The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	1095251	1202041	3696747	transposase,tRNA,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005012682.1|1095251_1096472_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_017685926.1|1096560_1097151_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097147_1097450_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097501_1098491_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098611_1099493_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099666_1100521_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100552_1101401_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101528_1102749_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102767_1103334_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103531_1104683_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104821_1105826_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105982_1106954_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107032_1107821_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107892_1108129_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108137_1109049_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109092_1110964_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111124_1111922_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112153_1112528_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112604_1112928_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113011_1113284_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113298_1113754_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113875_1114712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114708_1116082_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116158_1117115_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117202_1118180_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118304_1119960_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120008_1120473_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120469_1120931_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121156_1122344_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122340_1123645_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123641_1125051_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125244_1126364_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126499_1127519_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127527_1130233_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130372_1131026_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131088_1131451_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132017_1133478_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133740_1134814_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134898_1136119_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137876_1138997_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138970_1140470_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140483_1141587_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141591_1142842_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142838_1144284_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144280_1144595_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144596_1145715_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145897_1147118_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147217_1148084_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148144_1149125_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149271_1150192_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150200_1151313_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151394_1152216_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152291_1152900_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153037_1154414_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154475_1154919_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154985_1155642_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155684_1156804_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156973_1157255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157965_1158754_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158750_1159857_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160531_1161890_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162004_1162202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162219_1163340_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163433_1163988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164575_1165892_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165904_1166918_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167464_1168415_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168494_1168794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170154_1171813_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171961_1173182_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173299_1174583_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174586_1175528_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175637_1176096_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176476_1177097_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177504_1179925_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180032_1180770_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180816_1182061_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182383_1182656_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183239_1183968_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183989_1184907_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184906_1185416_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185532_1186204_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186313_1187381_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187400_1189245_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189381_1190569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190869_1191655_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191678_1192798_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192902_1194240_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194349_1195291_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195346_1196528_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196686_1196977_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197023_1197692_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197688_1197976_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198352_1199138_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199170_1199905_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200820_1202041_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	1206828	1263234	3696747	transposase,tRNA,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206828_1207779_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207860_1208340_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209551_1210751_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210896_1211274_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211297_1213079_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213087_1213825_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214109_1215669_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215728_1216487_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216583_1217240_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217393_1218158_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218172_1218352_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218377_1219412_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219408_1219822_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219818_1220403_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220755_1222114_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222207_1222786_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222910_1224031_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224103_1225360_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225463_1226669_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226732_1227182_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227314_1227560_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227784_1228099_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233352_1235458_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235511_1237821_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239174_1240842_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240844_1241510_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241642_1245449_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245674_1246820_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246938_1247868_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247864_1248941_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248937_1249744_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249740_1250472_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250848_1252087_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252134_1252473_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252720_1253671_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253989_1254172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153570262.1|1254237_1255458_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255551_1256772_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256831_1257095_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257216_1258716_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259136_1259334_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259349_1259709_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259781_1260804_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260816_1263234_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	1586772	1693026	3696747	integrase,transposase,tRNA	Leptospira_phage(14.29%)	100	1644047:1644063	1689713:1689729
WP_005011985.1|1586772_1587993_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588347_1588824_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589082_1589691_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589709_1590381_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590554_1592441_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592468_1593311_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593307_1594651_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594835_1595651_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595716_1597198_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597396_1599469_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599688_1600726_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601912_1602770_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602797_1603574_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604401_1604911_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1605988_1606759_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606755_1607766_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607824_1608905_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609073_1610193_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610194_1610938_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610942_1611314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611374_1611620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611726_1613226_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613847_1614183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614441_1614573_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614602_1615100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615109_1615484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615574_1616867_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616983_1617883_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618034_1618253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618726_1620352_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620587_1622111_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622082_1622778_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623118_1624180_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624225_1624777_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624783_1625704_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625843_1628141_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628196_1629417_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629675_1630281_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630291_1631452_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631473_1632355_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632651_1633350_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633491_1634214_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634332_1635271_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635301_1636081_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636067_1637291_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637295_1638843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638878_1639412_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639655_1640351_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640365_1640497_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640544_1641669_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641674_1644014_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644010_1644418_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644047:1644063	