The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	1095327	1202116	3696668	protease,transposase,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095327_1096548_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096635_1097226_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097222_1097525_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097576_1098566_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098686_1099568_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099741_1100596_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100627_1101476_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101603_1102824_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102842_1103409_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103606_1104758_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104896_1105901_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106057_1107029_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107107_1107896_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107967_1108204_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108212_1109124_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109167_1111039_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111199_1111997_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112228_1112603_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112679_1113003_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113086_1113359_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113373_1113829_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113950_1114787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114783_1116157_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116233_1117190_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117277_1118255_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118379_1120035_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120083_1120548_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120544_1121006_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121231_1122419_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122415_1123720_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123716_1125126_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125319_1126439_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126574_1127594_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127602_1130308_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130447_1131101_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131163_1131526_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132092_1133553_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133815_1134889_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134973_1136194_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137951_1139072_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139045_1140545_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140558_1141662_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141666_1142917_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142913_1144359_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144355_1144670_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144671_1145790_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145972_1147193_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147292_1148159_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148219_1149200_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149346_1150267_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150275_1151388_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151469_1152291_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152366_1152975_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153112_1154489_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154550_1154994_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155060_1155717_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155759_1156879_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157048_1157330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158040_1158829_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158825_1159932_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160606_1161965_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162079_1162277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162294_1163415_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163508_1164063_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164650_1165967_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165979_1166993_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167539_1168490_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168569_1168869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170229_1171888_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172036_1173257_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173374_1174658_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174661_1175603_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175712_1176171_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176551_1177172_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177579_1180000_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180107_1180845_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180891_1182136_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182458_1182731_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183314_1184043_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184064_1184982_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184981_1185491_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185607_1186279_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186388_1187456_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187475_1189320_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189456_1190644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190944_1191730_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191753_1192873_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192977_1194315_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194424_1195366_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195421_1196603_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196761_1197052_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197098_1197767_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197763_1198051_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198427_1199213_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199245_1199980_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200895_1202116_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	1206903	1263309	3696668	protease,transposase,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206903_1207854_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207935_1208415_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209626_1210826_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210971_1211349_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211372_1213154_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213162_1213900_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214184_1215744_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215803_1216562_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216658_1217315_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217468_1218233_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218247_1218427_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218452_1219487_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219483_1219897_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219893_1220478_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220830_1222189_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222282_1222861_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222985_1224106_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224178_1225435_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225538_1226744_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226807_1227257_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227389_1227635_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227859_1228174_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233427_1235533_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235586_1237896_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239249_1240917_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240919_1241585_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241717_1245524_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245749_1246895_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1247013_1247943_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247939_1249016_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1249012_1249819_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249815_1250547_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250923_1252162_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252209_1252548_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252795_1253746_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254064_1254247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254312_1255533_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255626_1256847_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256906_1257170_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257291_1258791_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258838_1259114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259211_1259409_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259424_1259784_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259856_1260879_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260891_1263309_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	1586846	1693102	3696668	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1644121:1644137	1689787:1689803
WP_005011985.1|1586846_1588067_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588421_1588898_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589156_1589765_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589783_1590455_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590628_1592515_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592542_1593385_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593381_1594725_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594909_1595725_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595790_1597272_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597470_1599543_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599762_1600800_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601986_1602844_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602871_1603648_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604475_1604985_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606062_1606833_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606829_1607840_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607898_1608979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609147_1610267_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610268_1611012_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1611016_1611388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611448_1611694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611800_1613300_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613921_1614257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614515_1614647_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614676_1615174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615183_1615558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615648_1616941_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617057_1617957_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618108_1618327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618800_1620426_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620661_1622185_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622156_1622852_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623192_1624254_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624299_1624851_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624857_1625778_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625917_1628215_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628270_1629491_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629749_1630355_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630365_1631526_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631547_1632429_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632725_1633424_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633565_1634288_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634406_1635345_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635375_1636155_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636141_1637365_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637369_1638917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638952_1639486_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639729_1640425_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640439_1640571_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640618_1641743_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641748_1644088_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644084_1644492_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644121:1644137	