.1|1383905_1384364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000643565.1|1384509_1385175_-	LexA family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	66.2	3.5e-52
WP_000106776.1|1385326_1385578_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	46.3	4.0e-09
WP_149933135.1|1385574_1385979_+	hypothetical protein	NA	A0A2D2W3E4	Mycobacterium_phage	43.4	9.1e-11
WP_057692720.1|1385980_1386247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518382.1|1386243_1388853_+	PriCT-2 domain-containing protein	NA	Q775B5	Bordetella_phage	55.2	1.0e-280
WP_153518384.1|1389276_1390011_+|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	50.5	2.1e-53
WP_153518742.1|1390000_1390261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518386.1|1390270_1390588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518388.1|1390584_1392207_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	60.8	8.9e-190
WP_000337838.1|1392284_1392539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518390.1|1392540_1394232_+|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	32.8	4.3e-70
WP_001281314.1|1394228_1394561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518393.1|1394526_1395189_+	hypothetical protein	NA	A0A2I7RHR0	Vibrio_phage	39.7	2.1e-12
WP_001142379.1|1395200_1396223_+	hypothetical protein	NA	Q775C7	Bordetella_phage	50.6	1.5e-89
WP_001229564.1|1396236_1396641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518395.1|1396652_1396940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518397.1|1396945_1397500_+	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	27.7	2.4e-06
WP_153518399.1|1397500_1399537_+	hypothetical protein	NA	Q775D1	Bordetella_phage	39.3	9.0e-131
>prophage 6
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	1403365	1420502	3980182	tRNA,integrase	Acinetobacter_phage(25.0%)	11	1398261:1398274	1419091:1419104
1398261:1398274	attL	ACATTGAAACAAAC	NA	NA	NA	NA
WP_153518409.1|1403365_1410184_+	GNAT family N-acetyltransferase	NA	Q775D4	Bordetella_phage	24.5	3.7e-104
WP_000999573.1|1412827_1413199_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	65.0	3.3e-39
WP_000109879.1|1413209_1413752_+	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	79.9	1.7e-84
WP_000195506.1|1413888_1414086_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	71.1	5.2e-12
WP_001171605.1|1414114_1415128_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.3	3.8e-66
WP_017393716.1|1415481_1416903_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
WP_002051059.1|1417117_1418095_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	1.9e-38
WP_004709751.1|1418098_1418638_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_002051045.1|1418675_1419224_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
1419091:1419104	attR	ACATTGAAACAAAC	NA	NA	NA	NA
WP_002051027.1|1419207_1419756_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_153518411.1|1419755_1420502_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
>prophage 7
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	2240411	2300425	3980182	protease,holin,transposase,coat	Bacteriophage(12.5%)	50	NA	NA
WP_153518520.1|2240411_2242640_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_002053611.1|2242682_2242841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518522.1|2242965_2245065_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	30.7	4.4e-40
WP_002053612.1|2245188_2245803_-|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
WP_002053623.1|2245825_2247607_-	metalloendopeptidase CpaA	NA	NA	NA	NA	NA
WP_002053609.1|2247863_2249342_-	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	26.2	5.1e-27
WP_002053659.1|2249468_2250047_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002053615.1|2250099_2251359_-	EstA family serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	22.8	1.0e-12
WP_002053622.1|2251430_2252285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002053633.1|2252359_2253751_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_002053671.1|2253986_2255555_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002010078.1|2255622_2256057_-	chlorhexidine efflux PACE transporter AceI	NA	NA	NA	NA	NA
WP_002053653.1|2256147_2257041_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153518524.1|2257171_2258161_+	transaldolase	NA	NA	NA	NA	NA
WP_153518526.1|2258234_2258885_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_002053657.1|2258921_2259395_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002053634.1|2259582_2260755_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_002053619.1|2260828_2261548_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	1.7e-12
WP_002053649.1|2261563_2264320_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	5.4e-38
WP_002053613.1|2264881_2265325_-	RDD family protein	NA	NA	NA	NA	NA
WP_000774578.1|2265933_2266161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002053669.1|2266449_2266893_+	universal stress protein	NA	NA	NA	NA	NA
WP_002053639.1|2267155_2268739_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.5e-29
WP_002048661.1|2270361_2270493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016804992.1|2270724_2271108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025467696.1|2271285_2271549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002048669.1|2271736_2272111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002048653.1|2272273_2272744_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.1	4.9e-32
WP_002048677.1|2273157_2273409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002048675.1|2273717_2274953_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_031951060.1|2275559_2276564_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.7	5.0e-42
WP_002048660.1|2276585_2277599_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_081400883.1|2277670_2279311_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_002048672.1|2279314_2280520_+	MFS transporter	NA	NA	NA	NA	NA
