The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	1095250	1202039	3693560	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095250_1096471_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096558_1097149_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097145_1097448_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097499_1098489_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098609_1099491_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099664_1100519_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100550_1101399_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101526_1102747_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102765_1103332_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103529_1104681_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104819_1105824_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105980_1106952_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107030_1107819_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107890_1108127_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108135_1109047_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109090_1110962_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111122_1111920_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112151_1112526_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112602_1112926_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113009_1113282_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113296_1113752_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113873_1114710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114706_1116080_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116156_1117113_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117200_1118178_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118302_1119958_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120006_1120471_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120467_1120929_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121154_1122342_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122338_1123643_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123639_1125049_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125242_1126362_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126497_1127517_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127525_1130231_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130370_1131024_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131086_1131449_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132015_1133476_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133738_1134812_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134896_1136117_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137874_1138995_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138968_1140468_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140481_1141585_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141589_1142840_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142836_1144282_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144278_1144593_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144594_1145713_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145895_1147116_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147215_1148082_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148142_1149123_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149269_1150190_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150198_1151311_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151392_1152214_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152289_1152898_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_032968989.1|1153035_1154412_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	5.5e-108
WP_005012704.1|1154473_1154917_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154983_1155640_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155682_1156802_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156971_1157253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157963_1158752_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158748_1159855_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160529_1161888_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162002_1162200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162217_1163338_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163431_1163986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164573_1165890_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165902_1166916_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167462_1168413_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168492_1168792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170152_1171811_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171959_1173180_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173297_1174581_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174584_1175526_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175635_1176094_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176474_1177095_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177502_1179923_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180030_1180768_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180814_1182059_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182381_1182654_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183237_1183966_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183987_1184905_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184904_1185414_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185530_1186202_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186311_1187379_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187398_1189243_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189379_1190567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190867_1191653_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191676_1192796_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192900_1194238_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194347_1195289_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195344_1196526_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196684_1196975_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197021_1197690_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197686_1197974_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198350_1199136_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199168_1199903_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200818_1202039_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	1206826	1263232	3693560	tRNA,transposase,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206826_1207777_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207858_1208338_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209549_1210749_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210894_1211272_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211295_1213077_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213085_1213823_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214107_1215667_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215726_1216485_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216581_1217238_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217391_1218156_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218170_1218350_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218375_1219410_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219406_1219820_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219816_1220401_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220753_1222112_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222205_1222784_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222908_1224029_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224101_1225358_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225461_1226667_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226730_1227180_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227312_1227558_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227782_1228097_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233350_1235456_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235509_1237819_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239172_1240840_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240842_1241508_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241640_1245447_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245672_1246818_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246936_1247866_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247862_1248939_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248935_1249742_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249738_1250470_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250846_1252085_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252132_1252471_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252718_1253669_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253987_1254170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254235_1255456_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255549_1256770_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256829_1257093_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257214_1258714_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258761_1259037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259134_1259332_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259347_1259707_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259779_1260802_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260814_1263232_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	1586770	1650799	3693560	transposase	Ralstonia_virus(10.53%)	58	NA	NA
WP_005011985.1|1586770_1587991_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588345_1588822_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589080_1589689_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589707_1590379_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590552_1592439_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592466_1593309_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593305_1594649_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594833_1595649_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595714_1597196_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597394_1599467_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599686_1600724_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601910_1602768_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602795_1603572_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_101557831.1|1606098_1607218_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1607219_1607963_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1607967_1608339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1608399_1608645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1608751_1610251_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1610872_1611208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1611466_1611598_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1611627_1612125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1612134_1612509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1612599_1613892_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1614008_1614908_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1615059_1615278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1615751_1617377_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1617612_1619136_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1619107_1619803_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1620143_1621205_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1621250_1621802_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1621808_1622729_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1622868_1625166_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1625221_1626442_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1626700_1627306_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1627316_1628477_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1628498_1629380_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1629676_1630375_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1630516_1631239_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1631357_1632296_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1632326_1633106_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1633092_1634316_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1634320_1635868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1635903_1636437_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1636680_1637376_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1637390_1637522_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1637569_1638694_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1638699_1641039_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1641035_1641443_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013586.1|1641704_1641965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1642187_1643138_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1643236_1644187_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1644236_1645445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1645666_1646206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1646430_1646835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1646899_1647655_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1647654_1649016_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1649012_1649636_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1649679_1650799_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 4
