The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	196924	259304	4800098	plate,transposase,protease,tRNA	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_103686450.1|196924_198277_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198306_200739_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200860_201346_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201349_202375_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202479_202935_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|202938_203727_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_047084196.1|203726_204875_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|204871_205468_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|205504_208987_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|208999_209959_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|210057_212199_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212255_212645_+	VOC family protein	NA	NA	NA	NA	NA
WP_096307025.1|212709_214008_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214056_214317_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214303_214504_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214669_215215_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215211_215634_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239179.1|215647_216358_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399589.1|216607_217588_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_096307512.1|217791_218616_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|218669_220388_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096307511.1|220498_221206_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|221202_221607_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|221724_222540_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|222579_223233_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|223225_224257_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|224444_225020_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|230918_231722_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|231718_232633_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|232873_233674_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211688.1|233751_234522_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|234569_235928_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|235999_236755_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326291.1|236788_237511_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|237507_237975_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|238039_238771_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086139.1|239310_240096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096307443.1|240232_240712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|240721_241636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|241679_242162_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_096307444.1|242185_243538_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_140433309.1|243548_246983_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_140433308.1|247091_248504_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|248508_249252_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_153625530.1|249248_252056_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.1	6.9e-81
WP_000343302.1|252064_252826_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_096307448.1|252830_254162_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|254164_254689_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|254685_255966_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_096307449.1|255990_257073_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_078398921.1|257036_258887_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|258890_259304_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	1186990	1238010	4800098	portal,holin,head,terminase,protease,integrase,tRNA,capsid,tail,lysis	Enterobacteria_phage(63.64%)	70	1187760:1187774	1205235:1205249
WP_096306818.1|1186990_1188097_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1187760:1187774	attL	TCGAGGAAGGCTTTA	NA	NA	NA	NA
WP_000476093.1|1188150_1188612_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1188621_1189275_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1189446_1190697_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741342.1|1190810_1191953_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	99.7	1.8e-205
WP_000088653.1|1191942_1192179_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1192318_1192558_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763385.1|1192605_1192824_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|1192922_1193204_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548522.1|1193214_1193406_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_000149538.1|1193378_1193561_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000186792.1|1193557_1194238_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_001414600.1|1194234_1195020_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	5.3e-148
WP_096306816.1|1195025_1195322_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	4.0e-48
WP_000904075.1|1195460_1195766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123002837.1|1195770_1196061_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	89.7	1.8e-29
WP_001288169.1|1196459_1197392_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_000414677.1|1197388_1197862_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_024185289.1|1197943_1198636_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.7	2.5e-109
WP_000184665.1|1198746_1198974_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001566184.1|1199004_1199544_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_077781211.1|1199540_1200560_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.3e-110
WP_000788890.1|1200556_1201258_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_096306814.1|1201254_1201548_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
WP_074468307.1|1201653_1201962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087898273.1|1202120_1202324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077757380.1|1202409_1202511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053886053.1|1202507_1202963_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_000224915.1|1202962_1203133_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_023307720.1|1203125_1203416_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	1.5e-47
WP_096306813.1|1203412_1203775_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000971093.1|1203771_1203912_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1203908_1204598_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1204919_1205225_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1205211_1205688_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
1205235:1205249	attR	TAAAGCCTTCCTCGA	NA	NA	NA	NA
WP_140433287.1|1205904_1206087_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	9.4e-16
