The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	1095291	1202080	3696565	tRNA,protease,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095291_1096512_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096599_1097190_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097186_1097489_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097540_1098530_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098650_1099532_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099705_1100560_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100591_1101440_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101567_1102788_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102806_1103373_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103570_1104722_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104860_1105865_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106021_1106993_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107071_1107860_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107931_1108168_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108176_1109088_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109131_1111003_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111163_1111961_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112192_1112567_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112643_1112967_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113050_1113323_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113337_1113793_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113914_1114751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114747_1116121_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116197_1117154_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117241_1118219_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118343_1119999_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120047_1120512_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120508_1120970_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121195_1122383_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122379_1123684_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123680_1125090_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125283_1126403_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126538_1127558_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127566_1130272_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130411_1131065_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131127_1131490_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132056_1133517_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133779_1134853_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134937_1136158_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137915_1139036_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139009_1140509_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140522_1141626_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141630_1142881_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142877_1144323_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144319_1144634_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144635_1145754_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145936_1147157_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147256_1148123_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148183_1149164_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149310_1150231_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150239_1151352_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151433_1152255_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152330_1152939_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153076_1154453_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154514_1154958_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155024_1155681_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155723_1156843_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157012_1157294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158004_1158793_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158789_1159896_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160570_1161929_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162043_1162241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162258_1163379_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163472_1164027_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164614_1165931_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165943_1166957_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167503_1168454_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168533_1168833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170193_1171852_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172000_1173221_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173338_1174622_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174625_1175567_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175676_1176135_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176515_1177136_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177543_1179964_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180071_1180809_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180855_1182100_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182422_1182695_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183278_1184007_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184028_1184946_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184945_1185455_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185571_1186243_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186352_1187420_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187439_1189284_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189420_1190608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190908_1191694_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191717_1192837_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192941_1194279_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194388_1195330_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195385_1196567_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196725_1197016_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197062_1197731_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197727_1198015_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198391_1199177_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199209_1199944_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200859_1202080_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	1206867	1263272	3696565	tRNA,protease,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206867_1207818_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207899_1208379_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209590_1210790_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210935_1211313_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211336_1213118_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213126_1213864_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214148_1215708_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215767_1216526_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216622_1217279_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217432_1218197_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218211_1218391_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218416_1219451_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219447_1219861_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219857_1220442_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220794_1222153_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222246_1222825_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222949_1224070_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224142_1225399_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225502_1226708_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226771_1227221_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227353_1227599_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227823_1228138_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233391_1235497_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235550_1237860_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239213_1240881_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240883_1241549_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241681_1245488_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245713_1246859_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246977_1247907_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247903_1248980_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248976_1249783_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249779_1250511_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250887_1252126_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252173_1252512_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252759_1253710_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254028_1254211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254276_1255497_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255589_1256810_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256869_1257133_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257254_1258754_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258801_1259077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259174_1259372_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259387_1259747_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259819_1260842_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260854_1263272_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	1652691	1693064	3696565	tRNA,integrase,transposase	Leptospira_phage(28.57%)	39	1644085:1644101	1689750:1689766
1644085:1644101	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652691_1653811_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654463_1655219_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655395_1656190_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656186_1656624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656735_1656888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657308_1658277_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658433_1659441_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659498_1659957_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660030_1661377_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661394_1661766_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661765_1663235_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663390_1664116_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664129_1666844_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667095_1668460_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668499_1669558_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669585_1670404_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670441_1670720_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671983_1672283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672852_1674256_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674268_1674919_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675060_1676281_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676311_1677388_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677534_1678665_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678851_1680477_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680483_1681299_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681313_1682384_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682435_1683095_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683734_1684897_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684938_1685253_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685236_1685623_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685661_1685928_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686320_1687010_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687109_1687271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687421_1687586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687712_1687949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688138_1688387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688500_1689871_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689750:1689766	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689871_1690612_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691111_1693064_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	1711358	1755285	3696565	tRNA,holin,integrase,transposase	Leptospira_phage(33.33%)	37	1753853:1753867	1760329:1760343
