The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	631737	708150	3696562	integrase,transposase	Ralstonia_virus(23.53%)	55	661636:661695	710223:710793
WP_005012861.1|631737_632958_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018655.1|635967_636702_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|636870_638091_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|638465_639452_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|639455_642179_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|642179_643307_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018665.1|643319_644732_+	TolC family protein	NA	NA	NA	NA	NA
WP_005018670.1|644906_645563_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005018673.1|645583_646630_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|646626_648216_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|648151_648661_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|648586_649480_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|649469_650366_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_005020419.1|650412_651045_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005018686.1|651069_651954_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005018689.1|652081_653563_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|653635_653980_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|654065_654530_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|655693_657808_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|657840_658638_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005015810.1|658849_659800_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015806.1|660015_660810_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015804.1|660802_661657_+	hypothetical protein	NA	NA	NA	NA	NA
661636:661695	attL	GCTGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTC	NA	NA	NA	NA
WP_005015801.1|663632_665537_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015799.1|665598_666864_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015796.1|666875_667727_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015794.1|667740_669081_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_153566140.1|676752_676899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015791.1|677403_678783_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_005015790.1|678779_679367_-	HutD family protein	NA	NA	NA	NA	NA
WP_005015786.1|679486_680341_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015783.1|680375_681185_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015780.1|681193_681793_+	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015778.1|681794_682253_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015774.1|682386_682989_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015771.1|683115_683304_+	AsmA family protein	NA	NA	NA	NA	NA
WP_080691268.1|683367_685200_+	AsmA family protein	NA	NA	NA	NA	NA
WP_076879504.1|686789_687086_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017685928.1|687530_688910_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_005015758.1|689095_690988_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_005015757.1|691120_692035_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015755.1|692154_692943_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015753.1|693119_694373_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025341216.1|694424_695276_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005020013.1|696000_697221_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_005015745.1|697296_697587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015743.1|697573_698296_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015741.1|698300_699008_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015738.1|699073_699694_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015735.1|699709_700318_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015721.1|700596_701439_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015719.1|701556_702969_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015717.1|703031_704015_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015716.1|705694_706777_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005011985.1|706929_708150_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
710223:710793	attR	GCTGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTGATGAGCCTGCACGAATTGCGCCGGCGTTAAATATCCGAGCGCGCTGTGAGGCCGATCGGTGTTGTACTCGACTCGCCAGTTTTCGATCAAGCTTTTAGCCTGTCGCAGGGACAAGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAAACTTTCGATATAAGCGTTCTCCACCGGCTTACCCGGCCGAATAAACGACAGCTTTACGCCTGCTTGGTAGGCCCAGGCGTCCAAGGCTCTTCCGGCGAACTCTGGCCCGTTGTCCACGGTAATAGATCGCGGCAGGCCACGCATCTCCGCCAGCCGTTGCAGCACCATGGCAACACGCAGTCCCGGCAACGACGTATCGACCTCGATGGCCAGGCATTCGCGAGTGTAGTCATCGACGATAGTCAAACAGCGGAATCGGCGGCCATAGGCTAGGCCGTCGGCCACAAAGTCCATTGACCAACTCTGATTCGGCGCGATTGCCGCTGGGCGAACCACGCGCTCGGTC	NA	NA	NA	NA
>prophage 2
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	1210059	1318905	3696562	integrase,tRNA,transposase,protease	Leptospira_phage(15.62%)	99	1291721:1291780	1313028:1313303
WP_005014796.1|1210059_1211517_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
WP_005014794.1|1211527_1212172_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_005014792.1|1212205_1213171_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_005014790.1|1213188_1214238_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005019734.1|1214322_1215582_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005014784.1|1215833_1216304_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005014781.1|1216405_1217812_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
WP_005014780.1|1217827_1219921_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
WP_005014779.1|1219920_1220583_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014777.1|1220599_1222960_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_005011985.1|1223105_1224326_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014769.1|1224600_1225425_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014767.1|1225421_1226273_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014766.1|1226269_1227139_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014765.1|1227135_1228038_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1228445_1229666_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014763.1|1229969_1231523_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014760.1|1231654_1232224_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014759.1|1232345_1233554_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014755.1|1233591_1234221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014754.1|1234290_1235253_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014753.1|1235238_1236624_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014750.1|1236620_1238405_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014748.1|1240206_1240812_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014747.1|1240818_1241289_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014744.1|1241285_1241699_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014741.1|1241742_1242336_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014740.1|1242332_1243241_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014730.1|1243248_1244550_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014728.1|1244656_1245388_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014726.1|1245540_1247052_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014723.1|1247361_1248735_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014721.1|1248937_1249780_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014720.1|1249901_1250813_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014716.1|1250968_1251154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014714.1|1251564_1251810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014709.1|1252992_1254591_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014706.1|1254587_1255772_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014705.1|1255781_1257197_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014704.1|1257317_1257815_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014703.1|1257867_1258725_-	DMT family transporter	NA	NA	NA	NA	NA