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644679_1644940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645162_1646113_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646211_1647162_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647211_1648420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648641_1649181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649405_1649810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649874_1650630_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650629_1651991_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1651987_1652611_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652654_1653774_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654426_1655182_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655358_1656153_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656149_1656587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656698_1656851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657271_1658240_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658396_1659404_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659461_1659920_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659993_1661340_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661357_1661729_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661728_1663198_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663353_1664079_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664092_1666807_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667058_1668423_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668462_1669521_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669548_1670367_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670404_1670683_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671946_1672246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672815_1674219_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674231_1674882_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675023_1676244_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676274_1677351_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677497_1678628_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678814_1680440_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680446_1681262_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681276_1682347_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682398_1683058_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683697_1684860_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684901_1685216_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685199_1685586_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685624_1685891_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686283_1686973_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687072_1687234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687384_1687549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687675_1687912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688101_1688350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688463_1689834_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689713:1689729	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689834_1690575_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691073_1693026_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	1711320	1755463	3696747	integrase,holin,transposase,tRNA	Leptospira_phage(33.33%)	37	1754031:1754045	1760507:1760521
WP_005019367.1|1711320_1714182_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714171_1715137_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715893_1717369_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717373_1717649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717985_1719105_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718979_1719228_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719406_1720615_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720611_1722894_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722904_1725286_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725549_1727457_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727471_1728362_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728368_1729502_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729501_1730323_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730347_1731538_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731839_1732121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732286_1732607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732646_1733733_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733929_1734190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734682_1735453_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735449_1736460_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736494_1737337_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737799_1738585_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739444_1740564_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005011985.1|1741630_1742851_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013675.1|1742926_1743739_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743966_1746138_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746191_1747511_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747599_1748820_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749038_1749899_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749895_1751119_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751417_1751915_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751953_1752736_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752761_1752980_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753054_1753324_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753543_1754008_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754031:1754045	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754081_1754363_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754479_1755463_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760507:1760521	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	1780739	1822130	3696747	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780739_1781690_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781686_1782202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782559_1783180_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783279_1783531_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783618_1785097_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1785093_1788264_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788276_1789473_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789661_1790594_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790662_1791394_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791459_1792095_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792080_1793259_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793419_1793968_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794048_1794408_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794455_1795676_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795751_1796873_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796910_1797624_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797634_1798855_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798937_1799492_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799637_1800588_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800547_1800709_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800749_1801676_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801689_1802562_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802724_1803672_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804010_1804592_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805169_1806120_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1806099_1806852_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806864_1807596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807752_1809918_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810007_1810277_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810365_1810572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810570_1811089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1811107_1811887_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812054_1813071_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1813143_1813635_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813645_1815361_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816524_1817475_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1819126_1820368_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820379_1821153_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821179_1822130_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	2150343	2210466	3696747	transposase,tRNA,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150343_2150832_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150824_2151673_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151764_2152262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152399_2152759_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152755_2153037_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2153036_2153519_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153520_2155149_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155145_2155490_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155491_2158434_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158879_2159851_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159840_2161223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161365_2162316_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162275_2163517_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163513_2164635_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2166126_2166594_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166664_2167315_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167401_2168541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168709_2169714_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169710_2170958_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171310_2172177_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2172136_2173741_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173752_2174439_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174435_2175476_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175591_2176263_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176259_2177252_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177248_2178187_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178183_2179338_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179346_2180798_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180828_2181311_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181312_2182206_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182202_2182646_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182658_2183033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183175_2183574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183700_2183988_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183984_2184401_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184576_2185209_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185237_2185684_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185970_2187122_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187235_2188240_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189223_2189931_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189863_2191315_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191320_2194479_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194491_2195013_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2195002_2195827_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195823_2196423_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196531_2198388_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198536_2199541_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199749_2201012_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2201016_2201352_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201348_2202278_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202282_2202996_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2203099_2204557_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204553_2204850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204974_2206333_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206433_2207234_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207413_2208532_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208604_2208976_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208982_2209834_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209854_2210466_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	2305595	2427105	3696747	integrase,transposase,tRNA,protease	Leptospira_phage(15.15%)	106	2337125:2337184	2358432:2358706
