The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	631758	692877	3696864	tRNA,transposase	Ralstonia_virus(36.36%)	51	NA	NA
WP_005012861.1|631758_632979_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018655.1|635988_636723_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|636891_638112_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|638486_639473_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|639476_642200_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|642200_643328_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018665.1|643340_644753_+	TolC family protein	NA	NA	NA	NA	NA
WP_005018670.1|644927_645584_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005018673.1|645604_646651_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|646647_648237_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|648172_648682_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|648607_649501_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|649490_650387_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_005020419.1|650433_651066_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005018686.1|651090_651975_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005018689.1|652102_653584_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|653656_654001_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|654086_654551_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|655714_657829_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|657861_658659_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|658870_659821_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005018702.1|659853_660300_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005018704.1|660348_661038_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018707.1|661125_661620_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018709.1|661651_662968_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018710.1|662984_663905_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_005018713.1|663939_664401_-	protein TolR	NA	NA	NA	NA	NA
WP_005018715.1|664400_665075_-	protein TolQ	NA	NA	NA	NA	NA
WP_005018717.1|665077_665500_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018720.1|665553_667284_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018723.1|667349_667919_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018726.1|667899_668586_+	response regulator	NA	NA	NA	NA	NA
WP_005018729.1|668605_670111_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018732.1|670339_670789_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018735.1|670794_672315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|672368_673589_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018738.1|673685_674615_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005018740.1|674773_675679_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005011985.1|675878_677099_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018744.1|677154_678660_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_005018747.1|678681_679137_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018750.1|679493_680066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018752.1|680065_680377_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005018754.1|680690_681452_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_005018757.1|681420_682215_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_005018762.1|682393_682729_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005018764.1|682745_683303_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005018766.1|683364_684477_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005018783.1|684617_685094_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011899.1|691435_691630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|691757_692877_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 2
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	1095579	1202368	3696864	protease,tRNA,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095579_1096800_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096887_1097478_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097474_1097777_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097828_1098818_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098938_1099820_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099993_1100848_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100879_1101728_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101855_1103076_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1103094_1103661_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103858_1105010_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1105148_1106153_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106309_1107281_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107359_1108148_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1108219_1108456_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108464_1109376_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109419_1111291_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111451_1112249_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112480_1112855_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112931_1113255_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113338_1113611_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113625_1114081_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1114202_1115039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1115035_1116409_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116485_1117442_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117529_1118507_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118631_1120287_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120335_1120800_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120796_1121258_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121483_1122671_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122667_1123972_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123968_1125378_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125571_1126691_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126826_1127846_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127854_1130560_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130699_1131353_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131415_1131778_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132344_1133805_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1134067_1135141_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1135225_1136446_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1138203_1139324_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139297_1140797_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140810_1141914_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141918_1143169_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1143165_1144611_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144607_1144922_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144923_1146042_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1146224_1147445_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147544_1148411_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148471_1149452_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149598_1150519_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150527_1151640_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151721_1152543_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152618_1153227_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153364_1154741_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154802_1155246_+	cytochrome c	NA	NA	NA	NA	NA
WP_153567850.1|1155312_1155969_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1156011_1157131_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157300_1157582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158292_1159081_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1159077_1160184_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160858_1162217_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162331_1162529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162546_1163667_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163760_1164315_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164902_1166219_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1166231_1167245_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167791_1168742_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168821_1169121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170481_1172140_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172288_1173509_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173626_1174910_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174913_1175855_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175964_1176423_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176803_1177424_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177831_1180252_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180359_1181097_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181143_1182388_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182710_1182983_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183566_1184295_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184316_1185234_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1185233_1185743_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185859_1186531_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186640_1187708_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187727_1189572_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189708_1190896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191196_1191982_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192005_1193125_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193229_1194567_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194676_1195618_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195673_1196855_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197013_1197304_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197350_1198019_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198015_1198303_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198679_1199465_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199497_1200232_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201147_1202368_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	1207155	1263561	3696864	protease,tRNA,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207155_1208106_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208187_1208667_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209878_1211078_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211223_1211601_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211624_1213406_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213414_1214152_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214436_1215996_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216055_1216814_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216910_1217567_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217720_1218485_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218499_1218679_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218704_1219739_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219735_1220149_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220145_1220730_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221082_1222441_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222534_1223113_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223237_1224358_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224430_1225687_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225790_1226996_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227059_1227509_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227641_1227887_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228111_1228426_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233679_1235785_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235838_1238148_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239501_1241169_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241171_1241837_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241969_1245776_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246001_1247147_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1247265_1248195_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248191_1249268_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1249264_1250071_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250067_1250799_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251175_1252414_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252461_1252800_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1253047_1253998_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254316_1254499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254564_1255785_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255878_1257099_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257158_1257422_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257543_1259043_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259090_1259366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259463_1259661_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259676_1260036_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260108_1261131_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261143_1263561_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	1587099	1693351	3696864	tRNA,transposase,integrase	Leptospira_phage(14.29%)	100	1644374:1644390	1690040:1690056
