The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	1095257	1202046	3697588	tRNA,protease,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095257_1096478_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096565_1097156_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097152_1097455_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097506_1098496_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098616_1099498_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099671_1100526_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100557_1101406_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101533_1102754_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102772_1103339_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103536_1104688_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104826_1105831_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105987_1106959_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107037_1107826_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107897_1108134_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108142_1109054_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109097_1110969_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111129_1111927_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112158_1112533_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112609_1112933_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113016_1113289_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113303_1113759_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113880_1114717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114713_1116087_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116163_1117120_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117207_1118185_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118309_1119965_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120013_1120478_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120474_1120936_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121161_1122349_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122345_1123650_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123646_1125056_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125249_1126369_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126504_1127524_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127532_1130238_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130377_1131031_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131093_1131456_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132022_1133483_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133745_1134819_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134903_1136124_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137881_1139002_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138975_1140475_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140488_1141592_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141596_1142847_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142843_1144289_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144285_1144600_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144601_1145720_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145902_1147123_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147222_1148089_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148149_1149130_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149276_1150197_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150205_1151318_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151399_1152221_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152296_1152905_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153042_1154419_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154480_1154924_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154990_1155647_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155689_1156809_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156978_1157260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157970_1158759_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158755_1159862_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160536_1161895_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162009_1162207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162224_1163345_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163438_1163993_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164580_1165897_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165909_1166923_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167469_1168420_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168499_1168799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170159_1171818_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171966_1173187_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173304_1174588_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174591_1175533_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175642_1176101_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176481_1177102_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177509_1179930_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180037_1180775_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180821_1182066_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182388_1182661_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183244_1183973_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183994_1184912_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184911_1185421_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185537_1186209_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186318_1187386_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187405_1189250_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189386_1190574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190874_1191660_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191683_1192803_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192907_1194245_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194354_1195296_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195351_1196533_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196691_1196982_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197028_1197697_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197693_1197981_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198357_1199143_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199175_1199910_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200825_1202046_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	1206833	1263239	3697588	tRNA,protease,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206833_1207784_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207865_1208345_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209556_1210756_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210901_1211279_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211302_1213084_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213092_1213830_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214114_1215674_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215733_1216492_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216588_1217245_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217398_1218163_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218177_1218357_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218382_1219417_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219413_1219827_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219823_1220408_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220760_1222119_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222212_1222791_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222915_1224036_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224108_1225365_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225468_1226674_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226737_1227187_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227319_1227565_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227789_1228104_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233357_1235463_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235516_1237826_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239179_1240847_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240849_1241515_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241647_1245454_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245679_1246825_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246943_1247873_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247869_1248946_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248942_1249749_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249745_1250477_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250853_1252092_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252139_1252478_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252725_1253676_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253994_1254177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254242_1255463_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255556_1256777_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256836_1257100_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257221_1258721_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258768_1259044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259141_1259339_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259354_1259714_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259786_1260809_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260821_1263239_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	1586777	1693039	3697588	tRNA,transposase,integrase	Leptospira_phage(14.29%)	100	1644052:1644068	1689718:1689734
WP_005011985.1|1586777_1587998_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588352_1588829_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589087_1589696_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589714_1590386_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590559_1592446_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592473_1593316_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593312_1594656_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594840_1595656_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595721_1597203_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597401_1599474_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599693_1600731_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601917_1602775_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602802_1603579_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604406_1604916_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1605993_1606764_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606760_1607771_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607829_1608910_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609078_1610198_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610199_1610943_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610947_1611319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611379_1611625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611731_1613231_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613852_1614188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614446_1614578_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614607_1615105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615114_1615489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615579_1616872_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616988_1617888_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618039_1618258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618731_1620357_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620592_1622116_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622087_1622783_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623123_1624185_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624230_1624782_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624788_1625709_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625848_1628146_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628201_1629422_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629680_1630286_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630296_1631457_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631478_1632360_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632656_1633355_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633496_1634219_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634337_1635276_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635306_1636086_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636072_1637296_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637300_1638848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638883_1639417_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639660_1640356_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640370_1640502_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640549_1641674_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641679_1644019_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644015_1644423_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644052:1644068	