WP_005019367.1|1711358_1714220_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714209_1715175_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715931_1717407_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717411_1717687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718023_1719143_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719017_1719266_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719444_1720653_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720649_1722932_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722942_1725324_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725587_1727495_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727509_1728400_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728406_1729540_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729539_1730361_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730385_1731576_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731877_1732159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732324_1732645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732684_1733771_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733967_1734228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734720_1735491_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735487_1736498_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736532_1737375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737837_1738623_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739482_1740602_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741668_1742673_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742748_1743561_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743788_1745960_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746013_1747333_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747421_1748642_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748860_1749721_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749717_1750941_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751239_1751737_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751775_1752558_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752583_1752802_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752876_1753146_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753365_1753830_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753853:1753867	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753903_1754185_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754301_1755285_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760329:1760343	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	1780561	1821952	3696565	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780561_1781512_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781508_1782024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782381_1783002_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783101_1783353_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783440_1784919_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784915_1788086_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788098_1789295_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789483_1790416_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790484_1791216_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791281_1791917_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791902_1793081_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793241_1793790_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793870_1794230_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794277_1795498_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795573_1796695_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796732_1797446_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797456_1798677_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798759_1799314_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799459_1800410_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800369_1800531_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800571_1801498_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801511_1802384_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802546_1803494_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803832_1804414_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804991_1805942_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805921_1806674_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806686_1807418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807574_1809740_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809829_1810099_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810187_1810394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810392_1810911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810929_1811709_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811876_1812893_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812965_1813457_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813467_1815183_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816346_1817297_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818948_1820190_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820201_1820975_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821001_1821952_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	2150165	2210288	3696565	tRNA,protease,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150165_2150654_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150646_2151495_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151586_2152084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152221_2152581_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152577_2152859_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152858_2153341_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153342_2154971_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154967_2155312_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155313_2158256_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158701_2159673_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159662_2161045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161187_2162138_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162097_2163339_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163335_2164457_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165948_2166416_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166486_2167137_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167223_2168363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168531_2169536_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169532_2170780_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171132_2171999_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171958_2173563_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173574_2174261_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174257_2175298_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175413_2176085_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176081_2177074_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177070_2178009_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178005_2179160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179168_2180620_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180650_2181133_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181134_2182028_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182024_2182468_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182480_2182855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182997_2183396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183522_2183810_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183806_2184223_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184398_2185031_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185059_2185506_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185792_2186944_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187057_2188062_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189045_2189753_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189685_2191137_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191142_2194301_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194313_2194835_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194824_2195649_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195645_2196245_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196353_2198210_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198358_2199363_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199571_2200834_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200838_2201174_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201170_2202100_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202104_2202818_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202921_2204379_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204375_2204672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204796_2206155_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206255_2207056_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207235_2208354_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208426_2208798_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208804_2209656_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209676_2210288_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	2305417	2426926	3696565	tRNA,protease,integrase,transposase	Leptospira_phage(15.15%)	106	2336947:2337006	2358254:2358528
WP_101557807.1|2305417_2306580_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306692_2307661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307657_2308578_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308674_2313153_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313531_2317866_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318504_2319068_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319079_2319325_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319480_2319990_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320035_2321016_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321227_2323579_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323625_2324456_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324452_2325142_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325134_2326415_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326512_2327451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327432_2329139_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329216_2330320_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330372_2331122_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331128_2332643_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332655_2332943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332963_2333851_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334001_2334508_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334504_2335461_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335648_2336995_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336947:2337006	