The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	1095221	1202010	3696506	protease,tRNA,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095221_1096442_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096529_1097120_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097116_1097419_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097470_1098460_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098580_1099462_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099635_1100490_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100521_1101370_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101497_1102718_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102736_1103303_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103500_1104652_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104790_1105795_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105951_1106923_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107001_1107790_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107861_1108098_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108106_1109018_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109061_1110933_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111093_1111891_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112122_1112497_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112573_1112897_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1112980_1113253_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113267_1113723_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113844_1114681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114677_1116051_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116127_1117084_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117171_1118149_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118273_1119929_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1119977_1120442_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120438_1120900_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121125_1122313_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122309_1123614_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123610_1125020_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125213_1126333_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126468_1127488_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127496_1130202_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130341_1130995_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131057_1131420_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1131986_1133447_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133709_1134783_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134867_1136088_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137845_1138966_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138939_1140439_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140452_1141556_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141560_1142811_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142807_1144253_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144249_1144564_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144565_1145684_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145866_1147087_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147186_1148053_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148113_1149094_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149240_1150161_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150169_1151282_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151363_1152185_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152260_1152869_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153006_1154383_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154444_1154888_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154954_1155611_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155653_1156773_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156942_1157224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157934_1158723_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158719_1159826_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160500_1161859_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161973_1162171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162188_1163309_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163402_1163957_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164544_1165861_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165873_1166887_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167433_1168384_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168463_1168763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170123_1171782_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171930_1173151_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173268_1174552_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174555_1175497_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175606_1176065_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176445_1177066_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177473_1179894_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180001_1180739_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180785_1182030_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182352_1182625_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183208_1183937_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183958_1184876_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184875_1185385_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185501_1186173_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186282_1187350_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187369_1189214_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189350_1190538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190838_1191624_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191647_1192767_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192871_1194209_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194318_1195260_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195315_1196497_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196655_1196946_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1196992_1197661_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197657_1197945_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198321_1199107_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199139_1199874_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200789_1202010_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	1206797	1263203	3696506	protease,tRNA,transposase	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206797_1207748_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207829_1208309_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209520_1210720_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210865_1211243_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211266_1213048_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213056_1213794_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214078_1215638_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215697_1216456_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216552_1217209_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217362_1218127_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218141_1218321_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218346_1219381_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219377_1219791_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219787_1220372_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220724_1222083_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222176_1222755_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222879_1224000_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224072_1225329_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225432_1226638_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226701_1227151_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227283_1227529_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227753_1228068_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233321_1235427_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235480_1237790_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239143_1240811_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240813_1241479_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241611_1245418_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245643_1246789_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246907_1247837_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247833_1248910_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248906_1249713_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249709_1250441_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250817_1252056_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252103_1252442_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252689_1253640_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253958_1254141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254206_1255427_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255520_1256741_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256800_1257064_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257185_1258685_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259105_1259303_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259318_1259678_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259750_1260773_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260785_1263203_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	1586741	1693004	3696506	tRNA,integrase,transposase	Leptospira_phage(14.29%)	100	1644016:1644032	1689682:1689698
WP_005011985.1|1586741_1587962_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588316_1588793_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589051_1589660_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589678_1590350_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590523_1592410_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592437_1593280_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593276_1594620_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594804_1595620_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595685_1597167_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597365_1599438_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599657_1600695_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601881_1602739_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602766_1603543_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604370_1604880_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1605957_1606728_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606724_1607735_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607793_1608874_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609042_1610162_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610163_1610907_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610911_1611283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611343_1611589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611695_1613195_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613816_1614152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614410_1614542_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614571_1615069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615078_1615453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615543_1616836_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616952_1617852_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618003_1618222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618695_1620321_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620556_1622080_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622051_1622747_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623087_1624149_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624194_1624746_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624752_1625673_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625812_1628110_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628165_1629386_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629644_1630250_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630260_1631421_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631442_1632324_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632620_1633319_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633460_1634183_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634301_1635240_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635270_1636050_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636036_1637260_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637264_1638812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638847_1639381_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639624_1640320_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640334_1640466_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640513_1641638_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641643_1643983_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1643979_1644387_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644016:1644032	