The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	1095320	1202109	3696594	protease,tRNA,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095320_1096541_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096628_1097219_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097215_1097518_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097569_1098559_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098679_1099561_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099734_1100589_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100620_1101469_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101596_1102817_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102835_1103402_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103599_1104751_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104889_1105894_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106050_1107022_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107100_1107889_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107960_1108197_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108205_1109117_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109160_1111032_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111192_1111990_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112221_1112596_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112672_1112996_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113079_1113352_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113366_1113822_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113943_1114780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114776_1116150_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116226_1117183_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117270_1118248_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118372_1120028_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120076_1120541_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120537_1120999_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121224_1122412_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122408_1123713_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123709_1125119_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125312_1126432_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126567_1127587_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127595_1130301_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130440_1131094_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131156_1131519_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132085_1133546_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133808_1134882_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134966_1136187_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137944_1139065_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139038_1140538_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140551_1141655_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_032979952.1|1141659_1142910_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142906_1144352_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144348_1144663_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144664_1145783_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145965_1147186_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147285_1148152_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148212_1149193_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149339_1150260_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150268_1151381_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151462_1152284_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152359_1152968_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153105_1154482_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154543_1154987_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155053_1155710_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155752_1156872_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157041_1157323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158033_1158822_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158818_1159925_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160599_1161958_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162072_1162270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162287_1163408_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163501_1164056_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164643_1165960_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165972_1166986_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167532_1168483_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168562_1168862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170222_1171881_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172029_1173250_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173367_1174651_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174654_1175596_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175705_1176164_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176544_1177165_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177572_1179993_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180100_1180838_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180884_1182129_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182451_1182724_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183307_1184036_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184057_1184975_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184974_1185484_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185600_1186272_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186381_1187449_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187468_1189313_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189449_1190637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190937_1191723_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191746_1192866_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192970_1194308_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194417_1195359_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195414_1196596_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196754_1197045_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197091_1197760_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197756_1198044_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198420_1199206_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199238_1199973_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200888_1202109_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	1206896	1263302	3696594	protease,tRNA,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206896_1207847_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207928_1208408_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209619_1210819_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210964_1211342_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211365_1213147_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213155_1213893_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214177_1215737_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215796_1216555_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216651_1217308_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217461_1218226_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218240_1218420_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218445_1219480_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219476_1219890_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219886_1220471_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220823_1222182_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222275_1222854_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222978_1224099_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224171_1225428_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225531_1226737_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226800_1227250_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227382_1227628_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227852_1228167_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233420_1235526_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235579_1237889_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239242_1240910_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240912_1241578_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241710_1245517_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245742_1246888_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1247006_1247936_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247932_1249009_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1249005_1249812_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249808_1250540_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250916_1252155_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252202_1252541_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252788_1253739_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254057_1254240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254305_1255526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255619_1256840_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256899_1257163_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257284_1258784_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258831_1259107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259204_1259402_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259417_1259777_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259849_1260872_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260884_1263302_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	1586840	1693095	3696594	tRNA,integrase,transposase	Leptospira_phage(14.29%)	100	1644115:1644131	1689781:1689797
WP_005011985.1|1586840_1588061_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588415_1588892_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589150_1589759_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589777_1590449_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590622_1592509_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592536_1593379_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593375_1594719_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594903_1595719_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595784_1597266_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597464_1599537_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599756_1600794_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601980_1602838_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602865_1603642_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604469_1604979_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606056_1606827_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606823_1607834_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607892_1608973_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609141_1610261_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610262_1611006_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1611010_1611382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611442_1611688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611794_1613294_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613915_1614251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614509_1614641_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614670_1615168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615177_1615552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615642_1616935_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617051_1617951_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618102_1618321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618794_1620420_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620655_1622179_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622150_1622846_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623186_1624248_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624293_1624845_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624851_1625772_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625911_1628209_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628264_1629485_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629743_1630349_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630359_1631520_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631541_1632423_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632719_1633418_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633559_1634282_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634400_1635339_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635369_1636149_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636135_1637359_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637363_1638911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638946_1639480_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639723_1640419_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640433_1640565_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640612_1641737_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641742_1644082_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644078_1644486_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644115:1644131	