WP_005011985.1|1587099_1588320_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588674_1589151_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589409_1590018_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1590036_1590708_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590881_1592768_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592795_1593638_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593634_1594978_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1595162_1595978_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1596043_1597525_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597723_1599796_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1600015_1601053_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1602239_1603097_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1603124_1603901_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604728_1605238_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606315_1607086_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1607082_1608093_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1608151_1609232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609400_1610520_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610521_1611265_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1611269_1611641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611701_1611947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1612053_1613553_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1614174_1614510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614768_1614900_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614929_1615427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615436_1615811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615901_1617194_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617310_1618210_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618361_1618580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1619053_1620679_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620914_1622438_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622409_1623105_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623445_1624507_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624552_1625104_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1625110_1626031_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1626170_1628468_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628523_1629744_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1630002_1630608_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630618_1631779_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631800_1632682_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632978_1633677_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633818_1634541_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634659_1635598_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635628_1636408_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636394_1637618_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637622_1639170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1639205_1639739_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639982_1640678_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640692_1640824_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640871_1641996_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1642001_1644341_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644337_1644745_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644374:1644390	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1645006_1645267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645489_1646440_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646538_1647489_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647538_1648747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648968_1649508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649732_1650137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1650201_1650957_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650956_1652318_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652314_1652938_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652981_1654101_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654753_1655509_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655685_1656480_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656476_1656914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1657025_1657178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657598_1658567_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658723_1659731_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659788_1660247_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660320_1661667_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661684_1662056_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1662055_1663525_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663680_1664406_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664419_1667134_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667385_1668750_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668789_1669848_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669875_1670694_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670731_1671010_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1672273_1672573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1673142_1674546_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674558_1675209_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675350_1676571_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676601_1677678_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677824_1678955_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1679141_1680767_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680773_1681589_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681603_1682674_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682725_1683385_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1684024_1685187_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1685228_1685543_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685526_1685913_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685951_1686218_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686610_1687300_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687399_1687561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687711_1687876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1688002_1688239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688428_1688677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688790_1690161_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1690040:1690056	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1690161_1690902_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691398_1693351_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	1711645	1755572	3696864	integrase,tRNA,transposase,holin	Leptospira_phage(33.33%)	37	1754140:1754154	1760616:1760630
WP_005019367.1|1711645_1714507_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714496_1715462_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1716218_1717694_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717698_1717974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718310_1719430_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719304_1719553_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719731_1720940_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720936_1723219_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1723229_1725611_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725874_1727782_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727796_1728687_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728693_1729827_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729826_1730648_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730672_1731863_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1732164_1732446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732611_1732932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732971_1734058_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1734254_1734515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1735007_1735778_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735774_1736785_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736819_1737662_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1738124_1738910_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739769_1740889_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741955_1742960_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1743035_1743848_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1744075_1746247_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746300_1747620_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747708_1748929_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749147_1750008_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1750004_1751228_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751526_1752024_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1752062_1752845_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752870_1753089_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753163_1753433_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753652_1754117_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754140:1754154	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754190_1754472_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754588_1755572_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760616:1760630	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	1780848	1822239	3696864	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780848_1781799_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781795_1782311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782668_1783289_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783388_1783640_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783727_1785206_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1785202_1788373_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788385_1789582_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789770_1790703_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790771_1791503_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791568_1792204_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792189_1793368_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793528_1794077_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794157_1794517_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794564_1795785_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795860_1796982_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1797019_1797733_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797743_1798964_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1799046_1799601_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799746_1800697_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800656_1800818_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800858_1801785_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801798_1802671_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802833_1803781_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804119_1804701_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805278_1806229_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1806208_1806961_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806973_1807705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807861_1810027_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810116_1810386_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810474_1810681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810679_1811198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1811216_1811996_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812163_1813180_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1813252_1813744_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813754_1815470_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816633_1817584_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1819235_1820477_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820488_1821262_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821288_1822239_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	2150452	2210575	3696864	