WP_000738495.1|1206177_1206471_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1206762_1207173_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1207458_1207665_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1207829_1208024_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1208412_1208958_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_096306809.1|1208932_1210858_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1210854_1211061_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001440634.1|1211057_1212659_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.9e-310
WP_096306807.1|1212639_1213959_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	4.8e-234
WP_096306805.1|1213968_1214301_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	1.9e-54
WP_000063276.1|1214356_1215382_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158906.1|1215423_1215822_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1215833_1216187_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1216198_1216777_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1216773_1217169_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1217176_1217917_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1217932_1218355_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1218336_1218771_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_096306803.1|1218763_1221313_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000847331.1|1221309_1221639_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_096306801.1|1221638_1222337_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	6.2e-132
WP_000194779.1|1222342_1223086_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1223022_1223655_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_096306799.1|1223715_1227114_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230336.1|1227180_1227780_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_103686419.1|1227844_1230760_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1230759_1231341_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488338.1|1231460_1232351_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1232369_1232876_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_096306796.1|1232912_1233413_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1233491_1233674_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1234171_1234840_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096307515.1|1235385_1236870_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096307516.1|1237056_1238010_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 3
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	2138495	2146647	4800098		Prochlorococcus_phage(16.67%)	7	NA	NA
WP_000089911.1|2138495_2139461_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_001746893.1|2139463_2140585_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
WP_001581219.1|2140611_2141628_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_096307469.1|2141646_2142666_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.3	4.1e-84
WP_001363008.1|2142974_2143868_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|2144099_2145095_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001363019.1|2145252_2146647_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 4
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	2193370	2250748	4800098	portal,holin,plate,head,terminase,integrase,tRNA,capsid,tail,transposase,lysis	Escherichia_phage(35.42%)	68	2198428:2198455	2230797:2230824
WP_096307215.1|2193370_2194774_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|2194770_2195493_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_096307214.1|2195683_2196016_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2196224_2196521_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2196522_2196819_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476014.1|2196921_2198283_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2198428:2198455	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2198555_2198774_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_096307213.1|2198855_2200019_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	5.4e-205
WP_000978902.1|2200018_2200498_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_096307212.1|2200512_2202960_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000785970.1|2202952_2203072_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2203104_2203380_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2203436_2203955_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_096307211.1|2203967_2205158_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_074452492.1|2205601_2206087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069915486.1|2206173_2206959_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	20.3	1.7e-05
WP_001597977.1|2207289_2207817_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	3.4e-90
WP_153625554.1|2207820_2209818_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	59.6	5.5e-149
WP_096307320.1|2209828_2210359_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.3	5.6e-101
WP_001121456.1|2210351_2211260_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	98.3	7.0e-160
WP_096307321.1|2211264_2211612_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	2.9e-58
WP_096307322.1|2211608_2212244_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.0e-112
WP_001001787.1|2212310_2212763_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_023281588.1|2212755_2213223_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	1.9e-81
WP_001440152.1|2213185_2213359_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_096307323.1|2213330_2213756_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	96.5	8.0e-66
WP_096307324.1|2213743_2214169_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	6.1e-58
WP_023567678.1|2214183_2214681_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123123.1|2214680_2214962_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2214965_2215169_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_079959780.1|2215168_2215678_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	5.6e-90
WP_000203439.1|2215777_2216521_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_096307325.1|2216524_2217598_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	98.9	1.3e-200
WP_096307326.1|2217656_2218511_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	91.9	1.5e-124
WP_000156843.1|2218684_2220457_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_000038182.1|2220456_2221491_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_096307327.1|2221840_2223679_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	98.7	0.0e+00
WP_096307328.1|2223832_2226124_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_153625555.1|2226120_2227128_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.1	6.1e-64
WP_001538230.1|2227124_2227403_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.8	2.6e-41
WP_001113270.1|2227399_2227624_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001471828.1|2227623_2227926_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	2.5e-45
WP_000557703.1|2227925_2228150_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217681.1|2228213_2228714_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_001005162.1|2228710_2228881_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2228891_2229167_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2229288_2229588_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_096307330.1|2229703_2230717_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	98.8	7.7e-192