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644747_1645008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645230_1646181_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646279_1647230_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647279_1648488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648709_1649249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649473_1649878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649942_1650698_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650697_1652059_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652055_1652679_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652722_1653842_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654494_1655250_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655426_1656221_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656217_1656655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656766_1656919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657339_1658308_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658464_1659472_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659529_1659988_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660061_1661408_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661425_1661797_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661796_1663266_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663421_1664147_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664160_1666875_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667126_1668491_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668530_1669589_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669616_1670435_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670472_1670751_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1672014_1672314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672883_1674287_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674299_1674950_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675091_1676312_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676342_1677419_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677565_1678696_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678882_1680508_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680514_1681330_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681344_1682415_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682466_1683126_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683765_1684928_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684969_1685284_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685267_1685654_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685692_1685959_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686351_1687041_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687140_1687302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687452_1687617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687743_1687980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688169_1688418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688531_1689902_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689781:1689797	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689902_1690643_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691142_1693095_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	1711389	1755316	3696594	tRNA,holin,integrase,transposase	Leptospira_phage(33.33%)	37	1753884:1753898	1760360:1760374
WP_005019367.1|1711389_1714251_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714240_1715206_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715962_1717438_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717442_1717718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718054_1719174_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719048_1719297_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719475_1720684_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720680_1722963_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722973_1725355_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725618_1727526_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727540_1728431_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728437_1729571_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729570_1730392_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730416_1731607_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731908_1732190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732355_1732676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732715_1733802_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733998_1734259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734751_1735522_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735518_1736529_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736563_1737406_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737868_1738654_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739513_1740633_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741699_1742704_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742779_1743592_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743819_1745991_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746044_1747364_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747452_1748673_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748891_1749752_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749748_1750972_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751270_1751768_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751806_1752589_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752614_1752833_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752907_1753177_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753396_1753861_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753884:1753898	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753934_1754216_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754332_1755316_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760360:1760374	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	1780592	1821983	3696594	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780592_1781543_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781539_1782055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782412_1783033_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783132_1783384_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783471_1784950_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784946_1788117_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788129_1789326_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789514_1790447_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790515_1791247_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791312_1791948_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791933_1793112_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793272_1793821_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793901_1794261_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794308_1795529_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795604_1796726_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796763_1797477_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797487_1798708_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798790_1799345_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799490_1800441_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800400_1800562_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800602_1801529_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801542_1802415_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802577_1803525_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803863_1804445_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805022_1805973_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805952_1806705_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806717_1807449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807605_1809771_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809860_1810130_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810218_1810425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810423_1810942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810960_1811740_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811907_1812924_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812996_1813488_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813498_1815214_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816377_1817328_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818979_1820221_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820232_1821006_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821032_1821983_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	2150196	2210319	3696594	tRNA,protease,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150196_2150685_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150677_2151526_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151617_2152115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152252_2152612_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152608_2152890_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152889_2153372_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153373_2155002_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154998_2155343_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155344_2158287_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158732_2159704_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159693_2161076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161218_2162169_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162128_2163370_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163366_2164488_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165979_2166447_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166517_2167168_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167254_2168394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168562_2169567_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169563_2170811_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171163_2172030_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171989_2173594_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173605_2174292_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174288_2175329_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175444_2176116_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176112_2177105_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177101_2178040_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178036_2179191_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179199_2180651_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180681_2181164_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181165_2182059_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182055_2182499_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182511_2182886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183028_2183427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183553_2183841_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183837_2184254_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184429_2185062_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185090_2185537_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185823_2186975_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187088_2188093_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189076_2189784_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189716_2191168_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191173_2194332_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194344_2194866_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194855_2195680_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195676_2196276_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196384_2198241_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198389_2199394_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199602_2200865_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200869_2201205_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201201_2202131_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202135_2202849_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202952_2204410_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204406_2204703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204827_2206186_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206286_2207087_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207266_2208385_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208457_2208829_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208835_2209687_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209707_2210319_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	2305442	2426952	3696594	tRNA,integrase,transposase,protease	Leptospira_phage(15.15%)	106	2336972:2337031	2358279:2358553