WP_002048674.1|2280516_2284044_+	siderophore biosynthesis protein, IucA/IucC family	NA	NA	NA	NA	NA
WP_002048659.1|2284036_2284810_+	aldolase/citrate lyase	NA	NA	NA	NA	NA
WP_002048655.1|2284963_2287198_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002048665.1|2287263_2287818_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002048759.1|2288430_2289363_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002049026.1|2289991_2290489_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002048987.1|2290517_2291075_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002049032.1|2291153_2291837_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002049037.1|2291846_2292608_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153518760.1|2292615_2293227_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_086610772.1|2293266_2294199_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_025467732.1|2294597_2295470_-	DUF4882 family protein	NA	NA	NA	NA	NA
WP_002048984.1|2295633_2296656_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033855703.1|2296646_2299106_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002048998.1|2299115_2299820_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002049041.1|2299894_2300425_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	2381147	2418442	3980182	integrase,terminase,tail,transposase	Acinetobacter_phage(43.75%)	49	2395010:2395024	2418784:2418798
WP_153518532.1|2381147_2382686_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001162227.1|2382758_2384750_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014220.1|2384769_2385282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130712.1|2385293_2385494_-	TraR/DksA C4-type zinc finger protein	NA	A0A0U4IIN4	Pseudomonas_phage	43.5	4.8e-05
WP_001108877.1|2385486_2386290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157186.1|2386292_2387198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001239775.1|2387270_2387498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183514.1|2387509_2387968_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	37.6	6.7e-10
WP_000371257.1|2388046_2388661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000176711.1|2388648_2390094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633139.1|2390074_2390413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166851.1|2390412_2390769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518534.1|2390968_2391910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032028575.1|2392063_2393785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032028576.1|2393918_2394446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042791351.1|2394445_2396734_-|tail	tail tape measure protein	tail	NA	NA	NA	NA
2395010:2395024	attL	ACCTTGTGCATCTAA	NA	NA	NA	NA
WP_000099001.1|2396808_2397072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114171624.1|2397159_2397999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001085636.1|2398012_2398699_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000592656.1|2398699_2399389_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_086610772.1|2399790_2400723_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001136753.1|2401399_2401855_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
WP_086610772.1|2402076_2403009_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000991091.1|2403358_2403892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994862.1|2403888_2404653_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	47.7	3.9e-63
WP_004886711.1|2404649_2405714_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.4e-28
WP_001055556.1|2405717_2407196_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.5	4.4e-135
WP_004708298.1|2407192_2407579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006581306.1|2407584_2408145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031984809.1|2408144_2408786_-	hypothetical protein	NA	R9VWB9	Serratia_phage	40.8	2.8e-30
WP_032028962.1|2408782_2409238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|2409234_2409420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111906150.1|2409416_2409617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|2409650_2410025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009497419.1|2410057_2410291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009497448.1|2410427_2411126_+	LexA family transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	44.7	1.1e-24
WP_031984815.1|2411137_2411425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105905.1|2411636_2411969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290758.1|2412008_2412812_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	33.3	1.1e-26
WP_000350172.1|2412896_2413157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114171717.1|2413215_2413545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518536.1|2413541_2413910_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	39.6	4.6e-09
WP_153518538.1|2414080_2414761_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000805205.1|2414773_2415802_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_079398418.1|2415942_2416236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130794.1|2416232_2416634_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	96.1	6.2e-36
WP_000877059.1|2416630_2416966_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	59.1	4.6e-32
WP_000039877.1|2416967_2417237_+	helix-turn-helix domain-containing protein	NA	A0A0N7IRE8	Acinetobacter_phage	53.5	1.8e-15
WP_000773636.1|2417233_2418442_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	48.0	2.8e-108
2418784:2418798	attR	ACCTTGTGCATCTAA	NA	NA	NA	NA
>prophage 9
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	2532897	2602793	3980182	tRNA,coat,protease,transposase	Moraxella_phage(33.33%)	51	NA	NA
WP_002049104.1|2532897_2533416_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_171062645.1|2533420_2533876_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002049140.1|2534042_2534579_-	Csu fimbrial major subunit CsuAB	NA	NA	NA	NA	NA
