The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	1095277	1202066	3696560	transposase,protease,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095277_1096498_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096585_1097176_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097172_1097475_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097526_1098516_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098636_1099518_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099691_1100546_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100577_1101426_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101553_1102774_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102792_1103359_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103556_1104708_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104846_1105851_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106007_1106979_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107057_1107846_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107917_1108154_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108162_1109074_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109117_1110989_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111149_1111947_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112178_1112553_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112629_1112953_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113036_1113309_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113323_1113779_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113900_1114737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114733_1116107_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116183_1117140_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117227_1118205_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118329_1119985_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120033_1120498_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120494_1120956_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121181_1122369_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122365_1123670_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123666_1125076_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125269_1126389_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126524_1127544_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127552_1130258_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130397_1131051_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131113_1131476_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132042_1133503_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133765_1134839_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134923_1136144_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137901_1139022_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138995_1140495_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140508_1141612_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141616_1142867_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142863_1144309_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144305_1144620_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144621_1145740_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145922_1147143_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147242_1148109_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148169_1149150_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149296_1150217_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150225_1151338_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151419_1152241_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152316_1152925_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153062_1154439_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154500_1154944_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155010_1155667_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155709_1156829_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156998_1157280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157990_1158779_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158775_1159882_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160556_1161915_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162029_1162227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162244_1163365_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163458_1164013_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164600_1165917_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165929_1166943_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167489_1168440_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168519_1168819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170179_1171838_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171986_1173207_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173324_1174608_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174611_1175553_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175662_1176121_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176501_1177122_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177529_1179950_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180057_1180795_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180841_1182086_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182408_1182681_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183264_1183993_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184014_1184932_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184931_1185441_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185557_1186229_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186338_1187406_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187425_1189270_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189406_1190594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190894_1191680_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191703_1192823_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192927_1194265_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194374_1195316_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195371_1196553_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196711_1197002_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197048_1197717_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197713_1198001_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198377_1199163_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199195_1199930_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200845_1202066_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	1206853	1263259	3696560	transposase,protease,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206853_1207804_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207885_1208365_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209576_1210776_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210921_1211299_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211322_1213104_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213112_1213850_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214134_1215694_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215753_1216512_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216608_1217265_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217418_1218183_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218197_1218377_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218402_1219437_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219433_1219847_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219843_1220428_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220780_1222139_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222232_1222811_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222935_1224056_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224128_1225385_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225488_1226694_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226757_1227207_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227339_1227585_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227809_1228124_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233377_1235483_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235536_1237846_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239199_1240867_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240869_1241535_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241667_1245474_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245699_1246845_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246963_1247893_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247889_1248966_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248962_1249769_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249765_1250497_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250873_1252112_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252159_1252498_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252745_1253696_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254014_1254197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254262_1255483_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255576_1256797_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256856_1257120_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257241_1258741_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258788_1259064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259161_1259359_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259374_1259734_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259806_1260829_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260841_1263259_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	1586797	1693053	3696560	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1644072:1644088	1689738:1689754
WP_005011985.1|1586797_1588018_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588372_1588849_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589107_1589716_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589734_1590406_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590579_1592466_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592493_1593336_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593332_1594676_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594860_1595676_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595741_1597223_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597421_1599494_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599713_1600751_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601937_1602795_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602822_1603599_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604426_1604936_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606013_1606784_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606780_1607791_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607849_1608930_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609098_1610218_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610219_1610963_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610967_1611339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611399_1611645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611751_1613251_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613872_1614208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614466_1614598_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614627_1615125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615134_1615509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615599_1616892_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617008_1617908_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618059_1618278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618751_1620377_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620612_1622136_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622107_1622803_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623143_1624205_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624250_1624802_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624808_1625729_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625868_1628166_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628221_1629442_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629700_1630306_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630316_1631477_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631498_1632380_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632676_1633375_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633516_1634239_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634357_1635296_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635326_1636106_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636092_1637316_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637320_1638868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638903_1639437_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639680_1640376_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640390_1640522_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640569_1641694_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641699_1644039_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644035_1644443_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644072:1644088	