WP_101557770.1|1259838_1260958_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_017685964.1|1261124_1261274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014698.1|1261270_1262821_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_005019713.1|1262953_1264417_-	ribonuclease G	NA	NA	NA	NA	NA
WP_101557807.1|1264801_1265964_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005011899.1|1272046_1272241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1272368_1273488_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014621.1|1273681_1273993_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005014618.1|1274786_1276358_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014613.1|1276420_1276756_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014610.1|1276752_1277091_-	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014607.1|1277166_1277379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|1277433_1277769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014600.1|1277752_1278073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014599.1|1278390_1278594_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014598.1|1278703_1279195_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_050427733.1|1279162_1279822_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005013542.1|1279907_1280678_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341473.1|1280674_1281685_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_135238891.1|1281566_1281932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557809.1|1281970_1282237_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014595.1|1282715_1283255_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_005014590.1|1283482_1284793_+	trigger factor	NA	NA	NA	NA	NA
WP_005014589.1|1284795_1285449_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014587.1|1285553_1286852_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014581.1|1287017_1289447_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_032974133.1|1289497_1290718_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014574.1|1290833_1291487_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
1291721:1291780	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_101557770.1|1291736_1292857_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879527.1|1292948_1293050_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014572.1|1293046_1294090_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_005014566.1|1295505_1296174_-	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014564.1|1296245_1296590_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014560.1|1296701_1296875_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005014556.1|1296961_1297243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032826331.1|1298276_1299212_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014553.1|1299754_1300957_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_017685984.1|1301031_1303062_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014551.1|1303276_1303768_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005014547.1|1303992_1304541_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014546.1|1304562_1305774_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014545.1|1305810_1306215_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014544.1|1306216_1306540_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014543.1|1306543_1307050_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014539.1|1307089_1308952_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014536.1|1308961_1309303_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014534.1|1309304_1309499_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_076879495.1|1309554_1310001_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341421.1|1310315_1311326_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|1311322_1312093_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_101558036.1|1312247_1312811_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_025341181.1|1312840_1313071_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_005019683.1|1313038_1314385_-	TonB-dependent receptor	NA	NA	NA	NA	NA
1313028:1313303	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCATCGCCCCGATAGGTATTGGGCGGCCCCAGTCGGCCGCTACGCAGCAAATACTTGATGTCGTTCGTTTCATCCACGCGCACCACAGCCGCCTTGAATTTCCATCCATTGGAAAATCGGTGGGTGAGGTCGGCGAACCAAGTGTTCTGGGTTTTATACGCGTGATTCCATTTGGCGCTCAGATTGGTCGAGCGTGAATACTCCGGCATCGACCCGTCT	NA	NA	NA	NA
WP_005014518.1|1314572_1315529_-	FecR family protein	NA	NA	NA	NA	NA
WP_005014516.1|1315525_1316032_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014514.1|1316182_1317070_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005019680.1|1317090_1317378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014511.1|1317390_1318905_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
>prophage 3
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	1439745	1488846	3696562	tRNA,transposase,protease	Ralstonia_virus(25.0%)	48	NA	NA
WP_005014292.1|1439745_1440357_+|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
WP_005014290.1|1440377_1441229_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014289.1|1441235_1441607_-	lipoprotein	NA	NA	NA	NA	NA
WP_005014286.1|1441679_1442798_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014285.1|1442977_1443778_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014283.1|1443878_1445237_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014281.1|1445361_1445658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014278.1|1445654_1447112_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014277.1|1447215_1447929_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014275.1|1447933_1448863_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014274.1|1448859_1449195_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014271.1|1449199_1450462_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012353.1|1450670_1451675_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014269.1|1451823_1453680_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005014267.1|1453788_1454388_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014265.1|1454384_1455209_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014263.1|1455198_1455720_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014260.1|1455732_1458891_-	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_032954285.1|1458896_1460348_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014256.1|1460280_1460988_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_005012353.1|1461971_1462976_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014253.1|1463089_1464241_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005014250.1|1464527_1464974_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014248.1|1465002_1465635_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014247.1|1465810_1466227_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_076879494.1|1466223_1466511_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014242.1|1466637_1467036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014241.1|1467178_1467553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014239.1|1467565_1468009_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014237.1|1468005_1468899_-	