WP_002049333.1|2535161_2535800_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002049193.1|2536007_2536394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002049109.1|2536440_2537274_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_147520475.1|2537289_2537970_-	metallophosphoesterase	NA	A0A172Q076	Acinetobacter_phage	38.2	1.2e-36
WP_050560288.1|2537982_2538192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002049085.1|2538219_2538918_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002049356.1|2539014_2539917_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002049175.1|2539980_2541816_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_002049330.1|2542013_2543249_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_002049216.1|2543414_2544434_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_153518556.1|2544598_2545639_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	40.8	1.2e-14
WP_002049195.1|2545661_2546609_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002049242.1|2546617_2547538_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002049184.1|2547593_2549099_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002049142.1|2549168_2550092_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_001153334.1|2550338_2551259_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106451.1|2551441_2552122_+	hydrolase	NA	NA	NA	NA	NA
WP_002049246.1|2552183_2553014_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002049345.1|2554047_2555067_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_033855474.1|2555305_2556190_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002049138.1|2556219_2557086_-	PaaX domain-containing protein	NA	NA	NA	NA	NA
WP_002049064.1|2557319_2560616_-	type I secretion target GGXGXDXXX repeat protein	NA	NA	NA	NA	NA
WP_002049361.1|2560974_2562126_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004707954.1|2562839_2563166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002049354.1|2563162_2563633_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_002049108.1|2563796_2564159_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_002049169.1|2564441_2565086_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025467751.1|2565082_2565682_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_106465503.1|2565656_2566451_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_153518558.1|2566438_2567413_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000105754.1|2567711_2567945_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_081106503.1|2568273_2569302_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002049254.1|2570702_2572271_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_081400903.1|2572377_2573760_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002049219.1|2573857_2574775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002049327.1|2575019_2576141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025467750.1|2576195_2576756_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002049348.1|2577539_2577875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086610772.1|2578759_2579692_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153518560.1|2579688_2580117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518562.1|2580727_2592250_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.6	1.4e-50
WP_025467747.1|2594851_2595658_-	protein kinase	NA	K7Z807	Megavirus	33.0	1.8e-05
WP_002049303.1|2595644_2597153_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_002049146.1|2597331_2598213_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002049277.1|2599419_2600430_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.0	6.2e-125
WP_001136722.1|2600575_2600791_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002049105.1|2600817_2601264_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	42.2	1.1e-17
WP_081400907.1|2601365_2602793_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	2646968	2720963	3980182	tail,tRNA,transposase,capsid,terminase,integrase	Acinetobacter_phage(60.0%)	93	2668511:2668528	2718316:2718333
WP_081400906.1|2646968_2647697_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_002049093.1|2647801_2648581_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_002049316.1|2648636_2649506_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_081400902.1|2649736_2651203_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_025467741.1|2651259_2652630_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	62.5	4.5e-126
WP_002049324.1|2652632_2652896_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.7	1.2e-19
WP_002049209.1|2653131_2653461_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002049337.1|2653531_2654308_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.8e-23
WP_002049239.1|2654317_2655031_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000010370.1|2655027_2655717_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_151299736.1|2655808_2656573_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002049092.1|2656772_2657804_-	multidrug efflux transcriptional repressor AdeL	NA	NA	NA	NA	NA
WP_033855468.1|2658001_2659222_+	multidrug efflux RND transporter periplasmic adaptor subunit AdeF	NA	NA	NA	NA	NA
WP_002049365.1|2659228_2662408_+	multidrug efflux RND transporter permease subunit AdeG	NA	S5VTK5	Leptospira_phage	21.4	3.3e-63
WP_025467740.1|2662420_2663869_+	multidrug efflux RND transporter outer membrane subunit AdeH	NA	NA	NA	NA	NA
WP_002049224.1|2663909_2665163_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	4.7e-98
WP_002049062.1|2665410_2666640_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002049276.1|2666888_2667575_+	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.1	5.3e-35
WP_002049342.1|2667724_2668348_+	hypothetical protein	NA	NA	NA	NA	NA
2668511:2668528	attL	CCCGCCGGGCGCACCAAT	NA	NA	NA	NA