WP_000716757.1|2230981_2231299_-	hypothetical protein	NA	NA	NA	NA	NA
2230797:2230824	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2231704_2232604_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178556.1|2232685_2233465_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2233564_2234605_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490675.1|2234653_2236009_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|2236012_2236297_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182914.1|2236327_2236780_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_096307331.1|2236789_2238052_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001363051.1|2238080_2238935_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_078081066.1|2239244_2240297_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|2240553_2241831_+	nucleoside permease	NA	NA	NA	NA	NA
WP_096307332.1|2241827_2242832_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.4e-14
WP_096307333.1|2242828_2243794_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2243767_2244514_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096307334.1|2244565_2245384_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_096307335.1|2245448_2246249_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2246245_2247034_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000782271.1|2247586_2247811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001590329.1|2248029_2249463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2249586_2250748_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 5
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	2277008	2285316	4800098		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001402348.1|2277008_2279009_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001295429.1|2279133_2279595_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2279634_2280105_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2280151_2280871_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001538977.1|2280867_2282553_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.6e-303
WP_001240401.1|2282774_2283506_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2283565_2283673_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2283653_2284385_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2284389_2285316_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 6
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	2739337	2781318	4800098	holin,plate,head,terminase,tRNA,capsid,tail	Salmonella_phage(56.41%)	50	NA	NA
WP_001295367.1|2739337_2739874_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|2739898_2740534_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|2740742_2741591_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096307105.1|2742225_2742873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096307106.1|2743455_2744523_+	acyltransferase	NA	NA	NA	NA	NA
WP_103686444.1|2744778_2745195_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	74.3	1.2e-21
WP_103686445.1|2745194_2746280_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.2	9.2e-58
WP_096307390.1|2746261_2746942_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.4	1.1e-101
WP_103686446.1|2746938_2748138_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_001270634.1|2748137_2748491_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_054575860.1|2748490_2749243_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.7	1.4e-89
WP_032314236.1|2749306_2749729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314235.1|2749728_2750460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314234.1|2750596_2750938_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.3	1.8e-31
WP_096307388.1|2750941_2752003_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.0	1.0e-157
WP_000155113.1|2752005_2752308_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	4.1e-48
WP_001420197.1|2752307_2752895_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_096307387.1|2752894_2754883_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.0	3.1e-269
WP_032314228.1|2755060_2755513_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	2.7e-56
WP_000109249.1|2755516_2755957_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_023565717.1|2755967_2757113_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.8e-160
WP_096307386.1|2757116_2757680_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	2.9e-79
WP_032314226.1|2757654_2758044_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000008729.1|2758030_2758585_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	2.0e-80
WP_001125663.1|2758581_2758989_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	2.5e-69
WP_032314225.1|2759217_2760159_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_021580222.1|2760170_2760677_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	6.4e-70
WP_096307385.1|2760680_2761901_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.5	7.6e-202
WP_136759112.1|2761915_2762650_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_096307384.1|2762540_2764007_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	2.3e-261
WP_001130793.1|2764006_2765629_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_096307383.1|2765631_2766204_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.0	1.5e-59
WP_000779569.1|2766265_2766790_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2766773_2767250_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2767253_2767595_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_096111114.1|2767998_2768433_-	antitermination protein Q	NA	B6SD39	Bacteriophage	62.9	7.4e-43
WP_096307382.1|2768723_2770916_-	replication protein	NA	B6SCY1	Bacteriophage	72.1	7.1e-174
WP_000170998.1|2770919_2771132_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_032214624.1|2771252_2771876_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	45.3	1.1e-36
WP_000801672.1|2772523_2772673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096307381.1|2772669_2773572_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_096307380.1|2773574_2774876_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	1.4e-132
WP_000769011.1|2774891_2775440_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_112030936.1|2775466_2776066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096307356.1|2776092_2778156_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.4	3.0e-275
WP_096307355.1|2778438_2778657_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096307354.1|2778649_2778889_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	87.0	1.6e-31
WP_103686516.1|2778889_2779162_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.0e-27
WP_096307352.1|2779153_2779885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096307351.1|2779920_2781318_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.0	4.2e-212
>prophage 7
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	2922007	2929147	4800098		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2922007_2924569_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_096307011.1|2924674_2925331_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	9.5e-50