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644753_1645014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645236_1646187_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646285_1647236_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647285_1648494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648715_1649255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649479_1649884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649948_1650704_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650703_1652065_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652061_1652685_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652728_1653848_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654500_1655256_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655432_1656227_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656223_1656661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656772_1656925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657345_1658314_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658470_1659478_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659535_1659994_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660067_1661414_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661431_1661803_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661802_1663272_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663427_1664153_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664166_1666881_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667132_1668497_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668536_1669595_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669622_1670441_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670478_1670757_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1672020_1672320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672889_1674293_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674305_1674956_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675097_1676318_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676348_1677425_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677571_1678702_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678888_1680514_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680520_1681336_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681350_1682421_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682472_1683132_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683771_1684934_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684975_1685290_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685273_1685660_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685698_1685965_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686357_1687047_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687146_1687308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687458_1687623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687749_1687986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688175_1688424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688537_1689908_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689787:1689803	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689908_1690649_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691149_1693102_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	1711396	1755323	3696668	holin,transposase,integrase,tRNA	Leptospira_phage(33.33%)	37	1753891:1753905	1760367:1760381
WP_005019367.1|1711396_1714258_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714247_1715213_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715969_1717445_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717449_1717725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718061_1719181_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719055_1719304_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719482_1720691_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720687_1722970_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722980_1725362_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725625_1727533_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727547_1728438_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728444_1729578_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729577_1730399_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730423_1731614_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731915_1732197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732362_1732683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732722_1733809_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1734005_1734266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734758_1735529_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735525_1736536_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736570_1737413_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737875_1738661_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739520_1740640_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741706_1742711_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742786_1743599_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743826_1745998_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746051_1747371_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747459_1748680_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748898_1749759_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749755_1750979_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751277_1751775_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751813_1752596_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752621_1752840_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752914_1753184_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753403_1753868_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753891:1753905	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753941_1754223_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754339_1755323_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760367:1760381	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	1780599	1821990	3696668	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780599_1781550_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781546_1782062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782419_1783040_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783139_1783391_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783478_1784957_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784953_1788124_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788136_1789333_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789521_1790454_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790522_1791254_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791319_1791955_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791940_1793119_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793279_1793828_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793908_1794268_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794315_1795536_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795611_1796733_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796770_1797484_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797494_1798715_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798797_1799352_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799497_1800448_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800407_1800569_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800609_1801536_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801549_1802422_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802584_1803532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803870_1804452_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805029_1805980_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805959_1806712_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806724_1807456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807612_1809778_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809867_1810137_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810225_1810432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810430_1810949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810967_1811747_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811914_1812931_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1813003_1813495_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813505_1815221_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816384_1817335_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818986_1820228_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820239_1821013_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821039_1821990_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	2150204	2210327	3696668	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150204_2150693_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150685_2151534_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151625_2152123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152260_2152620_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152616_2152898_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152897_2153380_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153381_2155010_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155006_2155351_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155352_2158295_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158740_2159712_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159701_2161084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161226_2162177_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162136_2163378_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163374_2164496_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165987_2166455_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166525_2167176_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167262_2168402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168570_2169575_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169571_2170819_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171171_2172038_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171997_2173602_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173613_2174300_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174296_2175337_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175452_2176124_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176120_2177113_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177109_2178048_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178044_2179199_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179207_2180659_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180689_2181172_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181173_2182067_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182063_2182507_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182519_2182894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183036_2183435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183561_2183849_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183845_2184262_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184437_2185070_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185098_2185545_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185831_2186983_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187096_2188101_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189084_2189792_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189724_2191176_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191181_2194340_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194352_2194874_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194863_2195688_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195684_2196284_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196392_2198249_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198397_2199402_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199610_2200873_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200877_2201213_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201209_2202139_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202143_2202857_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202960_2204418_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204414_2204711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204835_2206194_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206294_2207095_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207274_2208393_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208465_2208837_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208843_2209695_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209715_2210327_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	2305456	2426967	3696668	protease,transposase,integrase,tRNA	Leptospira_phage(15.15%)	106	2336986:2337045	2358293:2358567