WP_101557807.1|2305442_2306605_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306717_2307686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307682_2308603_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308699_2313178_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313556_2317891_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318529_2319093_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319104_2319350_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319505_2320015_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320060_2321041_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321252_2323604_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323650_2324481_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324477_2325167_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325159_2326440_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326537_2327476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327457_2329164_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329241_2330345_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330397_2331147_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331153_2332668_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332680_2332968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332988_2333876_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334026_2334533_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334529_2335486_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335673_2337020_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336972:2337031	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336987_2337218_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337247_2337811_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337965_2338736_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338732_2339743_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340057_2340504_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340559_2340754_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340755_2341097_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341106_2342969_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343008_2343515_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343518_2343842_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343843_2344248_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344284_2345496_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345517_2346066_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346290_2346782_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346996_2349027_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349101_2350304_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350846_2351782_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352815_2353097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353183_2353357_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353468_2353813_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353884_2354553_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355968_2357012_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357008_2357110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357201_2358321_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358571_2359225_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358279:2358553	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359340_2360561_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360611_2363041_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363206_2364505_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364609_2365263_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365265_2366576_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366803_2367343_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367821_2368088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368126_2368492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368373_2369384_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369380_2370151_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370236_2370896_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370863_2371355_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371464_2371668_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371985_2372306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372289_2372625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372679_2372892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372967_2373306_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373302_2373638_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373700_2375272_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376065_2376377_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376569_2377690_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377817_2378012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384093_2385255_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385640_2387104_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387236_2388787_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388783_2388933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389098_2390219_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391332_2392190_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392242_2392740_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392860_2394276_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394285_2395470_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395466_2397065_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398247_2398493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398903_2399089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399244_2400156_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400277_2401120_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401322_2402696_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403005_2404517_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404669_2405401_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405507_2406809_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406816_2407725_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407721_2408315_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408358_2408772_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408768_2409239_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409245_2409851_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411652_2413437_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413433_2414819_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414804_2415767_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415836_2416466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416503_2417712_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417833_2418403_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418534_2420088_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420391_2421612_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422019_2422922_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422918_2423788_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423784_2424636_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424632_2425457_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425731_2426952_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	2936411	3014419	3696594	tRNA,integrase,transposase,protease	Ralstonia_virus(21.43%)	56	2939266:2939325	2987853:2988423
WP_005019978.1|2936411_2937191_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937213_2938161_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938162_2938363_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938697_2939817_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939266:2939325	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940138_2940855_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940851_2941745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941908_2943129_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943281_2944364_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946043_2947027_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947089_2948502_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948619_2949462_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949740_2950349_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950364_2950985_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951050_2951758_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951762_2952485_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952471_2952762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952837_2954058_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954782_2955634_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955685_2956939_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957115_2957904_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958023_2958938_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959070_2960963_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961148_2962528_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962972_2963269_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967069_2967672_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967805_2968264_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968265_2968865_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968873_2969683_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969717_2970572_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970691_2971279_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971275_2972655_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973159_2973306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980977_2982318_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982331_2983183_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983194_2984460_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984521_2986426_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988401_2989256_-	hypothetical protein	NA	NA	NA	NA	NA
2987853:2988423	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989248_2990043_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005020039.1|2991810_2992608_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992647_2993301_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993281_2994346_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994509_2996735_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996980_2998825_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998941_2999814_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999860_3001561_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001623_3002823_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002833_3003712_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003818_3004856_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004936_3005341_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005352_3006810_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007452_3008049_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008209_3008668_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009445_3010417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010538_3010958_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012249_3013470_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005020040.1|3013531_3014419_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 9
NZ_CP043125	Bordetella holmesii strain H862 chromosome, complete genome	3696594	3548710	3585926	3696594	tRNA,protease,transposase,holin	Ralstonia_virus(11.11%)	38	NA	NA
WP_005011985.1|3548710_3549931_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005016909.1|3549992_3551171_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005016911.1|3551189_3552284_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.2e-49
WP_005016914.1|3552280_3554320_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	38.7	3.4e-13
WP_005016917.1|3554440_3555118_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005016919.1|3556780_3557713_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005016921.1|3557726_3558530_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005016923.1|3558562_3559426_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005016926.1|3559524_3560475_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016929.1|3560471_3560951_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005016932.1|3560913_3561186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879514.1|3561149_3561914_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_005016938.1|3561949_3562207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016939.1|3562483_3563473_+	extra-cytoplasmic solute receptor family protein 175	NA	NA	NA	NA	NA
WP_005016941.1|3563526_3564369_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005016943.1|3564368_3564704_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_005016945.1|3564766_3566188_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.0	1.8e-37
WP_005016947.1|3566448_3567492_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_005016949.1|3567559_3567781_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_005016951.1|3568007_3568220_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_005016952.1|3568216_3568981_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005016955.1|3569035_3570199_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.9	3.4e-127
WP_005020237.1|3570216_3571332_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005016962.1|3571328_3572222_+	lysophospholipid acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	31.2	5.5e-32
WP_005016964.1|3572244_3573141_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005016967.1|3573165_3573834_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_005016969.1|3573840_3574809_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	29.9	3.3e-14
WP_005020238.1|3574814_3576860_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005016972.1|3576946_3577888_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_005016975.1|3577884_3578550_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_005020243.1|3578510_3579512_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005016979.1|3579514_3580390_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005016985.1|3580386_3581142_-	metal ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	5.5e-09
WP_017685723.1|3581317_3581818_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_005016990.1|3582177_3583287_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005016992.1|3583408_3583873_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_005016994.1|3584025_3584580_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017685724.1|3584591_3585926_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	9.3e-44