WP_001297141.1|2925381_2926149_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847982.1|2926344_2927253_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	8.6e-118
WP_000590392.1|2927249_2928512_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2928508_2929147_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 8
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	3920745	3927524	4800098		Enterobacteria_phage(100.0%)	9	NA	NA
WP_096307209.1|3920745_3921318_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.7e-93
WP_000638628.1|3921391_3921892_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_096307208.1|3921888_3922623_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	7.4e-128
WP_001149160.1|3923174_3923441_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032226384.1|3923437_3923992_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001244670.1|3923984_3924272_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_096307207.1|3924264_3924720_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000856729.1|3924855_3925176_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_096307206.1|3925190_3927524_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 9
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	4514631	4572496	4800098	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|4514631_4515891_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4515893_4516898_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4516979_4517177_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4517280_4518579_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4518783_4519209_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_153625571.1|4519247_4521689_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001293282.1|4521868_4522600_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4522726_4523128_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4523146_4523845_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4523895_4524555_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4524572_4524971_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_032218934.1|4524980_4525619_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_049589774.1|4525621_4526785_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_063070065.1|4526868_4528494_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4528610_4528886_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|4529034_4529364_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_096307504.1|4529545_4530295_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4530291_4531047_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4531154_4532219_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4532573_4533971_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4533986_4534292_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4534301_4534766_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4534779_4535430_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|4535439_4536294_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|4536293_4536980_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|4537108_4537384_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4537710_4538106_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4538112_4538427_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4538431_4538659_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4538700_4539150_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001350063.1|4539220_4540015_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_044804197.1|4540637_4541063_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	1.6e-42
WP_071999710.1|4541070_4542279_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	3.2e-208
WP_001119478.1|4542413_4543052_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4543270_4543891_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4544199_4545612_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4545656_4546319_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001297263.1|4546426_4547392_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560565.1|4547499_4548360_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4548448_4548829_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589439.1|4548946_4550890_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886895.1|4551079_4551820_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4551809_4552367_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4552691_4552898_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4552959_4554303_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4554625_4555264_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4555469_4557203_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001462977.1|4557199_4560979_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4560981_4561323_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223212.1|4561534_4561786_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|4561779_4562130_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055072.1|4562209_4562740_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|4563049_4564006_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_153625572.1|4564315_4565818_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001296689.1|4565831_4566854_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4566840_4567836_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4567868_4568867_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4569042_4570416_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4570498_4571050_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4571143_4572496_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 10
NZ_AP019856	Escherichia coli O8:H8 strain 16F5M1D1	4800098	4722378	4765360	4800098	portal,holin,plate,head,terminase,integrase,capsid,tail	Enterobacteria_phage(36.36%)	56	4718997:4719011	4739198:4739212
4718997:4719011	attL	GGGGACTTGAACCCC	NA	NA	NA	NA
WP_072837552.1|4722378_4723602_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.8	2.3e-235
WP_089644204.1|4723865_4725620_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_077581185.1|4725904_4726465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089644205.1|4726808_4727429_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.7	2.1e-115
WP_089644206.1|4727428_4727791_-	hypothetical protein	NA	U5P092	Shigella_phage	93.3	9.2e-63
WP_103686409.1|4727781_4728318_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	96.1	2.5e-96
WP_000081287.1|4728445_4729270_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|4729335_4729698_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_140433297.1|4730167_4730683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021559690.1|4730897_4731572_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.1	1.0e-131
WP_000649477.1|4731662_4731863_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515862.1|4731906_4732458_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_096307235.1|4732454_4733606_+	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	94.8	7.2e-202