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644684_1644945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645167_1646118_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646216_1647167_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647216_1648425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648646_1649186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649410_1649815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649879_1650635_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650634_1651996_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1651992_1652616_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652659_1653779_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654431_1655187_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655363_1656158_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656154_1656592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656703_1656856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657276_1658245_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658401_1659409_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659466_1659925_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659998_1661345_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661362_1661734_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661733_1663203_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663358_1664084_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664097_1666812_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667063_1668428_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668467_1669526_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669553_1670372_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670409_1670688_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671951_1672251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672820_1674224_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674236_1674887_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675028_1676249_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676279_1677356_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677502_1678633_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678819_1680445_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680451_1681267_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681281_1682352_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682403_1683063_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683702_1684865_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684906_1685221_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685204_1685591_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685629_1685896_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686288_1686978_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687077_1687239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687389_1687554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687680_1687917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688106_1688355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688468_1689839_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689718:1689734	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689839_1690580_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691086_1693039_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	1711333	1755260	3697588	holin,tRNA,transposase,integrase	Leptospira_phage(33.33%)	37	1753828:1753842	1760304:1760318
WP_005019367.1|1711333_1714195_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714184_1715150_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715906_1717382_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717386_1717662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717998_1719118_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718992_1719241_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719419_1720628_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720624_1722907_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722917_1725299_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725562_1727470_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727484_1728375_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728381_1729515_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729514_1730336_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730360_1731551_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731852_1732134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732299_1732620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732659_1733746_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733942_1734203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734695_1735466_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735462_1736473_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736507_1737350_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737812_1738598_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739457_1740577_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741643_1742648_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742723_1743536_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743763_1745935_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745988_1747308_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747396_1748617_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748835_1749696_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749692_1750916_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751214_1751712_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751750_1752533_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752558_1752777_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752851_1753121_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753340_1753805_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753828:1753842	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753878_1754160_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754276_1755260_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760304:1760318	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	1780536	1821927	3697588	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780536_1781487_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781483_1781999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782356_1782977_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783076_1783328_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_153569422.1|1783415_1784894_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784890_1788061_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788073_1789270_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789458_1790391_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790459_1791191_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791256_1791892_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791877_1793056_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793216_1793765_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793845_1794205_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794252_1795473_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795548_1796670_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796707_1797421_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797431_1798652_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798734_1799289_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799434_1800385_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800344_1800506_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800546_1801473_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801486_1802359_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802521_1803469_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803807_1804389_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804966_1805917_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805896_1806649_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806661_1807393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807549_1809715_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809804_1810074_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810162_1810369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810367_1810886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810904_1811684_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811851_1812868_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812940_1813432_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813442_1815158_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816321_1817272_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818923_1820165_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820176_1820950_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820976_1821927_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	2002177	2062721	3697588	transposase	Ralstonia_virus(23.08%)	53	NA	NA
WP_101557770.1|2002177_2003297_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014012.1|2003330_2003645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014013.1|2003746_2005435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014014.1|2005514_2005892_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_005014015.1|2006028_2006754_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014016.1|2006886_2007873_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_005014017.1|2007875_2008349_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_005014018.1|2008353_2009637_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005014019.1|2009633_2010524_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_005014020.1|2010520_2012218_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
WP_005014021.1|2013542_2015042_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005014022.1|2015114_2015633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014024.1|2015706_2016597_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_005019502.1|2016711_2017908_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_076879493.1|2017942_2018707_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101557831.1|2019071_2020192_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_005014027.1|2020165_2020513_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_005014028.1|2020548_2021448_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014029.1|2021452_2022592_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_005014030.1|2022699_2023314_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005011985.1|2023652_2024873_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019508.1|2025177_2025948_+	amino acid racemase	NA	NA	NA	NA	NA
WP_005014033.1|2026038_2026740_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-15
WP_005014034.1|2026740_2027508_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-15
WP_005014035.1|2027504_2028743_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_005014036.1|2028742_2029669_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_005014037.1|2029772_2030888_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014038.1|2031237_2031786_-	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	34.6	1.7e-15
WP_005014039.1|2031782_2032616_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_005014041.1|2032807_2034118_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_005014042.1|2034402_2035284_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_005014043.1|2035308_2036160_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_005014047.1|2036205_2037294_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.2	1.3e-22
WP_005014079.1|2037397_2038618_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
WP_005014048.1|2038672_2039797_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005016594.1|2039944_2040895_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014049.1|2041039_2041648_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005019512.1|2041650_2042937_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_005014051.1|2044094_2044940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014052.1|2044948_2047024_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_005014053.1|2047050_2048223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014054.1|2048247_2048961_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005014055.1|2048970_2049744_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014056.1|2050067_2050274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879525.1|2050691_2051387_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.7	9.2e-11
WP_005014058.1|2051472_2053434_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_005019521.1|2053598_2055776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014060.1|2055875_2056376_-	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	36.1	1.4e-13
WP_005019523.1|2056527_2057487_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.1	2.7e-13
WP_005014062.1|2057542_2059612_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_005014063.1|2059633_2060020_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_005014064.1|2060156_2061413_+	voltage gated Cl- channel protein	NA	NA	NA	NA	NA
WP_005011985.1|2061500_2062721_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 7