protease,tRNA,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150452_2150941_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150933_2151782_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151873_2152371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152508_2152868_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152864_2153146_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2153145_2153628_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153629_2155258_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155254_2155599_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155600_2158543_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158988_2159960_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159949_2161332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161474_2162425_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162384_2163626_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163622_2164744_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2166235_2166703_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166773_2167424_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167510_2168650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168818_2169823_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169819_2171067_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171419_2172286_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2172245_2173850_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173861_2174548_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174544_2175585_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175700_2176372_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176368_2177361_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177357_2178296_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178292_2179447_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179455_2180907_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180937_2181420_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181421_2182315_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182311_2182755_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182767_2183142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183284_2183683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183809_2184097_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2184093_2184510_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184685_2185318_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185346_2185793_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2186079_2187231_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187344_2188349_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189332_2190040_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189972_2191424_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191429_2194588_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194600_2195122_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2195111_2195936_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195932_2196532_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196640_2198497_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198645_2199650_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199858_2201121_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2201125_2201461_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201457_2202387_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202391_2203105_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2203208_2204666_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204662_2204959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2205083_2206442_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206542_2207343_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207522_2208641_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208713_2209085_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2209091_2209943_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209963_2210575_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	2305704	2427217	3696864	protease,tRNA,transposase,integrase	Leptospira_phage(12.5%)	105	2297064:2297080	2365636:2365652
2297064:2297080	attL	TCGGCGCGGCGCTGGCG	NA	NA	NA	NA
WP_101557807.1|2305704_2306867_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306979_2307948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307944_2308865_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308961_2313440_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313818_2318153_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318791_2319355_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319366_2319612_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319767_2320277_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320322_2321303_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321514_2323866_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323912_2324743_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324739_2325429_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325421_2326702_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326799_2327738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327719_2329426_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329503_2330607_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330659_2331409_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331415_2332930_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332942_2333230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333250_2334138_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334288_2334795_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334791_2335748_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335935_2337282_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341181.1|2337249_2337480_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337509_2338073_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338227_2338998_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338994_2340005_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340319_2340766_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340821_2341016_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2341017_2341359_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341368_2343231_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343270_2343777_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343780_2344104_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2344105_2344510_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344546_2345758_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345779_2346328_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346552_2347044_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347258_2349289_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349363_2350566_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2351108_2352044_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2353077_2353359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353445_2353619_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353730_2354075_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354146_2354815_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2356230_2357274_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357270_2357372_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014574.1|2358835_2359489_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_032974133.1|2359604_2360825_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360875_2363305_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363470_2364769_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364873_2365527_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365529_2366840_-	trigger factor	NA	NA	NA	NA	NA
2365636:2365652	attR	TCGGCGCGGCGCTGGCG	NA	NA	NA	NA
WP_005014595.1|2367067_2367607_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2368085_2368352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368390_2368756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368637_2369648_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369644_2370415_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370500_2371160_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371127_2371619_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371728_2371932_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372249_2372570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372553_2372889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372943_2373156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373231_2373570_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373566_2373902_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373964_2375536_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376329_2376641_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376833_2377954_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2378081_2378276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384358_2385520_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385905_2387369_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387501_2389052_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2389048_2389198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389363_2390484_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391597_2392455_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392507_2393005_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2393125_2394541_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394550_2395735_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395731_2397330_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398512_2398758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2399168_2399354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399509_2400421_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400542_2401385_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401587_2402961_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403270_2404782_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404934_2405666_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405772_2407074_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2407081_2407990_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407986_2408580_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408623_2409037_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2409033_2409504_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409510_2410116_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411917_2413702_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413698_2415084_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2415069_2416032_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2416101_2416731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416768_2417977_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2418098_2418668_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418799_2420353_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420656_2421877_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422284_2423187_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423183_2424053_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2424049_2424901_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424897_2425722_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425996_2427217_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043137	Bordetella holmesii strain H619 chromosome, complete genome	3696864	2936677	3013737	3696864	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2939532:2939591	2988119:2988689
WP_005019978.1|2936677_2937457_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937479_2938427_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938428_2938629_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938963_2940083_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939532:2939591	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940404_2941121_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941117_2942011_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942174_2943395_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943547_2944630_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946309_2947293_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947355_2948768_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948885_2949728_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2950006_2950615_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950630_2951251_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951316_2952024_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2952028_2952751_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952737_2953028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953103_2954324_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2955048_2955900_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955951_2957205_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957381_2958170_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958289_2959204_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959336_2961229_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961414_2962794_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963238_2963535_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967335_2967938_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968071_2968530_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968531_2969131_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969139_2969949_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969983_2970838_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970957_2971545_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971541_2972921_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973425_2973572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981243_2982584_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982597_2983449_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983460_2984726_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984787_2986692_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988667_2989522_-	hypothetical protein	NA	NA	NA	NA	NA
2988119:2988689	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989514_2990309_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990524_2991475_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992077_2992875_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992914_2993568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993548_2994613_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994776_2997002_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997247_2999092_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999208_3000081_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000127_3001828_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001890_3003090_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003100_3003979_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004085_3005123_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005203_3005608_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005619_3007077_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007719_3008316_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008476_3008935_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009712_3010684_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010805_3011225_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012516_3013737_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