WP_101557807.1|2305456_2306619_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306731_2307700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307696_2308617_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308713_2313192_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313570_2317905_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318543_2319107_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319118_2319364_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319519_2320029_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320074_2321055_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321266_2323618_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323664_2324495_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324491_2325181_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325173_2326454_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326551_2327490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327471_2329178_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329255_2330359_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330411_2331161_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331167_2332682_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332694_2332982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333002_2333890_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334040_2334547_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334543_2335500_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335687_2337034_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336986:2337045	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2337001_2337232_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337261_2337825_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337979_2338750_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338746_2339757_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340071_2340518_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340573_2340768_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340769_2341111_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341120_2342983_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343022_2343529_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343532_2343856_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343857_2344262_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344298_2345510_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345531_2346080_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346304_2346796_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347010_2349041_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349115_2350318_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350860_2351796_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352829_2353111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353197_2353371_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353482_2353827_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353898_2354567_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355982_2357026_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357022_2357124_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357215_2358335_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358585_2359239_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358293:2358567	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359354_2360575_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360625_2363055_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363220_2364519_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364623_2365277_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365279_2366590_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366817_2367357_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367835_2368102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368140_2368506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368387_2369398_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369394_2370165_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370250_2370910_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370877_2371369_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371478_2371682_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371999_2372320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372303_2372639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372693_2372906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372981_2373320_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373307_2373652_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373714_2375286_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376079_2376391_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376583_2377704_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377831_2378026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384108_2385270_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385655_2387119_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387251_2388802_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388798_2388948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389113_2390234_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391347_2392205_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392257_2392755_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392875_2394291_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394300_2395485_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395481_2397080_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398262_2398508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398918_2399104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399259_2400171_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400292_2401135_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401337_2402711_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403020_2404532_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404684_2405416_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405522_2406824_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406831_2407740_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407736_2408330_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408373_2408787_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408783_2409254_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409260_2409866_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411667_2413452_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413448_2414834_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414819_2415782_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415851_2416481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416518_2417727_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417848_2418418_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418549_2420103_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420406_2421627_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422034_2422937_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422933_2423803_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423799_2424651_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424647_2425472_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425746_2426967_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043136	Bordetella holmesii strain H620 chromosome, complete genome	3696668	2936426	3013486	3696668	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2939281:2939340	2987868:2988438
WP_005019978.1|2936426_2937206_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937228_2938176_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938177_2938378_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938712_2939832_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939281:2939340	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940153_2940870_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940866_2941760_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941923_2943144_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943296_2944379_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946058_2947042_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947104_2948517_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948634_2949477_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949755_2950364_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950379_2951000_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951065_2951773_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951777_2952500_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952486_2952777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952852_2954073_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954797_2955649_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955700_2956954_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957130_2957919_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958038_2958953_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959085_2960978_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961163_2962543_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962987_2963284_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967084_2967687_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967820_2968279_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968280_2968880_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968888_2969698_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969732_2970587_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970706_2971294_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971290_2972670_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973174_2973321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980992_2982333_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982346_2983198_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983209_2984475_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984536_2986441_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988416_2989271_-	hypothetical protein	NA	NA	NA	NA	NA
2987868:2988438	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989263_2990058_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990273_2991224_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991826_2992624_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992663_2993317_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993297_2994362_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994525_2996751_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996996_2998841_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998957_2999830_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999876_3001577_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001639_3002839_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002849_3003728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003834_3004872_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004952_3005357_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005368_3006826_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007468_3008065_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008225_3008684_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009461_3010433_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010554_3010974_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012265_3013486_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