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	1655421	1778501	3693560	tRNA,integrase,holin,transposase	Leptospira_phage(20.83%)	116	1650734:1650793	1765126:1765204
1650734:1650793	attL	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCC	NA	NA	NA	NA
WP_025341429.1|1655421_1656429_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1656486_1656945_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1657018_1658365_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1658382_1658754_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1658753_1660223_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1660378_1661104_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1661117_1663832_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1664083_1665448_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1665487_1666546_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1666573_1667392_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1667429_1667708_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1668971_1669271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1669840_1671244_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1671256_1671907_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1672048_1673269_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1673299_1674376_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1674522_1675653_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1675839_1677465_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1677471_1678287_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1678301_1679372_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1679423_1680083_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1680722_1681885_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1681926_1682241_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1682224_1682611_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1682649_1682916_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1683308_1683998_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1684097_1684259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1684409_1684574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1684700_1684937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1685126_1685375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1685488_1686859_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013631.1|1686859_1687600_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1688100_1690053_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_076879490.1|1690073_1690622_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013634.1|1690787_1691744_+	glutathione synthase	NA	NA	NA	NA	NA
WP_005013635.1|1691757_1692156_+	PTS IIa component	NA	NA	NA	NA	NA
WP_005013636.1|1692218_1692488_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013637.1|1692516_1694292_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013638.1|1694339_1694549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013639.1|1694595_1695018_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005013640.1|1695137_1696115_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013641.1|1696183_1697347_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013642.1|1697515_1698403_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013643.1|1698413_1699055_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013644.1|1699051_1699723_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013645.1|1700595_1701045_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013647.1|1701086_1701545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013648.1|1701565_1702198_-	DedA family protein	NA	NA	NA	NA	NA
WP_005013649.1|1702307_1702775_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013650.1|1702796_1703339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013651.1|1703351_1704056_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013652.1|1704074_1704545_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019364.1|1704637_1705378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013654.1|1706557_1707769_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
WP_005013655.1|1707829_1708345_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005019367.1|1708347_1711209_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1711198_1712164_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1712920_1714396_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1714400_1714676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1715012_1716132_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1716006_1716255_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1716433_1717642_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1717638_1719921_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1719931_1722313_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1722576_1724484_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1724498_1725389_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1725395_1726529_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1726528_1727350_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1727374_1728565_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1728866_1729148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1729313_1729634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1729673_1730760_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1730956_1731217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1731709_1732480_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1732476_1733487_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1733521_1734364_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1734826_1735612_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1736471_1737591_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1738657_1739662_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1739737_1740550_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1740777_1742949_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1743002_1744322_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1744410_1745631_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1745849_1746710_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1746706_1747930_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1748228_1748726_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1748764_1749547_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1749572_1749791_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1749865_1750135_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1750354_1750819_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013685.1|1750892_1751174_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1751290_1752274_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013688.1|1752517_1753516_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013689.1|1753618_1754050_+	TonB family protein	NA	NA	NA	NA	NA
WP_005013690.1|1754114_1755026_+	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013691.1|1755158_1757240_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005019382.1|1757278_1757983_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013692.1|1758075_1758960_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013693.1|1759035_1759437_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013694.1|1759527_1759674_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013695.1|1759935_1760871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013696.1|1760952_1761606_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157933265.1|1762222_1762690_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013698.1|1762723_1763518_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005013699.1|1763534_1764515_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013700.1|1764687_1764900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153566129.1|1765018_1765192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013701.1|1765313_1767089_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1765126:1765204	attR	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAG	NA	NA	NA	NA
WP_005013702.1|1767104_1768769_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013703.1|1768781_1771493_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_153566130.1|1771726_1771867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013704.1|1772038_1773793_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005019390.1|1773789_1774416_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013706.1|1774412_1775267_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005013707.1|1775386_1777441_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012067.1|1777550_1778501_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	1791266	1840278	3693560	transposase	Ralstonia_virus(33.33%)	43	NA	NA
WP_005011985.1|1791266_1792487_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1792562_1793684_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1793721_1794435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1794445_1795666_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1795748_1796303_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1796448_1797399_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1797358_1797520_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1797560_1798487_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1798500_1799373_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1799535_1800483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1800821_1801403_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1801980_1802931_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1802910_1803663_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1803675_1804407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1804563_1806729_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1806818_1807088_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1807176_1807383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1807381_1807900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1807918_1808698_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1808865_1809882_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1809954_1810446_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1810456_1812172_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1813335_1814286_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1815937_1817179_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1817190_1817964_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1817990_1818941_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|1819039_1819822_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814013.1|1821863_1823249_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_005013750.1|1823267_1823873_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_005013751.1|1823869_1825726_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013752.1|1825722_1826523_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|1826537_1827731_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013754.1|1827798_1828773_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013755.1|1828895_1830119_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013756.1|1830229_1832434_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013757.1|1832728_1833358_+	MarC family protein	NA	NA	NA	NA	NA
WP_025341443.1|1833365_1833572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879523.1|1834812_1835553_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005013759.1|1835536_1836517_+	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_005013761.1|1836659_1837154_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013762.1|1837155_1838073_+	FecR family protein	NA	NA	NA	NA	NA
WP_005013763.1|1838152_1839337_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013764.1|1839327_1840278_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	2147155	2207278	3693560	