WP_101557807.1|2305595_2306758_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306870_2307839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307835_2308756_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308852_2313331_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313709_2318044_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318682_2319246_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319257_2319503_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319658_2320168_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320213_2321194_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321405_2323757_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323803_2324634_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324630_2325320_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325312_2326593_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326690_2327629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327610_2329317_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329394_2330498_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330550_2331300_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331306_2332821_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332833_2333121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333141_2334029_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334179_2334686_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334682_2335639_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335826_2337173_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2337125:2337184	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2337140_2337371_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337400_2337964_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338118_2338889_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338885_2339896_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340210_2340657_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340712_2340907_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340908_2341250_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341259_2343122_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343161_2343668_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343671_2343995_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343996_2344401_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344437_2345649_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345670_2346219_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346443_2346935_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347149_2349180_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349254_2350457_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350999_2351935_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352968_2353250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353336_2353510_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353621_2353966_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354037_2354706_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2356121_2357165_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357161_2357263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357354_2358474_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358724_2359378_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358432:2358706	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359493_2360714_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360764_2363194_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363359_2364658_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364762_2365416_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365418_2366729_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366956_2367496_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367974_2368241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368279_2368645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368526_2369537_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369533_2370304_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370389_2371049_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371016_2371508_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371617_2371821_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372138_2372459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372442_2372778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372832_2373045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373120_2373459_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373455_2373791_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373853_2375425_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376218_2376530_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376722_2377843_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377970_2378165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384246_2385408_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385793_2387257_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387389_2388940_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388936_2389086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389251_2390372_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391485_2392343_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392395_2392893_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2393013_2394429_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394438_2395623_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395619_2397218_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398400_2398646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2399056_2399242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399397_2400309_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400430_2401273_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401475_2402849_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403158_2404670_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404822_2405554_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405660_2406962_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406969_2407878_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407874_2408468_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408511_2408925_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408921_2409392_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409398_2410004_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411805_2413590_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413586_2414972_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414957_2415920_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415989_2416619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416656_2417865_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417986_2418556_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418687_2420241_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420544_2421765_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422172_2423075_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423071_2423941_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423937_2424789_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424785_2425610_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425884_2427105_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043129	Bordetella holmesii strain H719 chromosome, complete genome	3696747	2936563	3013622	3696747	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2939418:2939477	2988004:2988574
WP_005019978.1|2936563_2937343_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937365_2938313_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938314_2938515_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938849_2939969_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939418:2939477	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940290_2941007_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941003_2941897_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942060_2943281_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943433_2944516_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946195_2947179_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947241_2948654_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948771_2949614_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949892_2950501_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950516_2951137_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951202_2951910_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951914_2952637_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952623_2952914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952989_2954210_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954934_2955786_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955837_2957091_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957267_2958056_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958175_2959090_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959222_2961115_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961300_2962680_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963124_2963421_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967221_2967824_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967957_2968416_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968417_2969017_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969025_2969835_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969869_2970724_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970843_2971431_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971427_2972807_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973311_2973458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981129_2982470_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982483_2983335_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983346_2984612_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984673_2986578_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988552_2989407_-	hypothetical protein	NA	NA	NA	NA	NA
2988004:2988574	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989399_2990194_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990409_2991360_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991962_2992760_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992799_2993453_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993433_2994498_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994661_2996887_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997132_2998977_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999093_2999966_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000012_3001713_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001775_3002975_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002985_3003864_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003970_3005008_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005088_3005493_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005504_3006962_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007604_3008201_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008361_3008820_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009597_3010569_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010690_3011110_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012401_3013622_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