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014235.1|1468900_1469383_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014231.1|1469413_1470865_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014229.1|1470873_1472028_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014228.1|1472024_1472963_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005019577.1|1472959_1473952_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014226.1|1473948_1474620_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014223.1|1474735_1475776_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014221.1|1475772_1476459_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014215.1|1476470_1478075_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014213.1|1478034_1478901_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014212.1|1479253_1480501_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005012353.1|1480497_1481502_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014211.1|1481670_1482810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014210.1|1482896_1483547_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014203.1|1483617_1484085_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014202.1|1485576_1486698_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014200.1|1486694_1487936_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005012067.1|1487895_1488846_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	1806744	1917349	3696562	integrase,holin,transposase	Ralstonia_virus(25.0%)	99	1854532:1854591	1908310:1908648
WP_005013764.1|1806744_1807695_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013763.1|1807685_1808870_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013762.1|1808949_1809867_-	FecR family protein	NA	NA	NA	NA	NA
WP_005013761.1|1809868_1810363_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013759.1|1810505_1811486_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_076879523.1|1811469_1812210_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_025341443.1|1813450_1813657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013757.1|1813664_1814294_-	MarC family protein	NA	NA	NA	NA	NA
WP_005013756.1|1814588_1816793_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013755.1|1816903_1818127_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013754.1|1818249_1819224_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1819291_1820485_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013752.1|1820499_1821300_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013751.1|1821296_1823153_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013750.1|1823149_1823755_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1823773_1825159_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814011.1|1827200_1827983_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|1828081_1829032_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1829058_1829832_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1829843_1831085_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012808.1|1832736_1833687_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|1834850_1836566_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005013744.1|1836576_1837068_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005013742.1|1837140_1838157_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|1838324_1839104_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013740.1|1839122_1839641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019401.1|1839639_1839846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|1839934_1840204_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013736.1|1840293_1842459_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005019399.1|1842615_1843347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013735.1|1843359_1844112_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005012808.1|1844091_1845042_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_026087954.1|1845619_1846201_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005013732.1|1846539_1847487_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013731.1|1847649_1848522_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013730.1|1848535_1849462_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013729.1|1849502_1849664_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013727.1|1849623_1850574_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013726.1|1850719_1851274_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013725.1|1851356_1852577_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013724.1|1852587_1853301_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013723.1|1853338_1854460_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1854532:1854591	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
WP_005011985.1|1854535_1855756_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013722.1|1855803_1856163_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005013721.1|1856243_1856792_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013720.1|1856952_1858131_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013719.1|1858116_1858752_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005013718.1|1858817_1859549_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013717.1|1859617_1860550_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013715.1|1860738_1861935_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013714.1|1861947_1865118_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013712.1|1865114_1866593_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013711.1|1866680_1866932_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013710.1|1867031_1867652_-	SCO family protein	NA	NA	NA	NA	NA
WP_005013708.1|1868009_1868525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1868521_1869472_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013707.1|1869581_1871636_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013706.1|1871755_1872610_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005019390.1|1872606_1873233_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013704.1|1873229_1874984_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013703.1|1875529_1878241_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013702.1|1878253_1879918_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013701.1|1879933_1881709_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
WP_153566129.1|1881830_1882004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013700.1|1882122_1882335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013699.1|1882507_1883488_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013698.1|1883504_1884299_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157933265.1|1884332_1884800_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013696.1|1885416_1886070_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013695.1|1886151_1887087_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013694.1|1887348_1887495_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013693.1|1887585_1887987_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013692.1|1888062_1888947_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019382.1|1889039_1889744_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013691.1|1889782_1891864_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013690.1|1891996_1892908_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013689.1|1892972_1893404_-	TonB family protein	NA	NA	NA	NA	NA
WP_005013688.1|1893506_1894505_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013686.1|1894748_1895732_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013685.1|1895848_1896130_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013684.1|1896203_1896668_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005019379.1|1896887_1897157_-	YunC family protein	NA	NA	NA	NA	NA