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336962_2337193_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337222_2337786_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337940_2338711_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338707_2339718_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340032_2340479_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340534_2340729_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340730_2341072_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341081_2342944_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342983_2343490_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343493_2343817_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343818_2344223_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344259_2345471_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345492_2346041_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346265_2346757_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346971_2349002_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349076_2350279_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350821_2351757_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352790_2353072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353158_2353332_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353443_2353788_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353859_2354528_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355943_2356987_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356983_2357085_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357176_2358296_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358546_2359200_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358254:2358528	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359315_2360536_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360586_2363016_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363181_2364480_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364584_2365238_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365240_2366551_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366778_2367318_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367796_2368063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368101_2368467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368348_2369359_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369355_2370126_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370211_2370871_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370838_2371330_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371439_2371643_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371960_2372281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372264_2372600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372654_2372867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372942_2373281_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373277_2373613_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373675_2375247_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376040_2376352_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376544_2377665_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377792_2377987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384067_2385229_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385614_2387078_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387210_2388761_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388757_2388907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389072_2390193_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391306_2392164_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392216_2392714_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392834_2394250_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394259_2395444_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395440_2397039_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398221_2398467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398877_2399063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399218_2400130_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400251_2401094_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401296_2402670_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402979_2404491_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404643_2405375_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405481_2406783_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406790_2407699_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407695_2408289_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408332_2408746_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408742_2409213_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409219_2409825_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411626_2413411_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413407_2414793_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414778_2415741_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415810_2416440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416477_2417686_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417807_2418377_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418508_2420062_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420365_2421586_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421993_2422896_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422892_2423762_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423758_2424610_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424606_2425431_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425705_2426926_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	2936384	3013444	3696565	tRNA,integrase,transposase	Ralstonia_virus(21.43%)	56	2939239:2939298	2987826:2988396
WP_005019978.1|2936384_2937164_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937186_2938134_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938135_2938336_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938670_2939790_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939239:2939298	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940111_2940828_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940824_2941718_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941881_2943102_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943254_2944337_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946016_2947000_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947062_2948475_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948592_2949435_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949713_2950322_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950337_2950958_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951023_2951731_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951735_2952458_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952444_2952735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952810_2954031_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954755_2955607_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955658_2956912_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957088_2957877_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957996_2958911_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959043_2960936_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961121_2962501_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962945_2963242_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967042_2967645_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967778_2968237_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968238_2968838_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968846_2969656_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969690_2970545_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970664_2971252_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971248_2972628_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973132_2973279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980950_2982291_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982304_2983156_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983167_2984433_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984494_2986399_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988374_2989229_-	hypothetical protein	NA	NA	NA	NA	NA
2987826:2988396	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989221_2990016_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990231_2991182_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991784_2992582_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992621_2993275_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993255_2994320_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994483_2996709_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996954_2998799_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998915_2999788_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999834_3001535_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001597_3002797_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002807_3003686_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003792_3004830_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004910_3005315_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005326_3006784_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007426_3008023_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008183_3008642_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009419_3010391_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010512_3010932_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012223_3013444_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
>prophage 10
NZ_CP043149	Bordetella holmesii strain H385 chromosome, complete genome	3696565	3548681	3585897	3696565	tRNA,protease,transposase,holin	Ralstonia_virus(11.11%)	38	NA	NA
WP_005011985.1|3548681_3549902_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005016909.1|3549963_3551142_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005016911.1|3551160_3552255_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.2e-49
WP_005016914.1|3552251_3554291_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	38.7	3.4e-13
WP_005016917.1|3554411_3555089_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005016919.1|3556751_3557684_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005016921.1|3557697_3558501_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005016923.1|3558533_3559397_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005016926.1|3559495_3560446_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016929.1|3560442_3560922_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005016932.1|3560884_3561157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879514.1|3561120_3561885_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_005016938.1|3561920_3562178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016939.1|3562454_3563444_+	extra-cytoplasmic solute receptor family protein 175	NA	NA	NA	NA	NA
WP_005016941.1|3563497_3564340_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005016943.1|3564339_3564675_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_005016945.1|3564737_3566159_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.0	1.8e-37
WP_005016947.1|3566419_3567463_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_005016949.1|3567530_3567752_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_005016951.1|3567978_3568191_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_005016952.1|3568187_3568952_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005016955.1|3569006_3570170_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.9	3.4e-127
WP_005020237.1|3570187_3571303_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005016962.1|3571299_3572193_+	lysophospholipid acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	31.2	5.5e-32
WP_005016964.1|3572215_3573112_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005016967.1|3573136_3573805_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_005016969.1|3573811_3574780_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	29.9	3.3e-14
WP_005020238.1|3574785_3576831_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005016972.1|3576917_3577859_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_005016975.1|3577855_3578521_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_005020243.1|3578481_3579483_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005016979.1|3579485_3580361_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005016985.1|3580357_3581113_-	metal ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	5.5e-09
WP_017685723.1|3581288_3581789_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_005016990.1|3582148_3583258_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005016992.1|3583379_3583844_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_005016994.1|3583996_3584551_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017685724.1|3584562_3585897_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	9.3e-44