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644648_1644909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645131_1646082_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646180_1647131_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647180_1648389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648610_1649150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649374_1649779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649843_1650599_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650598_1651960_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1651956_1652580_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652623_1653743_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654395_1655151_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655327_1656122_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656118_1656556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656667_1656820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657240_1658209_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658365_1659373_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659430_1659889_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659962_1661309_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661326_1661698_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661697_1663167_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663322_1664048_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664061_1666776_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667027_1668392_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668431_1669490_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669517_1670336_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670373_1670652_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671915_1672215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672784_1674188_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674200_1674851_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674992_1676213_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676243_1677320_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677466_1678597_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678783_1680409_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680415_1681231_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681245_1682316_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682367_1683027_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683666_1684829_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684870_1685185_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685168_1685555_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685593_1685860_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686252_1686942_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687041_1687203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687353_1687518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687644_1687881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688070_1688319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688432_1689803_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689682:1689698	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689803_1690544_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691051_1693004_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	1711298	1755225	3696506	tRNA,integrase,transposase,holin	Leptospira_phage(33.33%)	37	1753793:1753807	1760269:1760283
WP_005019367.1|1711298_1714160_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714149_1715115_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715871_1717347_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717351_1717627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717963_1719083_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718957_1719206_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719384_1720593_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720589_1722872_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722882_1725264_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725527_1727435_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727449_1728340_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728346_1729480_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729479_1730301_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730325_1731516_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731817_1732099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732264_1732585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732624_1733711_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733907_1734168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734660_1735431_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735427_1736438_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736472_1737315_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737777_1738563_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739422_1740542_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741608_1742613_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742688_1743501_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743728_1745900_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745953_1747273_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747361_1748582_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748800_1749661_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749657_1750881_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751179_1751677_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751715_1752498_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752523_1752742_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752816_1753086_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753305_1753770_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753793:1753807	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753843_1754125_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754241_1755225_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760269:1760283	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	1780501	1821893	3696506	transposase	Ralstonia_virus(50.0%)	38	NA	NA
WP_005012067.1|1780501_1781452_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781448_1781964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782321_1782942_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783041_1783293_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783380_1784859_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784855_1788026_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788038_1789235_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789423_1790356_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790424_1791156_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791221_1791857_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791842_1793021_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793181_1793730_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793810_1794170_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794217_1795438_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795513_1796635_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796672_1797386_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797396_1798617_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798699_1799254_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799399_1800350_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800309_1800471_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800511_1801438_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801451_1802324_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802486_1803434_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803772_1804354_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804931_1805882_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805861_1806614_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806626_1807358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807514_1809680_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809769_1810039_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810127_1810334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810332_1810851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810869_1811649_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811816_1812833_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812905_1813397_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813407_1815123_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_003814009.1|1818889_1820131_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820142_1820916_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820942_1821893_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	2150106	2210229	3696506	protease,tRNA,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150106_2150595_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150587_2151436_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151527_2152025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152162_2152522_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152518_2152800_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152799_2153282_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153283_2154912_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154908_2155253_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155254_2158197_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158642_2159614_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159603_2160986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161128_2162079_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162038_2163280_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163276_2164398_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165889_2166357_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166427_2167078_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167164_2168304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168472_2169477_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169473_2170721_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171073_2171940_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171899_2173504_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173515_2174202_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174198_2175239_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175354_2176026_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176022_2177015_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177011_2177950_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177946_2179101_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179109_2180561_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180591_2181074_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181075_2181969_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181965_2182409_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182421_2182796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182938_2183337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183463_2183751_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183747_2184164_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184339_2184972_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185000_2185447_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185733_2186885_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2186998_2188003_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2188986_2189694_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189626_2191078_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191083_2194242_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194254_2194776_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194765_2195590_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195586_2196186_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196294_2198151_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198299_2199304_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199512_2200775_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200779_2201115_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201111_2202041_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202045_2202759_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202862_2204320_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204316_2204613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153567346.1|2204737_2206096_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.2	3.0e-42