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2147155_2147644_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2147636_2148485_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2148576_2149074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2149211_2149571_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2149567_2149849_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2149848_2150331_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2150332_2151961_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2151957_2152302_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2152303_2155246_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2155691_2156663_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2156652_2158035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2158177_2159128_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2159087_2160329_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2160325_2161447_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2162938_2163406_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2163476_2164127_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2164213_2165353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2165521_2166526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2166522_2167770_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2168122_2168989_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2168948_2170553_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2170564_2171251_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2171247_2172288_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2172403_2173075_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2173071_2174064_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2174060_2174999_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2174995_2176150_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2176158_2177610_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2177640_2178123_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2178124_2179018_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2179014_2179458_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2179470_2179845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2179987_2180386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2180512_2180800_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2180796_2181213_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2181388_2182021_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2182049_2182496_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2182782_2183934_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2184047_2185052_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2186035_2186743_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2186675_2188127_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2188132_2191291_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2191303_2191825_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2191814_2192639_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2192635_2193235_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2193343_2195200_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2195348_2196353_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2196561_2197824_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2197828_2198164_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2198160_2199090_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2199094_2199808_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2199911_2201369_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2201365_2201662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2201786_2203145_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2203245_2204046_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2204225_2205344_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2205416_2205788_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2205794_2206646_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2206666_2207278_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	2302401	2423912	3693560	tRNA,integrase,transposase,protease	Leptospira_phage(15.15%)	105	2333931:2333990	2355238:2355512
WP_101557807.1|2302401_2303564_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2303676_2304645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2304641_2305562_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005019672.1|2310515_2314850_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2315488_2316052_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2316063_2316309_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2316464_2316974_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2317019_2318000_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2318211_2320563_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2320609_2321440_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2321436_2322126_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2322118_2323399_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2323496_2324435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2324416_2326123_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2326200_2327304_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2327356_2328106_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2328112_2329627_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2329639_2329927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2329947_2330835_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2330985_2331492_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2331488_2332445_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2332632_2333979_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2333931:2333990	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2333946_2334177_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2334206_2334770_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2334924_2335695_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2335691_2336702_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2337016_2337463_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2337518_2337713_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2337714_2338056_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2338065_2339928_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2339967_2340474_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2340477_2340801_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2340802_2341207_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2341243_2342455_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2342476_2343025_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2343249_2343741_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2343955_2345986_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2346060_2347263_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2347805_2348741_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2349774_2350056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2350142_2350316_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2350427_2350772_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2350843_2351512_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2352927_2353971_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2353967_2354069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2354160_2355280_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2355530_2356184_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2355238:2355512	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2356299_2357520_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2357570_2360000_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2360165_2361464_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2361568_2362222_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2362224_2363535_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2363762_2364302_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2364780_2365047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2365085_2365451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2365332_2366343_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2366339_2367110_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2367195_2367855_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2367822_2368314_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2368423_2368627_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2368944_2369265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2369248_2369584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2369638_2369851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2369926_2370265_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2370261_2370597_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2370659_2372231_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2373024_2373336_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2373528_2374649_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2374776_2374971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2381053_2382215_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2382600_2384064_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2384196_2385747_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2385743_2385893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2386058_2387179_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2388292_2389150_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2389202_2389700_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2389820_2391236_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2391245_2392430_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2392426_2394025_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2395207_2395453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2395863_2396049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2396204_2397116_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2397237_2398080_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2398282_2399656_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2399965_2401477_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2401629_2402361_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2402467_2403769_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2403776_2404685_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2404681_2405275_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2405318_2405732_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2405728_2406199_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2406205_2406811_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2408612_2410397_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2410393_2411779_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2411764_2412727_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2412796_2413426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2413463_2414672_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2414793_2415363_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2415494_2417048_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2417351_2418572_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2418979_2419882_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2419878_2420748_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2420744_2421596_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2421592_2422417_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2422691_2423912_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043133	Bordetella holmesii strain H635 chromosome, complete genome	3693560	2933372	3010432	3693560	tRNA,integrase,transposase	Ralstonia_virus(21.43%)	56	2936227:2936286	2984814:2985384
WP_005019978.1|2933372_2934152_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2934174_2935122_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2935123_2935324_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2935658_2936778_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2936227:2936286	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2937099_2937816_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2937812_2938706_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2938869_2940090_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2940242_2941325_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2943004_2943988_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2944050_2945463_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2945580_2946423_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2946701_2947310_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2947325_2947946_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2948011_2948719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2948723_2949446_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2949432_2949723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2949798_2951019_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2951743_2952595_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2952646_2953900_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2954076_2954865_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2954984_2955899_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2956031_2957924_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2958109_2959489_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2959933_2960230_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2964030_2964633_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2964766_2965225_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2965226_2965826_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2965834_2966644_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2966678_2967533_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2967652_2968240_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2968236_2969616_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2970120_2970267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2977938_2979279_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2979292_2980144_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2980155_2981421_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2981482_2983387_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2985362_2986217_-	hypothetical protein	NA	NA	NA	NA	NA
2984814:2985384	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2986209_2987004_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2987219_2988170_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2988772_2989570_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2989609_2990263_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2990243_2991308_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2991471_2993697_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_032969100.1|2993942_2995787_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2995903_2996776_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2996822_2998523_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|2998585_2999785_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|2999795_3000674_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3000780_3001818_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3001898_3002303_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3002314_3003772_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3004414_3005011_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3005171_3005630_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3006407_3007379_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3007500_3007920_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3009211_3010432_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