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644704_1644965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645187_1646138_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646236_1647187_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647236_1648445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648666_1649206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649430_1649835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649899_1650655_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650654_1652016_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652012_1652636_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652679_1653799_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654451_1655207_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655383_1656178_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656174_1656612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656723_1656876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657296_1658265_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658421_1659429_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659486_1659945_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660018_1661365_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661382_1661754_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661753_1663223_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663378_1664104_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664117_1666832_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667083_1668448_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668487_1669546_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669573_1670392_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670429_1670708_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671971_1672271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672840_1674244_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674256_1674907_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675048_1676269_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676299_1677376_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677522_1678653_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678839_1680465_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680471_1681287_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681301_1682372_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682423_1683083_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683722_1684885_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684926_1685241_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685224_1685611_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685649_1685916_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686308_1686998_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687097_1687259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687409_1687574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687700_1687937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688126_1688375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688488_1689859_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689738:1689754	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689859_1690600_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691100_1693053_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	1711347	1755274	3696560	tRNA,integrase,holin,transposase	Leptospira_phage(33.33%)	37	1753842:1753856	1760318:1760332
WP_005019367.1|1711347_1714209_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714198_1715164_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715920_1717396_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717400_1717676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718012_1719132_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719006_1719255_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719433_1720642_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720638_1722921_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722931_1725313_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725576_1727484_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727498_1728389_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728395_1729529_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729528_1730350_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730374_1731565_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731866_1732148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732313_1732634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732673_1733760_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733956_1734217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734709_1735480_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735476_1736487_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_050597667.1|1736545_1737364_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
WP_005013673.1|1737826_1738612_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739471_1740591_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741657_1742662_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742737_1743550_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743777_1745949_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746002_1747322_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747410_1748631_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748849_1749710_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749706_1750930_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751228_1751726_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751764_1752547_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752572_1752791_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752865_1753135_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753354_1753819_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753842:1753856	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753892_1754174_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754290_1755274_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760318:1760332	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	1780550	1821941	3696560	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780550_1781501_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781497_1782013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782370_1782991_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783090_1783342_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783429_1784908_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784904_1788075_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788087_1789284_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789472_1790405_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790473_1791205_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791270_1791906_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791891_1793070_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793230_1793779_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793859_1794219_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794266_1795487_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795562_1796684_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796721_1797435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797445_1798666_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798748_1799303_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799448_1800399_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800358_1800520_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800560_1801487_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801500_1802373_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802535_1803483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803821_1804403_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804980_1805931_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805910_1806663_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806675_1807407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807563_1809729_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809818_1810088_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810176_1810383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810381_1810900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810918_1811698_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811865_1812882_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812954_1813446_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813456_1815172_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816335_1817286_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818937_1820179_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820190_1820964_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820990_1821941_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	2150155	2210278	3696560	tRNA,protease,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150155_2150644_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150636_2151485_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151576_2152074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152211_2152571_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152567_2152849_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152848_2153331_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153332_2154961_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154957_2155302_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155303_2158246_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158691_2159663_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159652_2161035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161177_2162128_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162087_2163329_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163325_2164447_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165938_2166406_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166476_2167127_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167213_2168353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168521_2169526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169522_2170770_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171122_2171989_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171948_2173553_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173564_2174251_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174247_2175288_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175403_2176075_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176071_2177064_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177060_2177999_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177995_2179150_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179158_2180610_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180640_2181123_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181124_2182018_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182014_2182458_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182470_2182845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182987_2183386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183512_2183800_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183796_2184213_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184388_2185021_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185049_2185496_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185782_2186934_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187047_2188052_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189035_2189743_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189675_2191127_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191132_2194291_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194303_2194825_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194814_2195639_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195635_2196235_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196343_2198200_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198348_2199353_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199561_2200824_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200828_2201164_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201160_2202090_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202094_2202808_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202911_2204369_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204365_2204662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204786_2206145_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206245_2207046_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207225_2208344_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208416_2208788_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208794_2209646_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209666_2210278_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	2305401	2426916	3696560	transposase,integrase,protease,tRNA	Leptospira_phage(15.15%)	106	2336931:2336990	2358238:2358512