WP_005013682.1|1897231_1897450_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005013681.1|1897475_1898258_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013680.1|1898296_1898794_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013679.1|1899092_1900316_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013678.1|1900312_1901173_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1901391_1902612_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013677.1|1902700_1904020_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005013676.1|1904073_1906245_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013675.1|1906472_1907285_-	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005012353.1|1907360_1908365_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_101557815.1|1909430_1910551_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
1908310:1908648	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
WP_005013673.1|1911410_1912196_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005013672.1|1912658_1913501_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_025341421.1|1913535_1914546_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|1914542_1915313_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013671.1|1915805_1916066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1916261_1917349_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 5
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	1930767	1974974	3696562	integrase,tRNA,transposase	Ralstonia_virus(20.0%)	47	1940730:1940789	1979188:1979758
WP_161992024.1|1930767_1931016_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_101557770.1|1930889_1932010_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013659.1|1932346_1932622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019369.1|1932626_1934102_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013657.1|1934858_1935824_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019367.1|1935813_1938675_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013655.1|1938677_1939193_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013654.1|1939253_1940465_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
1940730:1940789	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005019364.1|1941644_1942385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013652.1|1942477_1942948_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013651.1|1942966_1943671_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013650.1|1943683_1944226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013649.1|1944247_1944715_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013648.1|1944824_1945457_+	DedA family protein	NA	NA	NA	NA	NA
WP_005013647.1|1945477_1945936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013645.1|1945977_1946427_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013644.1|1947299_1947971_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013643.1|1947967_1948609_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013642.1|1948619_1949507_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013641.1|1949675_1950839_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013640.1|1950907_1951885_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013639.1|1952004_1952427_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005013638.1|1952473_1952683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013637.1|1952730_1954506_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013636.1|1954534_1954804_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013635.1|1954866_1955265_-	PTS IIa component	NA	NA	NA	NA	NA
WP_005013634.1|1955278_1956235_-	glutathione synthase	NA	NA	NA	NA	NA
WP_076879490.1|1956400_1956949_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013632.1|1956969_1958922_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_005013631.1|1959422_1960163_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013629.1|1960163_1961534_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013628.1|1961647_1961896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1962085_1962322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1962448_1962613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013626.1|1962763_1962925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013625.1|1963024_1963714_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_101557809.1|1964106_1964373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080687433.1|1964411_1964798_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157933264.1|1964781_1965096_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_101557807.1|1965137_1966299_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005013621.1|1966939_1967599_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110097765.1|1967650_1968721_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005019353.1|1968735_1969551_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005019351.1|1969557_1971183_-	membrane protein	NA	NA	NA	NA	NA
WP_005013618.1|1971369_1972500_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013617.1|1972646_1973723_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|1973753_1974974_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
1979188:1979758	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCACCATGGTTACGCCGGCCCAACAGAGCTCGGCCAGGCGCTCGGCGTGGTGGCCCAAGGCGGCATGTGGATGGGTCGATCTCTGGTAGGCCGCCTGTTACGCACGGCCCGAAATCGCGCCGGCACACCCGCGGATTGGGGCCACGCTCTGTTGACCGCACGGGAAGACACCGTCGCGCGCCACGCCTCTGCCGGTCAATCCAACGCGCAGATCGCCGAACAGCTCGGCATTACCGAACGCACCGTCAAAGCGCATCTGTCCGCGGTCTTTGAGAAAGTCGGCGTGGCAGATCGCCTGCAGTTAGCGCTATTGGTCCATGGCGTCACACCCGCCAAAACCGGCCATTGACTCAACGGCACCGCACCTCAATCGCCTGCCGGATCCATCAACGGCGGGCCTGCTCGTACAAGGGCAAAACCCGCTCTGACGCCTGCTTCAGATCCGCGATGCGTGTGCTGGCCGAGGGATGCGTGGAGAGAAACTCCGGCGAGGCCTGTCCAGTCTGGGCCGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	1990593	2042173	3696562	tRNA,transposase	Leptospira_phage(21.43%)	52	NA	NA
WP_025341429.1|1990593_1991601_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005013598.1|1991757_1992726_+	homoserine kinase	NA	NA	NA	NA	NA
WP_153566127.1|1993146_1993299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013597.1|1993410_1993848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013596.1|1993844_1994639_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013595.1|1994815_1995571_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_101557770.1|1996222_1997343_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013592.1|1997386_1998010_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_005013591.1|1998006_1999368_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013590.1|1999367_2000123_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013589.1|2000187_2000592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|2000816_2001356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013587.1|2001577_2002786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2002835_2003786_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2003884_2004835_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013586.1|2005057_2005318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013585.1|2005579_2005987_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013584.1|2005983_2008323_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013583.1|2008328_2009453_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013582.1|2009500_2009632_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013581.1|2009646_2010342_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013580.1|2010585_2011119_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013579.1|2011154_2012702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013578