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	2151190	2211313	3697588	tRNA,protease,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2151190_2151679_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2151671_2152520_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2152611_2153109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2153246_2153606_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2153602_2153884_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2153883_2154366_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2154367_2155996_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155992_2156337_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2156338_2159281_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2159726_2160698_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2160687_2162070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2162212_2163163_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2163122_2164364_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2164360_2165482_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2166973_2167441_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2167511_2168162_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2168248_2169388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2169556_2170561_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2170557_2171805_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2172157_2173024_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2172983_2174588_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2174599_2175286_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2175282_2176323_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2176438_2177110_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2177106_2178099_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2178095_2179034_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2179030_2180185_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2180193_2181645_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2181675_2182158_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2182159_2183053_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2183049_2183493_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2183505_2183880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2184022_2184421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2184547_2184835_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2184831_2185248_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2185423_2186056_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2186084_2186531_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2186817_2187969_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2188082_2189087_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2190070_2190778_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2190710_2192162_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2192167_2195326_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2195338_2195860_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2195849_2196674_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2196670_2197270_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2197378_2199235_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2199383_2200388_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2200596_2201859_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2201863_2202199_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2202195_2203125_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2203129_2203843_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2203946_2205404_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2205400_2205697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2205821_2207180_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2207280_2208081_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2208260_2209379_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2209451_2209823_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2209829_2210681_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2210701_2211313_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	2306436	2427947	3697588	tRNA,protease,transposase,integrase	Leptospira_phage(15.15%)	106	2337966:2338025	2359273:2359547
WP_101557807.1|2306436_2307599_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2307711_2308680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2308676_2309597_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2309693_2314172_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2314550_2318885_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2319523_2320087_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2320098_2320344_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2320499_2321009_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2321054_2322035_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2322246_2324598_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2324644_2325475_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2325471_2326161_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2326153_2327434_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2327531_2328470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2328451_2330158_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2330235_2331339_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2331391_2332141_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2332147_2333662_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2333674_2333962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333982_2334870_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2335020_2335527_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2335523_2336480_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2336667_2338014_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2337966:2338025	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2337981_2338212_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2338241_2338805_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338959_2339730_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2339726_2340737_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2341051_2341498_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2341553_2341748_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2341749_2342091_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2342100_2343963_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2344002_2344509_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2344512_2344836_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2344837_2345242_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2345278_2346490_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2346511_2347060_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2347284_2347776_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347990_2350021_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2350095_2351298_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2351840_2352776_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2353809_2354091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2354177_2354351_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2354462_2354807_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354878_2355547_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2356962_2358006_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2358002_2358104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2358195_2359315_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2359565_2360219_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2359273:2359547	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2360334_2361555_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2361605_2364035_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2364200_2365499_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2365603_2366257_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2366259_2367570_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2367797_2368337_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2368815_2369082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2369120_2369486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2369367_2370378_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2370374_2371145_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2371230_2371890_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371857_2372349_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2372458_2372662_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372979_2373300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2373283_2373619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2373673_2373886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373961_2374300_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2374296_2374632_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2374694_2376266_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2377059_2377371_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2377563_2378684_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2378811_2379006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2385088_2386250_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2386635_2388099_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2388231_2389782_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2389778_2389928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2390093_2391214_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2392327_2393185_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2393237_2393735_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2393855_2395271_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2395280_2396465_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2396461_2398060_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2399242_2399488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2399898_2400084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2400239_2401151_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2401272_2402115_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2402317_2403691_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2404000_2405512_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2405664_2406396_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2406502_2407804_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2407811_2408720_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2408716_2409310_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2409353_2409767_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2409763_2410234_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2410240_2410846_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2412647_2414432_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2414428_2415814_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2415799_2416762_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2416831_2417461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2417498_2418707_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2418828_2419398_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2419529_2421083_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2421386_2422607_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2423014_2423917_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423913_2424783_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2424779_2425631_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2425627_2426452_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2426726_2427947_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043150	Bordetella holmesii strain H370 chromosome, complete genome	3697588	2937406	3014466	3697588	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2940261:2940320	2988848:2989418
WP_005019978.1|2937406_2938186_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2938208_2939156_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2939157_2939358_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2939692_2940812_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2940261:2940320	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2941133_2941850_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941846_2942740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942903_2944124_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2944276_2945359_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2947038_2948022_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2948084_2949497_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2949614_2950457_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2950735_2951344_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2951359_2951980_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2952045_2952753_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2952757_2953480_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2953466_2953757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953832_2955053_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2955777_2956629_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2956680_2957934_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2958110_2958899_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2959018_2959933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2960065_2961958_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2962143_2963523_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963967_2964264_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2968064_2968667_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968800_2969259_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2969260_2969860_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969868_2970678_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2970712_2971567_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2971686_2972274_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2972270_2973650_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2974154_2974301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981972_2983313_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2983326_2984178_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2984189_2985455_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2985516_2987421_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2989396_2990251_-	hypothetical protein	NA	NA	NA	NA	NA
2988848:2989418	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2990243_2991038_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2991253_2992204_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992806_2993604_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2993643_2994297_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2994277_2995342_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2995505_2997731_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997976_2999821_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999937_3000810_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000856_3002557_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3002619_3003819_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003829_3004708_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004814_3005852_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005932_3006337_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3006348_3007806_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3008448_3009045_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3009205_3009664_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3010441_3011413_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3011534_3011954_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3013245_3014466_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