WP_005014285.1|2206196_2206997_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207176_2208295_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208367_2208739_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208745_2209597_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209617_2210229_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	2305358	2426878	3696506	protease,tRNA,integrase,transposase	Leptospira_phage(15.15%)	106	2336888:2336947	2358194:2358443
WP_101557807.1|2305358_2306521_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306633_2307602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307598_2308519_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308615_2313094_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313472_2317807_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318445_2319009_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319020_2319266_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319421_2319931_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319976_2320957_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321168_2323520_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323566_2324397_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324393_2325083_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325075_2326356_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326453_2327392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327373_2329080_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329157_2330261_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330313_2331063_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331069_2332584_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332596_2332884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332904_2333792_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333942_2334449_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334445_2335402_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335589_2336936_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336888:2336947	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336903_2337134_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_153569218.1|2337138_2337726_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337880_2338651_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338647_2339658_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339972_2340419_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340474_2340669_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340670_2341012_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341021_2342884_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342923_2343430_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343433_2343757_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343758_2344163_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344199_2345411_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345432_2345981_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346205_2346697_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346911_2348942_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349016_2350219_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350761_2351697_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352730_2353012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353098_2353272_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353383_2353728_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353799_2354468_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355883_2356927_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356923_2357025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357116_2358236_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358486_2359140_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358194:2358443	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGT	NA	NA	NA	NA
WP_032974133.1|2359255_2360476_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360526_2362956_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363121_2364420_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364524_2365178_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365180_2366491_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366718_2367258_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367736_2368003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368041_2368407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368288_2369299_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369295_2370066_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370151_2370811_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370778_2371270_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371379_2371583_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371900_2372221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372204_2372540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372594_2372807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372882_2373221_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373217_2373553_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373615_2375187_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2375980_2376292_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376484_2377605_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377732_2377927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013624.1|2384009_2384300_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
WP_005019713.1|2385566_2387030_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387162_2388713_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388709_2388859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389024_2390145_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391258_2392116_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392168_2392666_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392786_2394202_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394211_2395396_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395392_2396991_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398173_2398419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398829_2399015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399170_2400082_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400203_2401046_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401248_2402622_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402931_2404443_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404595_2405327_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405433_2406735_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406742_2407651_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407647_2408241_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408284_2408698_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408694_2409165_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409171_2409777_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411578_2413363_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413359_2414745_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414730_2415693_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415762_2416392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416429_2417638_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417759_2418329_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418460_2420014_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420317_2421538_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421945_2422848_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422844_2423714_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423710_2424562_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424558_2425383_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425657_2426878_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043068	Bordetella holmesii strain J708 chromosome, complete genome	3696506	2936321	3013381	3696506	tRNA,integrase,transposase	Ralstonia_virus(21.43%)	56	2939176:2939235	2987763:2988333
WP_005019978.1|2936321_2937101_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937123_2938071_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938072_2938273_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938607_2939727_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939176:2939235	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940048_2940765_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940761_2941655_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941818_2943039_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943191_2944274_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945953_2946937_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946999_2948412_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948529_2949372_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949650_2950259_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950274_2950895_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950960_2951668_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951672_2952395_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952381_2952672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952747_2953968_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954692_2955544_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955595_2956849_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957025_2957814_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957933_2958848_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2958980_2960873_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961058_2962438_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962882_2963179_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2966979_2967582_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967715_2968174_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968175_2968775_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968783_2969593_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969627_2970482_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970601_2971189_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971185_2972565_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973069_2973216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980887_2982228_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982241_2983093_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983104_2984370_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984431_2986336_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988311_2989166_-	hypothetical protein	NA	NA	NA	NA	NA
2987763:2988333	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989158_2989953_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990168_2991119_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991721_2992519_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992558_2993212_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993192_2994257_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994420_2996646_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996891_2998736_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998852_2999725_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999771_3001472_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001534_3002734_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002744_3003623_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003729_3004767_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004847_3005252_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005263_3006721_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007363_3007960_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008120_3008579_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009356_3010328_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010449_3010869_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012160_3013381_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