WP_153518566.1|2668600_2668798_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	95.4	1.6e-29
WP_153518568.1|2668922_2669477_-	glycoside hydrolase family protein	NA	A0A068CDE9	Acinetobacter_phage	80.4	8.8e-81
WP_001083663.1|2669466_2669685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138206.1|2669681_2670038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002049074.1|2670104_2670644_-	DUF4376 domain-containing protein	NA	A0A172Q0F8	Acinetobacter_phage	43.2	9.9e-29
WP_153518570.1|2670640_2676136_-	host specificity protein	NA	A0A0R6PIC9	Moraxella_phage	61.9	0.0e+00
WP_153518572.1|2676191_2676845_-|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	45.8	3.6e-41
WP_153518574.1|2676828_2677584_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.8	1.1e-86
WP_153518576.1|2677590_2678385_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	63.1	3.7e-88
WP_023188281.1|2679583_2679925_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	43.1	1.7e-13
WP_002051595.1|2680048_2680222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518577.1|2680331_2683781_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	37.8	3.4e-146
WP_016803027.1|2683843_2684371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016803028.1|2684405_2685047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016803029.1|2685063_2685291_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_016803030.1|2685398_2685554_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_057066844.1|2685625_2686456_+	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	68.4	7.8e-65
WP_057066846.1|2686528_2686753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518578.1|2686841_2687771_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	47.4	5.7e-24
WP_006582088.1|2687849_2688011_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_006582089.1|2688121_2688457_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_130075815.1|2688532_2688913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130075816.1|2688902_2689094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518580.1|2689664_2690189_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	57.1	4.0e-43
WP_106465386.1|2690236_2691166_-	hypothetical protein	NA	A0A1B1P9E0	Acinetobacter_phage	95.5	4.3e-165
WP_002052527.1|2691277_2691478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001056871.1|2691549_2692086_-	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	84.2	2.0e-77
WP_002052968.1|2692245_2692641_-	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	92.4	7.4e-66
WP_153518582.1|2692642_2693098_-	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	72.2	4.9e-53
WP_153518584.1|2693102_2693489_-	glutamate 5-kinase	NA	A0A1B1P9E3	Acinetobacter_phage	80.8	2.0e-55
WP_151809555.1|2693490_2693868_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	67.2	4.8e-38
WP_153518586.1|2693871_2694300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153518588.1|2694343_2695312_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	72.6	7.5e-128
WP_002052537.1|2695323_2696088_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	58.6	1.1e-60
WP_002052626.1|2696260_2697343_-|capsid	minor capsid protein	capsid	A0A1B1P9B7	Acinetobacter_phage	73.2	3.1e-146
WP_151745644.1|2697308_2698790_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	54.0	2.6e-143
WP_153518590.1|2698786_2700070_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	97.9	1.2e-245
WP_002052605.1|2700029_2700551_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	98.8	8.5e-86
WP_153518592.1|2700586_2701240_-|transposase	transposase	transposase	A0A1B1P9K3	Acinetobacter_phage	96.3	1.3e-128
WP_153518594.1|2701275_2702469_-	hypothetical protein	NA	A0A173GCS4	Salmonella_phage	36.9	5.4e-67
WP_153518596.1|2702563_2703049_-	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	58.5	1.0e-45
WP_150408860.1|2703095_2704166_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	30.7	3.5e-33
WP_153518598.1|2704253_2704538_-	DUF968 domain-containing protein	NA	A0A1B1P9J2	Acinetobacter_phage	56.5	8.3e-19
WP_171501687.1|2704524_2704668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151838009.1|2704847_2705252_-	hypothetical protein	NA	Q716B1	Shigella_phage	62.4	2.2e-33
WP_153518600.1|2705382_2705871_-	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	38.4	6.4e-19
WP_153518602.1|2706068_2706470_-	hypothetical protein	NA	A0A1B1P9J0	Acinetobacter_phage	98.5	4.6e-71
WP_002052471.1|2706466_2706670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087605871.1|2706666_2707056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025467971.1|2707057_2707333_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	58.2	3.6e-19
WP_171062658.1|2707353_2707530_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	91.4	3.2e-21
WP_002052658.1|2707526_2707814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234285.1|2707810_2708038_-	hypothetical protein	NA	A0A0P0IL13	Acinetobacter_phage	98.7	2.7e-36
WP_153518604.1|2708255_2709629_-	AAA family ATPase	NA	A0A1B1P9I0	Acinetobacter_phage	46.3	1.3e-101
WP_006582151.1|2709625_2710429_-	helix-turn-helix domain-containing protein	NA	A0A190XCE7	Acinetobacter_phage	62.0	1.4e-26
WP_171501693.1|2710425_2710587_-	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	82.7	2.7e-14
WP_153518606.1|2710628_2710904_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	78.4	1.7e-32
WP_001217698.1|2710900_2711077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139844213.1|2711204_2711987_+	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	75.4	7.7e-99
WP_042758126.1|2712001_2712217_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	1.2e-30
WP_151818883.1|2712267_2713026_+	KilA-N domain-containing protein	NA	A0A1S5V2I2	Saudi_moumouvirus	40.0	4.1e-12
WP_000508120.1|2713251_2713599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991219.1|2713618_2713885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002052952.1|2713884_2714106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002052515.1|2714115_2715054_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	81.7	2.9e-140