WP_000620696.1|4733602_4733827_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_087905310.1|4733823_4734642_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_072127861.1|4734638_4735133_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.9	4.0e-85
WP_096307234.1|4735132_4735786_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.5e-127
WP_000210169.1|4735782_4736109_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_016240453.1|4736105_4736495_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.7e-68
WP_001061444.1|4736514_4737324_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_089644212.1|4737331_4738321_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.3e-193
WP_053896015.1|4738338_4738707_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	93.3	1.8e-58
WP_089559722.1|4740114_4740504_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.5	2.2e-46
4739198:4739212	attR	GGGGTTCAAGTCCCC	NA	NA	NA	NA
WP_089559724.1|4740493_4740772_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	75.8	8.4e-32
WP_096307233.1|4740934_4741696_+	Heat-labile enterotoxin IIA, A chain	NA	A0A0U2QV53	Escherichia_phage	77.6	2.5e-110
WP_089633557.1|4741708_4742080_+	Heat-labile enterotoxin IIA, B chain	NA	A0A0U2SHA2	Escherichia_phage	74.0	2.5e-47
WP_089633556.1|4742169_4742547_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	95.2	1.3e-62
WP_089559733.1|4742617_4742899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040079722.1|4742978_4743176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170986562.1|4743287_4743443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089559735.1|4743617_4743911_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	89.8	2.0e-44
WP_089559738.1|4744568_4745075_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	49.4	5.1e-35
WP_089633554.1|4745046_4746963_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.2	1.3e-251
WP_087905871.1|4746966_4747176_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	50.8	3.0e-10
WP_089633561.1|4747220_4748744_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.9	6.8e-184
WP_087905872.1|4748733_4750350_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.3	8.8e-105
WP_087905873.1|4750388_4750724_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.1	1.9e-22
WP_087905874.1|4750792_4751821_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	59.3	4.4e-110
WP_089633553.1|4751871_4752237_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_087905876.1|4752239_4752641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087905877.1|4752621_4753344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087905884.1|4753355_4753907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089633552.1|4753890_4754514_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	30.0	4.4e-12
WP_021562190.1|4754548_4754905_+	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	47.7	5.5e-20
WP_087905879.1|4754879_4755794_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	44.2	1.4e-62
WP_087905880.1|4755786_4756377_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.5	1.4e-23
WP_089633551.1|4756373_4757633_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	80.1	1.0e-108
WP_089633550.1|4757635_4758178_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.9	1.7e-73
WP_089633549.1|4758232_4759708_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	38.9	1.3e-75
WP_096307232.1|4759704_4760223_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_001291421.1|4760282_4760585_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_096307231.1|4760702_4762355_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.9	7.7e-48
WP_000228000.1|4762357_4762846_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_032083597.1|4762820_4763039_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	50.7	1.1e-10
WP_096307230.1|4763029_4764118_+	late control protein	NA	R9TNM7	Vibrio_phage	29.4	5.1e-32
WP_089633545.1|4764142_4765360_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	80.2	3.1e-62
>prophage 1
NZ_AP019857	Escherichia coli O8:H8 strain 16F5M1D1 plasmid p16F5M1D101, complete sequence	102846	17415	86893	102846	plate,transposase	Stx2-converting_phage(12.5%)	40	NA	NA
WP_158664222.1|17415_17835_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	61.9	2.4e-38
WP_032220430.1|21623_22235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096307497.1|23096_23957_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	24.1	6.3e-09
WP_096307496.1|24251_24461_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	37.7	3.4e-09
WP_096307495.1|24617_25787_-	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	39.4	1.5e-66
WP_096307494.1|26027_26744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139302939.1|29042_29408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096307492.1|29714_30746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096307289.1|34058_34979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096307290.1|35453_36641_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_172968692.1|36641_37340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032220411.1|37653_37848_-	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_077698048.1|38661_38820_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_050489381.1|38812_39724_+	site-specific DNA-methyltransferase	NA	A0A1D8EQ78	Mycobacterium_phage	46.5	1.1e-67
WP_032260795.1|39673_40552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172904298.1|40978_41365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172968693.1|41454_41616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050436638.1|44549_45206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032220517.1|47645_48236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032220516.1|48930_49890_-	DUF2219 family protein	NA	NA	NA	NA	NA
WP_032220394.1|51154_51964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112030956.1|54413_54920_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_103686561.1|56471_56936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063103595.1|58341_59247_-	DMT family transporter	NA	NA	NA	NA	NA
WP_103686553.1|61014_62190_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032260613.1|62228_62978_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|64488_65650_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_113264828.1|67547_68117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143354741.1|68589_69642_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_103686424.1|69674_72206_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	32.9	1.5e-90
WP_103686423.1|72215_75617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103686422.1|75633_76224_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_112030950.1|76258_77695_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032260619.1|77672_78245_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_112030949.1|80412_81477_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_172968696.1|81480_81780_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_103686551.1|81789_82251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112030948.1|82243_84175_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	7.2e-13
WP_112030947.1|84185_85115_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_172968695.1|85105_86893_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