WP_101557807.1|2305401_2306564_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306676_2307645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307641_2308562_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308658_2313137_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313515_2317850_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318488_2319052_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319063_2319309_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319464_2319974_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320019_2321000_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321211_2323563_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323609_2324440_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324436_2325126_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325118_2326399_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326496_2327435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327416_2329123_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329200_2330304_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330356_2331106_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331112_2332627_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332639_2332927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332947_2333835_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333985_2334492_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334488_2335445_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335632_2336979_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336931:2336990	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336946_2337177_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337206_2337770_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337924_2338695_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338691_2339702_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340016_2340463_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340518_2340713_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340714_2341056_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341065_2342928_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342967_2343474_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343477_2343801_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343802_2344207_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344243_2345455_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345476_2346025_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346249_2346741_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346955_2348986_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349060_2350263_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350805_2351741_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352774_2353056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353142_2353316_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353427_2353772_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353843_2354512_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355927_2356971_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356967_2357069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357160_2358280_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358530_2359184_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358238:2358512	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359299_2360520_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360570_2363000_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363165_2364464_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364568_2365222_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365224_2366535_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366762_2367302_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367780_2368047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368085_2368451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368332_2369343_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369339_2370110_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370195_2370855_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370822_2371314_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371423_2371627_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371944_2372265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372248_2372584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372638_2372851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372926_2373265_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373252_2373597_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373659_2375231_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376024_2376336_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376528_2377649_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377776_2377971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384057_2385219_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385604_2387068_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387200_2388751_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388747_2388897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389062_2390183_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391296_2392154_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392206_2392704_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392824_2394240_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394249_2395434_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395430_2397029_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398211_2398457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398867_2399053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399208_2400120_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400241_2401084_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401286_2402660_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402969_2404481_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404633_2405365_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405471_2406773_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406780_2407689_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407685_2408279_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408322_2408736_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408732_2409203_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409209_2409815_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411616_2413401_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413397_2414783_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414768_2415731_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415800_2416430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416467_2417676_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417797_2418367_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418498_2420052_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420355_2421576_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421983_2422886_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422882_2423752_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423748_2424600_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424596_2425421_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425695_2426916_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043135	Bordetella holmesii strain H628 chromosome, complete genome	3696560	2936376	3013436	3696560	tRNA,integrase,transposase	Ralstonia_virus(21.43%)	56	2939231:2939290	2987818:2988388
WP_005019978.1|2936376_2937156_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937178_2938126_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938127_2938328_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938662_2939782_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939231:2939290	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940103_2940820_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940816_2941710_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941873_2943094_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943246_2944329_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946008_2946992_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947054_2948467_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948584_2949427_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949705_2950314_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950329_2950950_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951015_2951723_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951727_2952450_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952436_2952727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952802_2954023_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954747_2955599_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955650_2956904_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957080_2957869_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957988_2958903_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959035_2960928_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961113_2962493_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962937_2963234_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967034_2967637_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967770_2968229_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968230_2968830_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968838_2969648_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969682_2970537_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970656_2971244_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971240_2972620_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973124_2973271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162007580.1|2980942_2982283_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	3.8e-45
WP_005015796.1|2982296_2983148_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983159_2984425_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984486_2986391_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988366_2989221_-	hypothetical protein	NA	NA	NA	NA	NA
2987818:2988388	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989213_2990008_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990223_2991174_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991776_2992574_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992613_2993267_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993247_2994312_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994475_2996701_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996946_2998791_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998907_2999780_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999826_3001527_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001589_3002789_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002799_3003678_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003784_3004822_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004902_3005307_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005318_3006776_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007418_3008015_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008175_3008634_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009411_3010383_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010504_3010924_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012215_3013436_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