.1|2012706_2013930_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013577.1|2013916_2014696_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005019317.1|2014726_2015665_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013573.1|2015783_2016506_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013572.1|2016647_2017346_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013571.1|2017642_2018524_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013570.1|2018545_2019706_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013569.1|2019716_2020322_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2020580_2021801_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013568.1|2021856_2024154_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005013567.1|2024293_2025214_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013566.1|2025220_2025772_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013565.1|2025817_2026879_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013564.1|2027219_2027915_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013563.1|2027886_2029410_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_017685641.1|2029645_2031271_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013561.1|2031744_2031963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013559.1|2032114_2033014_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013558.1|2033130_2034423_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013556.1|2034513_2034888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013555.1|2034897_2035395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|2035424_2035556_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013552.1|2035814_2036150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|2036771_2038271_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013550.1|2038377_2038623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013549.1|2038683_2039055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601033.1|2039059_2039803_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_101557831.1|2039803_2040924_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_101557920.1|2041091_2042173_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 7
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	2347459	2397277	3696562	tRNA,transposase	Ralstonia_virus(25.0%)	54	NA	NA
WP_005011985.1|2347459_2348680_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019139.1|2349293_2350127_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_005012970.1|2350134_2351382_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_005012967.1|2351504_2351942_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012964.1|2351963_2353190_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_005019132.1|2353328_2353790_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	43.4	2.0e-17
WP_005011985.1|2354524_2355745_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012942.1|2356372_2356801_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_005012941.1|2356829_2357276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012939.1|2357408_2359325_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_005012937.1|2359496_2362019_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_005012934.1|2362013_2362667_-	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
WP_005012933.1|2362844_2364020_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005012931.1|2364016_2364223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012930.1|2364269_2365256_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005012927.1|2365260_2365716_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
WP_101557744.1|2365739_2366860_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_080687431.1|2366883_2367339_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
WP_005012922.1|2367407_2369207_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
WP_005012921.1|2369260_2369626_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012919.1|2369632_2369848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012916.1|2369938_2371021_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005012915.1|2371148_2371361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012914.1|2371508_2371751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012913.1|2371845_2372049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012912.1|2372200_2372383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012910.1|2372439_2372724_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012903.1|2372771_2373365_-	lipoprotein	NA	NA	NA	NA	NA
WP_005012901.1|2373656_2374127_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012900.1|2374123_2374576_-	low affinity iron permease family protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
WP_005012896.1|2374669_2374948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012894.1|2375077_2375326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012893.1|2375454_2377416_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
WP_005012891.1|2377450_2378197_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012888.1|2378592_2378802_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012887.1|2380682_2381687_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012885.1|2381717_2382707_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012883.1|2382734_2383478_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012882.1|2383764_2384019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|2384400_2385129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685459.1|2385159_2385726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012873.1|2385948_2386347_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012872.1|2386404_2386746_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012871.1|2386763_2389181_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012870.1|2389193_2390216_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012869.1|2390288_2390648_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012868.1|2390663_2390861_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_131285595.1|2390958_2391234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012866.1|2391281_2392781_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012863.1|2392902_2393166_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012861.1|2393225_2394446_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005011985.1|2394539_2395760_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012855.1|2395825_2396008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2396326_2397277_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	2412176	2458319	3696562	transposase,protease	uncultured_Mediterranean_phage(15.38%)	39	NA	NA
WP_005012839.1|2412176_2414486_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012838.1|2414539_2416645_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012835.1|2421898_2422213_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012834.1|2422437_2422683_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012833.1|2422815_2423265_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005019101.1|2423328_2424534_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_080601032.1|2424637_2425894_-	chloride channel protein	NA	NA	NA	NA	NA
WP_101557770.1|2425966_2427086_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012829.1|2427211_2427790_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_005012828.1|2427883_2429242_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012827.1|2429594_2430179_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012826.1|2430175_2430589_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012823.1|2430585_2431620_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012822.1|2431645_2431825_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012820.1|2431839_2432604_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005019095.1|2432757_2433414_+	adenylate kinase	NA	NA	NA	NA	NA