WP_153518607.1|2715050_2715710_+	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.0	1.1e-77
WP_000028947.1|2716218_2716428_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_046023973.1|2716424_2716637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518610.1|2716633_2716897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123991.1|2716898_2717168_+	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_153518612.1|2717164_2718151_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	98.5	3.4e-184
WP_002052950.1|2718448_2719384_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.5	3.7e-23
2718316:2718333	attR	CCCGCCGGGCGCACCAAT	NA	NA	NA	NA
WP_002052782.1|2719380_2720154_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002052678.1|2720150_2720963_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	35.2	1.4e-39
>prophage 11
NZ_CP045560	Acinetobacter nosocomialis strain AC1530 chromosome, complete genome	3980182	2769793	2784596	3980182		Acinetobacter_phage(100.0%)	10	NA	NA
WP_002052934.1|2769793_2770369_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.2e-110
WP_153518620.1|2770464_2773230_-	ERAP1-like C-terminal domain-containing protein	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
WP_002052450.1|2773243_2775976_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.5	0.0e+00
WP_009498528.1|2776332_2777382_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	98.6	3.1e-188
WP_153518622.1|2777391_2778198_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	98.1	7.4e-145
WP_002052415.1|2778207_2778903_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	98.3	1.6e-119
WP_153518624.1|2778913_2779897_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	93.0	2.4e-174
WP_002052689.1|2779903_2782279_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.0	0.0e+00
WP_002052981.1|2782280_2783786_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	93.8	1.6e-270
WP_001187844.1|2784047_2784596_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 1
NZ_CP045561	Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence	173972	0	6371	173972	transposase	Escherichia_phage(100.0%)	3	NA	NA
WP_033917515.1|2092_3490_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_061403682.1|3718_5233_+	MFS transporter	NA	NA	NA	NA	NA
WP_001067784.1|5666_6371_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 2
NZ_CP045561	Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence	173972	13662	14478	173972		Pandoravirus(100.0%)	1	NA	NA
WP_001043260.1|13662_14478_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 3
NZ_CP045561	Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence	173972	20560	25678	173972		Acinetobacter_phage(33.33%)	6	NA	NA
WP_171255599.1|20560_22378_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1X9SFE0	Acinetobacter_phage	46.6	5.7e-36
WP_061403605.1|22398_22749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403606.1|22764_23163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403607.1|23180_23861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403608.1|23913_24804_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.2	2.0e-05
WP_061403609.1|24817_25678_-	AAA family ATPase	NA	A0A1X9I765	Streptococcus_phage	27.6	3.4e-07
>prophage 4
NZ_CP045561	Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence	173972	54990	170828	173972	transposase,integrase	Staphylococcus_phage(13.04%)	106	69305:69320	98079:98094
WP_153518785.1|54990_55503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061403632.1|55517_57473_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	40.8	1.2e-129
WP_004645384.1|57770_58517_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.2	2.5e-14
WP_052690212.1|58536_58782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045796736.1|58883_59903_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061403633.1|60056_61502_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_061403634.1|61616_63335_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_151711499.1|64511_65981_+	TniQ family protein	NA	NA	NA	NA	NA
WP_061403636.1|65964_67560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005088774.1|67656_68130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005088776.1|68132_69377_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
69305:69320	attL	AATTTTTAATGAAAAA	NA	NA	NA	NA
WP_061403637.1|69363_69564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004994718.1|69608_70634_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_004201164.1|70734_71547_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|71550_71916_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|71920_72559_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|72569_73601_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|73605_73935_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|74128_74419_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|74474_76115_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|76303_77833_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_015056391.1|78043_78328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988464.1|78620_79646_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_061403638.1|79642_80545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005088780.1|80483_81086_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	40.5	8.5e-37
WP_044424310.1|81902_82127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045124703.1|82131_82512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403639.1|83057_84956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403640.1|85061_85493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403641.1|85556_86072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403642.1|86419_87103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403643.1|87117_87936_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_129264322.1|87958_88270_+	DUF1456 domain-containing protein	NA	NA	NA	NA	NA