WP_005012817.1|2433510_2434269_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005012815.1|2434328_2435888_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012814.1|2436172_2436910_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012813.1|2436918_2438700_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012812.1|2438723_2439101_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012811.1|2439246_2440446_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012810.1|2441657_2442137_+	sensor protein	NA	NA	NA	NA	NA
WP_005012808.1|2442218_2443169_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012807.1|2443222_2443369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012806.1|2443570_2443834_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005012805.1|2443959_2444730_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012804.1|2444772_2445768_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012803.1|2447599_2447881_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2447956_2449177_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012801.1|2450092_2450827_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019092.1|2450859_2451645_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012798.1|2452021_2452309_+	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005012797.1|2452305_2452974_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012796.1|2453020_2453311_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012795.1|2453469_2454651_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012790.1|2454706_2455648_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012789.1|2455757_2457095_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_101557770.1|2457198_2458319_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 9
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	2481582	2524753	3696562	tRNA,transposase,protease	Leptospira_phage(30.77%)	36	NA	NA
WP_005012067.1|2481582_2482533_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005019086.1|2483079_2484093_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012730.1|2484105_2485422_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_076879487.1|2486009_2486564_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_101557770.1|2486657_2487777_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012717.1|2487795_2487993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012715.1|2488107_2489466_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012713.1|2490140_2491247_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012711.1|2491243_2492032_-	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012709.1|2492742_2493024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2493192_2494313_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080688213.1|2494355_2495012_+	cytochrome B	NA	NA	NA	NA	NA
WP_005012704.1|2495078_2495522_-	cytochrome c	NA	NA	NA	NA	NA
WP_005012700.1|2495583_2496960_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005019071.1|2497097_2497706_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012695.1|2497781_2498603_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012692.1|2498684_2499797_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012689.1|2499805_2500726_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012688.1|2500872_2501853_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012685.1|2501913_2502780_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012682.1|2502879_2504100_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005019066.1|2504282_2505401_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012678.1|2505402_2505717_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019055.1|2505713_2507159_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012675.1|2507155_2508406_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012673.1|2508410_2509514_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005019053.1|2509527_2511027_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_101557770.1|2511000_2512120_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012670.1|2513878_2515099_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_005012669.1|2515183_2516257_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012668.1|2516519_2517980_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005019040.1|2518546_2518909_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012664.1|2518971_2519625_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012663.1|2519764_2522470_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012662.1|2522478_2523498_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_101557744.1|2523632_2524753_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
>prophage 10
NZ_CP043147	Bordetella holmesii strain H400 chromosome, complete genome	3696562	2972958	3015720	3696562	tRNA,transposase,protease	Ralstonia_virus(50.0%)	38	NA	NA
WP_005011985.1|2972958_2974179_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018740.1|2974378_2975284_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005018738.1|2975442_2976372_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2976468_2977689_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018735.1|2977742_2979263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005018732.1|2979268_2979718_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018729.1|2979946_2981452_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018726.1|2981471_2982158_-	response regulator	NA	NA	NA	NA	NA
WP_005018723.1|2982138_2982708_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018720.1|2982773_2984504_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018717.1|2984557_2984980_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018715.1|2984982_2985657_+	protein TolQ	NA	NA	NA	NA	NA
WP_005018713.1|2985656_2986118_+	protein TolR	NA	NA	NA	NA	NA
WP_005018710.1|2986152_2987073_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_005018709.1|2987089_2988406_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018707.1|2988437_2988932_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018704.1|2989019_2989709_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018702.1|2989757_2990204_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005013747.1|2990236_2991187_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991789_2992587_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992626_2993280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993260_2994325_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994488_2996714_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996959_2998804_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998920_2999793_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999839_3001540_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001602_3002802_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002812_3003691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003797_3004835_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004915_3005320_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005331_3006789_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007431_3008028_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008188_3008647_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009424_3010396_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010517_3010937_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012228_3013449_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005020040.1|3013510_3014398_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_005020041.1|3014415_3015720_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