WP_151711495.1|88292_88883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403645.1|88961_89942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403646.1|90143_91241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403647.1|91482_93735_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	32.6	1.8e-63
WP_061403648.1|93750_94137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052501251.1|94245_95289_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_044424397.1|95364_95562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044424396.1|95563_96376_+	Fic family protein	NA	NA	NA	NA	NA
WP_171255597.1|96515_97103_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044424394.1|97139_98036_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.0	5.0e-17
WP_044424393.1|98187_98400_+	hypothetical protein	NA	NA	NA	NA	NA
98079:98094	attR	AATTTTTAATGAAAAA	NA	NA	NA	NA
WP_153518787.1|98368_98647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081106503.1|98686_99715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171255598.1|99717_100998_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_061403652.1|101066_101699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129262120.1|101705_102275_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044424390.1|102260_103550_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	55.5	1.3e-135
WP_081106515.1|103743_104559_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	1.4e-26
WP_044424388.1|104570_105404_-	Abi family protein	NA	NA	NA	NA	NA
WP_061403653.1|105774_106440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403654.1|106608_108612_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	24.1	5.7e-21
WP_081106516.1|108614_109910_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_061403656.1|110435_113720_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_061403657.1|113732_115082_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.1	8.8e-58
WP_045124661.1|115242_116466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403658.1|116628_117540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403659.1|117543_119652_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_061403680.1|119777_120413_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_153518791.1|120866_121259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518793.1|121255_121447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403660.1|121938_122271_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_153518795.1|122313_124026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061403662.1|124128_124767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151711455.1|125850_127245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403664.1|127263_133185_+	strawberry notch C-terminal domain-containing protein	NA	K7WGS6	White_spot_syndrome_virus	30.9	9.6e-08
WP_061403665.1|133195_134821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403666.1|134847_135252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403667.1|135326_135914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403668.1|135929_136964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403669.1|136975_137716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403670.1|137719_138844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403671.1|138853_139990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153518797.1|140096_143834_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	32.6	6.7e-23
WP_061403681.1|143922_144243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403673.1|144298_144970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403674.1|144963_145494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403675.1|145486_145990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061403676.1|145986_147600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|147541_148632_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001082319.1|148733_149537_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|149536_150373_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067784.1|150786_151491_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_043041639.1|152166_153240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004647749.1|153683_153980_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	38.8	1.2e-15
WP_004969304.1|153981_154272_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	48.9	4.4e-15
WP_026438532.1|154382_155837_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	71.4	2.9e-184
WP_004976362.1|156086_156296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002002480.1|157014_157857_+	carbapenem-hydrolyzing class D beta-lactamase OXA-58	NA	NA	NA	NA	NA
WP_081106503.1|157910_158939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000073658.1|159933_160761_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000447788.1|160810_161416_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004728120.1|161465_161780_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_000438825.1|161766_162054_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_000172759.1|162325_162856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985609.1|163307_163589_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_001180106.1|163668_164088_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000897307.1|164229_164550_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000369781.1|164542_164815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000052512.1|165307_166783_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|166838_167723_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|167912_168524_-	recombinase family protein	NA	NA	NA	NA	NA
WP_033917576.1|168779_169742_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	9.1e-33
WP_046127737.1|169754_170828_-	two-component sensor histidine kinase AdeS	NA	W8CYF6	Bacillus_phage	28.0	2.7e-25
